ID: 1172835730

View in Genome Browser
Species Human (GRCh38)
Location 20:37871917-37871939
Sequence TGTTCTCTGCATACTCTAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172835730_1172835741 7 Left 1172835730 20:37871917-37871939 CCCCCTAGAGTATGCAGAGAACA 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1172835741 20:37871947-37871969 CGGCCGGAGCCCGGAGTTCCGGG 0: 1
1: 0
2: 1
3: 13
4: 119
1172835730_1172835740 6 Left 1172835730 20:37871917-37871939 CCCCCTAGAGTATGCAGAGAACA 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1172835740 20:37871946-37871968 ACGGCCGGAGCCCGGAGTTCCGG 0: 1
1: 0
2: 0
3: 4
4: 54
1172835730_1172835738 -9 Left 1172835730 20:37871917-37871939 CCCCCTAGAGTATGCAGAGAACA 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1172835738 20:37871931-37871953 CAGAGAACATCGGGGACGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 94
1172835730_1172835739 -2 Left 1172835730 20:37871917-37871939 CCCCCTAGAGTATGCAGAGAACA 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1172835739 20:37871938-37871960 CATCGGGGACGGCCGGAGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172835730 Original CRISPR TGTTCTCTGCATACTCTAGG GGG (reversed) Exonic
901590500 1:10337498-10337520 AGATATCTGCATACTCTGGGAGG - Exonic
902877151 1:19347561-19347583 TGTGCACTGCATACACTATGTGG + Intronic
903440079 1:23381169-23381191 TGTAATCTGCAAACTCTGGGAGG - Exonic
903689212 1:25159216-25159238 TGTTTTATGCATTCTCTAGTTGG - Intergenic
903933245 1:26876699-26876721 TGTTCTCTGCATATACTGAGGGG - Exonic
904069748 1:27784993-27785015 TGTTCTCTGCATATTCTCAGTGG - Intronic
904795873 1:33055991-33056013 TGGTCTCTGCTTACGGTAGGTGG + Intronic
905116559 1:35646266-35646288 TGTCCTCATCATCCTCTAGGTGG - Intergenic
905516227 1:38564047-38564069 TGTTCCCTGCACACTCCTGGAGG - Intergenic
911798416 1:102103054-102103076 TTTTCTCTTCATACTTTATGAGG + Intergenic
914224769 1:145711383-145711405 TGTACTCTGCATACCTTTGGAGG + Intergenic
918480989 1:184976323-184976345 TCTTCTCTCAATACTCTAGTTGG + Intergenic
919371618 1:196734555-196734577 TGGTCTCTGTTTACTTTAGGGGG + Intronic
920941267 1:210485262-210485284 TGTGTGCTGCATACCCTAGGAGG - Intronic
922071856 1:222202942-222202964 TATTCTCTGCAAAGCCTAGGAGG + Intergenic
923682479 1:236129298-236129320 AGTTCTCTGTCTACTCTAGTAGG + Intergenic
924674792 1:246164976-246164998 TGTTCTCTGCACACTGTCTGTGG - Intronic
1063293042 10:4771162-4771184 TGTTCTCTGCAGAGACTAGGAGG + Intergenic
1064669048 10:17689690-17689712 TTTTCTCTACCTATTCTAGGTGG - Intronic
1064821560 10:19340613-19340635 TGTACTCTGCATAGACTGGGAGG + Intronic
1065425397 10:25597999-25598021 TGTTCCCTGAAGACTCTGGGGGG - Exonic
1069531314 10:69221665-69221687 TGTAATCTGCATACACTGGGAGG + Intronic
1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG + Intergenic
