ID: 1172830263

View in Genome Browser
Species Human (GRCh38)
Location 20:37827936-37827958
Sequence TTAGAGGCCCAGAGATATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172830263_1172830266 -3 Left 1172830263 20:37827936-37827958 CCTTCATATCTCTGGGCCTCTAA 0: 1
1: 1
2: 0
3: 24
4: 242
Right 1172830266 20:37827956-37827978 TAAATCTCTTGTGTTTGGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1172830263_1172830264 -8 Left 1172830263 20:37827936-37827958 CCTTCATATCTCTGGGCCTCTAA 0: 1
1: 1
2: 0
3: 24
4: 242
Right 1172830264 20:37827951-37827973 GCCTCTAAATCTCTTGTGTTTGG 0: 1
1: 0
2: 1
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172830263 Original CRISPR TTAGAGGCCCAGAGATATGA AGG (reversed) Intronic
900774359 1:4570905-4570927 TTAGAGCCCTAGAGAAAGGAGGG + Intergenic
901284786 1:8068913-8068935 TTATAGGCCAAGAAAAATGAAGG + Intergenic
901537083 1:9889472-9889494 GCAGAGGCCCAGAGATGTGGAGG - Intronic
902028722 1:13404975-13404997 TTAGAGGCCCATAGGTATTTTGG + Intergenic
902459617 1:16563836-16563858 TTGGAAGCCCAGACATAGGATGG - Exonic
902531542 1:17093876-17093898 ATAGAGGCACAGAGACAGGAAGG + Intronic
902619235 1:17640981-17641003 TCTGAGGCCCAGAGATGTGCGGG + Intronic
903653222 1:24933457-24933479 TGTGAGGCCCAGAGAGAGGAGGG - Intronic
904340482 1:29830833-29830855 CCAGAAGCCCACAGATATGAGGG - Intergenic
906144748 1:43553250-43553272 CTAGAGGCCCAGAGAGGTTAAGG - Intronic
907247694 1:53118459-53118481 GTAAAGTCCCAGAGAGATGATGG - Intronic
907388487 1:54141165-54141187 TTCGTGGCCCAGAGACACGAGGG + Exonic
907552184 1:55313841-55313863 ATAGAGGCCCAGAGAGGGGAAGG + Intergenic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
907785683 1:57610422-57610444 TAAGAGGCCCAGAGTGATTATGG + Intronic
908963424 1:69729364-69729386 TTACAGGCTCACAGATATAAGGG - Intronic
913605971 1:120466306-120466328 TTGGAAGCCCAGACATAGGATGG + Intergenic
913644159 1:120840678-120840700 TTGGAAGCCCAGACATAGGATGG + Intronic
914082585 1:144422906-144422928 TTGGAAGCCCAGACATAGGATGG - Exonic
914177485 1:145291419-145291441 TTGGAAGCCCAGACATAGGATGG - Exonic
914210455 1:145573858-145573880 TTGGAAGCCCAGACATAGGATGG - Intergenic
914269381 1:146066211-146066233 TTGGAAGCCCAGACATAGGATGG - Exonic
914367714 1:146994660-146994682 TTGGAAGCCCAGACATAGGATGG + Exonic
914380500 1:147111714-147111736 TTGGAAGCCCAGACATAGGATGG - Intergenic
914380679 1:147113266-147113288 TTGGAAGCCCAGACATAGGATGG - Intergenic
914421261 1:147530207-147530229 TTAGAGCCCCAGAGATAGGCTGG - Intergenic
914485265 1:148103562-148103584 TTGGAAGCCCAGACATAGGATGG - Exonic
914532214 1:148532898-148532920 TTGGAAGCCCAGACATAGGATGG - Exonic
914585229 1:149055549-149055571 TTGGAAGCCCAGACATAGGATGG - Exonic
