ID: 1172835349

View in Genome Browser
Species Human (GRCh38)
Location 20:37869737-37869759
Sequence GGCCTGAGCAAAGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2322
Summary {0: 1, 1: 0, 2: 8, 3: 164, 4: 2149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172835345_1172835349 -9 Left 1172835345 20:37869723-37869745 CCAGTGCCATTACTGGCCTGAGC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1172835349 20:37869737-37869759 GGCCTGAGCAAAGGAGGCTGAGG 0: 1
1: 0
2: 8
3: 164
4: 2149
1172835343_1172835349 -7 Left 1172835343 20:37869721-37869743 CCCCAGTGCCATTACTGGCCTGA 0: 1
1: 0
2: 1
3: 8
4: 188
Right 1172835349 20:37869737-37869759 GGCCTGAGCAAAGGAGGCTGAGG 0: 1
1: 0
2: 8
3: 164
4: 2149
1172835344_1172835349 -8 Left 1172835344 20:37869722-37869744 CCCAGTGCCATTACTGGCCTGAG 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1172835349 20:37869737-37869759 GGCCTGAGCAAAGGAGGCTGAGG 0: 1
1: 0
2: 8
3: 164
4: 2149
1172835340_1172835349 14 Left 1172835340 20:37869700-37869722 CCCGGAGGAGGTGTGGGACTTCC 0: 1
1: 0
2: 1
3: 21
4: 237
Right 1172835349 20:37869737-37869759 GGCCTGAGCAAAGGAGGCTGAGG 0: 1
1: 0
2: 8
3: 164
4: 2149
1172835341_1172835349 13 Left 1172835341 20:37869701-37869723 CCGGAGGAGGTGTGGGACTTCCC 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1172835349 20:37869737-37869759 GGCCTGAGCAAAGGAGGCTGAGG 0: 1
1: 0
2: 8
3: 164
4: 2149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172835349 Original CRISPR GGCCTGAGCAAAGGAGGCTG AGG Intronic
Too many off-targets to display for this crispr