914636180 1:149554823-149554845 TTGGAAGCCCAGACATAGGATGG + Intergenic
915108270 1:153547528-153547550 TAGGAGGCCCAGAGATGTGAGGG - Exonic
915472390 1:156133776-156133798 GTACAGGCACAGAGGTATGAAGG - Intronic
915621633 1:157089742-157089764 TCACAGGCCCAGAGAGAAGAAGG - Intergenic
915830245 1:159122306-159122328 ATAGATGGCCAGAGAAATGATGG - Intronic
916370335 1:164086945-164086967 ACAGATGCCCAGAGATATCAGGG - Intergenic
918858490 1:189790556-189790578 TTAGAGAACCAGAGAGATAAAGG - Intergenic
920092536 1:203464723-203464745 TTAGAGACCCTCAGAAATGAAGG - Intergenic
920437654 1:205958236-205958258 ATAGAGGCAGAGAAATATGAAGG - Intergenic
923037529 1:230294826-230294848 TCACAGGTCCAGAGATAGGAAGG + Intergenic
923110940 1:230889529-230889551 TTGGAGTCTCGGAGATATGACGG - Intergenic
1063782449 10:9341532-9341554 TTTGAGGCCCAAAGACATGTAGG + Intergenic
1065351565 10:24800160-24800182 TTGGAGGACCAGAAATAAGAAGG - Intergenic
1066357325 10:34697697-34697719 ATAGAGGTCCAGATAGATGAGGG - Intronic
1066590191 10:36986340-36986362 TTATTGCCCCAGAGATAAGATGG - Intergenic
1067517393 10:46963419-46963441 ATGGAAGCCCAGAGATAGGAAGG + Intronic
1067644855 10:48088410-48088432 ATGGAAGCCCAGAGATAGGAAGG - Intergenic
1069425461 10:68284924-68284946 TTAGAGGCAGAGAAAAATGATGG - Intronic
1070195670 10:74154223-74154245 TGAGAGGCACAGAGATAGAAAGG - Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1074349886 10:112726268-112726290 TTAGAAGCCCAGAGATGAGCTGG - Intronic
1080761238 11:35250969-35250991 TTTAAGGCCCTGAGATTTGAGGG + Intergenic
1080824645 11:35837596-35837618 TTTGAGGCACAGAGATGTGTGGG + Intergenic
1084679791 11:70660167-70660189 AGAGAGGCCAAGAAATATGATGG - Intronic
1084679964 11:70661211-70661233 TTTGAGACCCAGAGCTCTGAGGG + Intronic
1084765740 11:71307171-71307193 TTAGGGGCACAGAGATATTAAGG - Intergenic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1086052271 11:82607232-82607254 TTAGATGTCCAGAGGTATGGGGG + Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1086889037 11:92235197-92235219 CAAGAGGCCCTGAGAGATGAGGG - Intergenic
1089402306 11:118171404-118171426 GCAGAGGCCCAGAGCTCTGAGGG + Intronic
1090024324 11:123154712-123154734 TTAGGGACCCAGAAAAATGAGGG - Intronic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1092205388 12:6611684-6611706 TTTGAGGCCCAGAGACAGGCTGG - Intergenic
1092771613 12:11902343-11902365 TCAGAGGCCCAGCGGGATGAGGG + Intergenic
1093186950 12:16030909-16030931 TTACAGACCCAAAGAAATGAAGG + Intronic
1093825416 12:23679858-23679880 TTAGATACCCAAAGATATCAAGG + Intronic
1094444659 12:30516538-30516560 TTAGAGGCACATAGATACCAGGG - Intergenic
1095192257 12:39271051-39271073 TTATAGGATCAGAGAAATGAAGG - Intergenic
1095338199 12:41055476-41055498 TTAGAATGCCAAAGATATGAGGG - Intronic
1095747050 12:45671342-45671364 TTAGAGGCCCAGAGAAAACATGG + Intergenic
1098524355 12:71469757-71469779 TTAAAGGCCCAGTGCCATGAAGG + Intronic
1101044343 12:100789111-100789133 TTAGAGGCTCAAAAATATAATGG + Intronic
1101724366 12:107376868-107376890 TGAGGGGCCCAGAGGTATAAGGG + Intronic
1101736021 12:107463940-107463962 ACAGAGGCCCAGAGAGATGAGGG - Intronic
1102470569 12:113157715-113157737 TGAGAGACCCTGAGATAGGAGGG + Exonic
1102544731 12:113646255-113646277 ATGGATGCCCAGAGAGATGAAGG + Intergenic
1103730959 12:123027517-123027539 CTCGAGGCTCAGAGATATCAAGG - Intronic
1108687038 13:52828726-52828748 TACGAGGCCCAGAGATTTGAAGG + Intergenic
1108715498 13:53074344-53074366 TTTGAGGCTCAGAGAGATAAGGG - Intergenic
1110513662 13:76383021-76383043 TCTGAGGCCCAAAGAGATGATGG - Intergenic
1110607173 13:77446397-77446419 TTAGAGGTCCTGACAAATGATGG - Intergenic
1112770767 13:102792619-102792641 GAAGAGACCCAGAGACATGAGGG + Intronic
1113049343 13:106191632-106191654 TTTTAGGCCCAGAGATTTTATGG - Intergenic
1121248368 14:92481236-92481258 TTAGATTCCCAGAGATATCTAGG + Intronic
1122120241 14:99549404-99549426 TGAGAGCCCCAGGGAGATGAGGG + Intronic
1126332796 15:47551583-47551605 TTGGAAGCACAGAGATATGAAGG - Intronic
1129065089 15:72895877-72895899 TTAGAGGAACAGAGAAAGGAAGG + Intergenic
1129979202 15:79851057-79851079 TTAGAGCCCAAGAGGTATGTGGG + Intronic
1130083606 15:80757580-80757602 TCAGAGGCCCAGAGAAATTAGGG - Intergenic
1130274193 15:82468102-82468124 GTTGAGGCCCAGAGATGGGATGG + Intergenic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1130588835 15:85200069-85200091 GTTGAGGCCCAGAGATGGGATGG + Intergenic
1134802468 16:17098285-17098307 TCTGAGGCCCAGAGAGATTAGGG + Intergenic
1135186926 16:20323334-20323356 TTAGGGGCACAGAGAGATTAAGG - Intronic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1137832530 16:51557703-51557725 GTAGAGGCCTGGAGATAGGATGG + Intergenic
1138298608 16:55908198-55908220 TCAGAGGCCCCAAGATGTGAAGG - Intronic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1140339920 16:74147495-74147517 TTAGAGATCCACACATATGAGGG - Intergenic
1140889169 16:79270506-79270528 TCAGAGGAGCAGAGAGATGATGG - Intergenic
1143068739 17:4271561-4271583 ATAGAGGCAGAGAAATATGAAGG + Exonic
1144596806 17:16576744-16576766 ATAGTGGCCCAGAGATAAGAAGG + Intergenic
1144737178 17:17561718-17561740 TGAGAGGCCCAGAGATATGAGGG + Intronic
1145078619 17:19875996-19876018 ACAGAGGCCCAGAGAGGTGAAGG - Intergenic
1146207910 17:30920721-30920743 TTGGAGGCTCAGAGAAGTGAAGG + Intronic
1147401222 17:40181038-40181060 TTAGGGGCCCAGAGACAGAAGGG - Intronic
1147904616 17:43814613-43814635 ATTGAGGCTCAGAGAGATGAAGG - Intronic
1149287129 17:55177123-55177145 TTATAGGTACAGAGATAAGAGGG - Intergenic
1149429371 17:56585103-56585125 ATTGAGGGCCAGAGAAATGAGGG - Intergenic
1151273340 17:73013913-73013935 GCAGAGGCCCAGCGATTTGATGG + Intronic
1151563078 17:74881188-74881210 ATAAAGGCCCAGAGAAATCAGGG + Exonic
1152286983 17:79418529-79418551 ATAGATGCCCAGACATGTGAAGG + Intronic
1153248395 18:3095988-3096010 TAAGAGGCCCAGAGTGATGAGGG + Intronic
1155349074 18:24888425-24888447 AGAGAGGCCAAGAGATATGGTGG - Intergenic
1156117088 18:33798547-33798569 ACAGAGGACCAGAGAAATGAAGG + Intergenic
1157408503 18:47444135-47444157 GAAGGGGCCTAGAGATATGATGG - Intergenic
1157526586 18:48387573-48387595 ATAGAGGCAAAGAGACATGAAGG - Intronic
1158183108 18:54740329-54740351 ATAGAGCCTCAGGGATATGAAGG + Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161722452 19:5910714-5910736 ACAGAGGCCCAGAGGTGTGAAGG + Exonic
1162582207 19:11538405-11538427 ATAGAGGCCCAGAGAGGAGAAGG + Intergenic
1165314824 19:35048533-35048555 GTTGAGGCTCAAAGATATGATGG + Intronic
1166302651 19:41921215-41921237 TCAGAGACCCAGAGAGATGGAGG + Intronic
1167459136 19:49615190-49615212 ATAGAGACCCAGAGACAGGAGGG + Intronic
1167471014 19:49676599-49676621 TGAGAGGCCCAGAGAGAGGAAGG - Intronic
1168478329 19:56694998-56695020 TTAGATGCTCAGAGACAAGATGG + Intergenic
1202675861 1_KI270711v1_random:6020-6042 TTGGAAGCCCAGACATAGGATGG - Intergenic
925371860 2:3351522-3351544 ATAGTGGCACAGAGATAGGATGG - Intronic
927862020 2:26565990-26566012 TCAGAGCCCCTGAGATTTGAAGG + Intronic
930064220 2:47315173-47315195 ACAGAGTCCCAGAGCTATGAAGG + Intergenic
930877999 2:56241482-56241504 TCAGAGGCCCAGAAAGATAATGG - Intronic
931833389 2:66074969-66074991 AAAGAGGCCCAGAGATAGGAAGG + Intergenic
932962072 2:76424550-76424572 TTAAAGGGGCAGAAATATGAGGG + Intergenic
933037985 2:77425384-77425406 TTAGGGGCCAAGTAATATGATGG - Intronic
933433922 2:82220508-82220530 GTAGAGGAATAGAGATATGATGG - Intergenic
933708371 2:85307866-85307888 TAAGAGGCTCTGAGATGTGAAGG + Intronic
935391836 2:102560881-102560903 TTTGAGGGACAGAGCTATGATGG + Intergenic
937389634 2:121473463-121473485 ATAGAGTCTCAGAGACATGAAGG + Intronic
937483975 2:122294384-122294406 GCACAGGCCCAGAGATATGAAGG + Intergenic
939907426 2:147934180-147934202 TTAGAGGCCCTGTGAGATGTAGG - Exonic
941575638 2:167226775-167226797 TTTCAGGCCCAGAGAGATGTGGG - Intronic
941601455 2:167547948-167547970 TTAGAATCCCAGAGTCATGAAGG - Intergenic
941793036 2:169573792-169573814 TTATAAACCCTGAGATATGAGGG - Exonic
945312423 2:208330107-208330129 TTAGATGGGCAGAGATATGAGGG - Intronic
945951395 2:216042088-216042110 TTAGAGGCCCAGACTTGTGATGG + Intronic
1170115602 20:12855692-12855714 ATAGAGGACCAGAAATAAGACGG + Intergenic
1171210955 20:23316570-23316592 TTAGTAGCCCAGAGATATCTGGG - Intergenic
1171230540 20:23480670-23480692 TTGGAGGGGCAGAGAGATGAGGG + Intergenic
1172594747 20:36143026-36143048 TTAGAGGCCAAGTGACAGGATGG - Intronic
1172830263 20:37827936-37827958 TTAGAGGCCCAGAGATATGAAGG - Intronic
1173289994 20:41706433-41706455 ATATAGGCACAGAGATATGTTGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174362374 20:50037084-50037106 TTAGTGCCCCTGAGATCTGAGGG - Intergenic
1179430617 21:41318615-41318637 TGAGAGGCCAGGAGAGATGAGGG - Intronic
1180975846 22:19847755-19847777 TTAGATGCCCAGAGTTGTGGAGG - Exonic
1181132894 22:20744125-20744147 ATGGAGGCCCACAGATGTGATGG + Intronic
1181568472 22:23753463-23753485 TTAAAGGCCCAGAGCTCAGAAGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183101698 22:35588135-35588157 TTAGAGGCACAGAGAGGTTAAGG - Intergenic
1183194767 22:36345810-36345832 ATTGAGGCCCAGAGATAGCAAGG - Intronic
1183383512 22:37502389-37502411 ATGGAGGCCCAGAGAAGTGAAGG + Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
949606632 3:5660579-5660601 TTAGAGGCCTTGAGATCTGAGGG + Intergenic
952401308 3:32966496-32966518 TTACAGGCCCATAGGTAAGAAGG + Intergenic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
954972541 3:54663396-54663418 TGAGAGGCCCAGGGCCATGAAGG - Intronic
955942499 3:64159528-64159550 TTAGAGGCCCTGAGACAGGAGGG - Intronic
959870682 3:111323940-111323962 TAAGATGCCAAGAGATATTAAGG + Intronic
960313837 3:116151430-116151452 TCAGAGGCCTAGAGATCAGAGGG + Intronic
962896807 3:139722939-139722961 CTAGATGCCAAGAGAAATGATGG + Intergenic
963504055 3:146162214-146162236 TCAAAGGCCCAGAGTTATAACGG - Intronic
964245120 3:154642719-154642741 TTATAGGCACAGAGATTTGGAGG - Intergenic
964382325 3:156110020-156110042 CTGGAGGCCCACAGATGTGAGGG - Intronic
966435723 3:179881870-179881892 TAAGATGCCCTGAGATACGAGGG + Intronic
967942162 3:194774475-194774497 TTAGAGGTCCTGGGATATGGTGG + Intergenic
969222352 4:5769475-5769497 TTAGAGGCCGAGAGACAGGGGGG - Intronic
969842677 4:9893769-9893791 GAAAAGGCCCAGAGATATCAGGG + Intronic
971541146 4:27818175-27818197 ATAGAGACACATAGATATGATGG + Intergenic
972988908 4:44799315-44799337 TTACAGGCTCATAGATAAGAAGG + Intergenic
973754271 4:54058011-54058033 TTAGTGGCCCTGAGGTATGTTGG - Intronic
973946598 4:55962884-55962906 TTTGAGCCACAGAGAGATGAAGG - Intronic
976384736 4:84443609-84443631 TCACAGGCCCAGAGAAATGTGGG + Intergenic
977233563 4:94480483-94480505 TTAGGGACCCAGAGAGATGATGG + Intronic
977614300 4:99070374-99070396 CTAGAGGGCTGGAGATATGAGGG - Intergenic
983817434 4:172149548-172149570 ACAGAGGCCCAGAGATAAGCAGG - Intronic
983904872 4:173171633-173171655 CAAGAGGCCCAGAGATGGGAAGG - Intronic
986277021 5:6285283-6285305 TAAGAGACCCAGAGAACTGAGGG + Intergenic
988502191 5:31792725-31792747 TTATAGGCCCAGATAAATAATGG - Intronic
990979244 5:61586863-61586885 TTAGAGCCTCTGAGATAAGATGG - Intergenic
991121005 5:63013394-63013416 AGAGAGGCCCATAGTTATGAAGG - Intergenic
991391402 5:66147599-66147621 TTAGAAGACCAGAGAAGTGACGG - Intronic
991669433 5:69033138-69033160 GATGAGGCCCAGAGATTTGAGGG - Intergenic
992639817 5:78759551-78759573 TTTGAGGCACAGAGATAAGAAGG + Intronic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994589174 5:101752605-101752627 TTAGAGGCCTAGACCTCTGATGG - Intergenic
995411246 5:111859533-111859555 TTAGAGGCCATGAGGGATGAAGG + Intronic
995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG + Intergenic
995733841 5:115276043-115276065 TGAGAAGCTCAGAGAAATGATGG - Exonic
996919406 5:128750120-128750142 TTAGAGACCCAGAGACATCAAGG + Intronic
997395050 5:133553065-133553087 TTCCAGGCCCAGAGACCTGATGG - Intronic
997782419 5:136673534-136673556 TAAGAGGCCCAGAAATGTAATGG - Intergenic
999583745 5:153067778-153067800 TTGGAGGCCCAGACAGATAAGGG + Intergenic
999734929 5:154506005-154506027 ACAGAGGCCCAGAGAGGTGAAGG + Intergenic
1001013167 5:168116940-168116962 TTAGAGGCCTTCAGAAATGACGG - Intronic
1001411086 5:171512456-171512478 ATGGAGGCTCAGAGAAATGAAGG - Intergenic
1001777947 5:174343359-174343381 TTAGAGGCCGAGGGATAGAATGG - Intergenic
1001951536 5:175820086-175820108 TTGGAGGCCCAGTGATGTGCAGG + Intronic
1002495144 5:179606617-179606639 TTAGATGCCCAGAGACATCAGGG - Intronic
1003164944 6:3669524-3669546 CCAGAGGCCCAGAGATAAGCTGG + Intergenic
1004105474 6:12663881-12663903 TTGGAGGCCCAGAGACATGCAGG - Intergenic
1008844077 6:55940419-55940441 GTAGAGGCAGAGAGTTATGAAGG - Intergenic
1009160973 6:60281894-60281916 TCAGAGGCCAAGAGAAAGGAAGG - Intergenic
1011357750 6:86489941-86489963 TTGGAAGACCAGAGACATGAAGG + Intergenic
1015533837 6:134247039-134247061 TAATATGCCCAGAGACATGATGG + Intronic
1015638370 6:135303643-135303665 TTGGAGGCCCAGAGTTACCAAGG + Intronic
1016410275 6:143775497-143775519 TCTGAGGCCCAGAGAGATTAAGG + Intronic
1017307912 6:152940542-152940564 TTCAAGGCCCAGAGGTAGGAGGG - Intergenic
1017558975 6:155606494-155606516 AGAAAGACCCAGAGATATGAGGG - Intergenic
1018398678 6:163401363-163401385 CTAGAGGCACAGAGCTATCAGGG + Intergenic
1018849761 6:167578492-167578514 TTAGAAGTCCAGAGGTCTGAGGG + Intergenic
1021491445 7:21223590-21223612 TTAGAGGACCAGTGATTTAAGGG - Intergenic
1023542093 7:41276431-41276453 GTAGAGGCCCAGATGTGTGAAGG - Intergenic
1023606495 7:41936191-41936213 CTAGGGGCTCAGAGAGATGAAGG + Intergenic
1026439916 7:70435161-70435183 TTAGAGGCCCAGAGAATAGAAGG - Intronic
1030146835 7:106365614-106365636 TTAGAGGCCCTGGAATATGTCGG + Intergenic
1031965034 7:128021653-128021675 TTAGAGACACAGGGAAATGAGGG + Intronic
1035022852 7:155809282-155809304 TTAGAGACCCAGAGACAGGGAGG + Intronic
1036489566 8:9212360-9212382 ATGGAGGCCCAGAGATATTAAGG - Intergenic
1036689921 8:10938952-10938974 TTAGAGGCCCATAAAAGTGAGGG + Intronic
1036782909 8:11662084-11662106 ATTGAGGCCCAGAGAAAAGAAGG + Intergenic
1037579871 8:20238799-20238821 TTGGAGGCCCAGCCAGATGAAGG + Intergenic
1037588246 8:20292872-20292894 ATAGAGGCCCAGAGAGGGGAAGG - Intronic
1038932092 8:32205117-32205139 TTAGAGGCTTAGAGATGTGTAGG + Intronic
1039758498 8:40548637-40548659 TAAGAGGTCCAGAGATAAGGGGG + Intronic
1042104631 8:65313262-65313284 TAAGAAGCTAAGAGATATGATGG + Intergenic
1044316183 8:90751824-90751846 TTAGAGGCCCAGAGAATTTGGGG + Intronic
1045197301 8:99944823-99944845 ATTGGGGCACAGAGATATGAGGG - Intergenic
1045565887 8:103314658-103314680 TTAGAGGACAATAGCTATGAAGG - Intronic
1046681689 8:117177630-117177652 TTAATGGCCCAGAAAGATGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1050366208 9:4876090-4876112 TTAGTGGCCCAGAACTATCAAGG - Intronic
1057024647 9:91725730-91725752 ATAGAGGCCGAGAGAGATGCAGG - Intronic
1057297210 9:93855492-93855514 CTAGAGCCTCAGAGATATGTGGG - Intergenic
1057302212 9:93893585-93893607 TTGAAGGCCCAGAGATATTTTGG + Intergenic
1057389536 9:94631203-94631225 TTCCAGCCCCAGAGATACGAAGG + Intronic
1057715195 9:97488219-97488241 TTTGAGGCCCAAAGAGTTGAGGG + Intronic
1059008818 9:110434057-110434079 GTAGAGGCCCAGAGATAGATGGG - Intronic
1060208312 9:121695535-121695557 TTTGAGGCCAAGCGATGTGAGGG + Intronic
1061589787 9:131590893-131590915 ACCGAGGCCCAGAGACATGAAGG - Intronic
1186427682 X:9476615-9476637 TTTGAGGCACAGAGGTATGTAGG + Intronic
1187376232 X:18757382-18757404 TTAGAGCCCAAGAGAAGTGAAGG - Intronic
1187561351 X:20406475-20406497 TTATAGGCCCAAAGGGATGAGGG - Intergenic
1188523474 X:31063533-31063555 TGAGAGGCCCAGAGACAGAAGGG + Intergenic
1188711850 X:33410720-33410742 TGAGAGGACCAAAGCTATGAGGG + Intergenic
1190879000 X:54479451-54479473 TTTGGGGCCCACAGCTATGAAGG + Intronic
1191959013 X:66679048-66679070 TTAAAAGACCAGATATATGAAGG + Intergenic
1192054783 X:67761893-67761915 ATGGAGGCCCAGAGATGTTAAGG - Intergenic
1192861103 X:75071643-75071665 TATGAAGCACAGAGATATGATGG - Exonic
1193317626 X:80082145-80082167 TTAGAGTCCTAGAAATATGTTGG + Intergenic
1194539018 X:95147039-95147061 TTAAAGGCACAGGGATAAGATGG - Intergenic
1195029789 X:100915155-100915177 CCAGAGGTCCAGAGAGATGACGG + Intronic
1196262628 X:113602286-113602308 TTAGTGGACCAAATATATGAAGG - Intergenic
1200073797 X:153541503-153541525 CGAGAGGCCCAGAGAGACGATGG - Exonic
1200384096 X:155871611-155871633 ACAGAGGACCAGTGATATGATGG + Intergenic
1201378913 Y:13351121-13351143 TTAGAGACCCAGATAATTGAAGG - Intronic