1073940411 10:108691582-108691604 TGTACTCTGCATCCTCTGGAGGG + Intergenic
1074293165 10:112156716-112156738 TCTTTTCTGAATACTCTAAGAGG - Intronic
1077832744 11:5893010-5893032 TGATCTGTGCATCCTCTAGTGGG - Intronic
1078076664 11:8168612-8168634 AGGTCTGTGCATCCTCTAGGTGG - Intronic
1078725012 11:13922613-13922635 AATTCTCTGCATACTTTATGCGG - Intergenic
1081482679 11:43504245-43504267 TGTTCTCTGCAGGCCCTCGGTGG + Intergenic
1081851379 11:46277479-46277501 TCTTCTCTGAATGCTCAAGGTGG - Intergenic
1082847493 11:57738486-57738508 TGTGCTCTCCATTCACTAGGAGG + Intronic
1085278111 11:75312861-75312883 TGTCCTCTGGAAACTCTAGCGGG - Intronic
1089127488 11:116186955-116186977 TGTTATCTACATACTTTATGGGG + Intergenic
1089790746 11:120941785-120941807 CTCTCTCTGCAGACTCTAGGAGG - Intronic
1090309466 11:125721935-125721957 AGTTCTATGCATACTATTGGAGG - Intergenic
1091315339 11:134610473-134610495 TGTTTTCTGCCTGCGCTAGGAGG + Intergenic
1091558122 12:1591258-1591280 TGTTGTTTGTATACTCTAAGAGG - Intronic
1094769299 12:33635827-33635849 TCTTCTCCACAAACTCTAGGTGG + Intergenic
1096186023 12:49581099-49581121 TGCTCTCTGCACACCCTGGGAGG - Intronic
1097290664 12:57911916-57911938 TTTTCTCTGCATACTCTTCAGGG - Intergenic
1097997142 12:65900239-65900261 GCCTCTCTGCATTCTCTAGGAGG + Intronic
1098406193 12:70129125-70129147 TTTTCTCTGCATACTAGAGATGG + Intergenic
1101270793 12:103141853-103141875 TGTTCACTGTAGAATCTAGGTGG + Intergenic
1103233367 12:119351004-119351026 TGTTCTCTGGATTTTCCAGGAGG + Intronic
1104394090 12:128416831-128416853 TGTTTTCTGGATACGCTTGGAGG + Intronic
1104553997 12:129783438-129783460 TGTTCTAAGAATACTGTAGGAGG - Intronic
1104905974 12:132213743-132213765 TGGCCTCTGCATTCTCCAGGTGG + Intronic
1106197439 13:27506343-27506365 TGTTTTCTTTATACTCTAGATGG - Intergenic
1106360458 13:29026231-29026253 TCTTATCTGCATTCTCTAGAAGG - Exonic
1106511016 13:30412662-30412684 TGTTCTCTGTATATTTTAGCTGG + Intergenic
1106784241 13:33091354-33091376 TGTTGTGTGCATACCCTAGTGGG + Intergenic
1108795762 13:54028373-54028395 TGGTGTCTGCATACTGCAGGTGG + Intergenic
1108996568 13:56741231-56741253 TATTCTATGTATAATCTAGGAGG + Intergenic
1109827818 13:67745692-67745714 TGTTCTGAGCATATTCAAGGTGG + Intergenic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1116214301 14:41991416-41991438 TTGTCGCTGCATACTCTAGGGGG + Intergenic
1117206759 14:53451417-53451439 TAATCTCTGCCTACTCTTGGAGG + Intergenic
1118255570 14:64202281-64202303 TGTTCTCTGCTTACTCAGAGAGG + Intronic
1124172898 15:27392598-27392620 AGTACTCTGCATACTTTAGAAGG + Intronic
1127981684 15:64039927-64039949 TGTTTTCAGCATAATCTAGCTGG - Intronic
1129489132 15:75905818-75905840 TTTTCACGGCATACTTTAGGTGG + Intronic
1131981785 15:98001386-98001408 TGTGCTGTGCATACTGTGGGTGG + Intergenic
1131988496 15:98068528-98068550 TGTGCACTGCATACCCAAGGTGG - Intergenic
1133899205 16:9957540-9957562 TGTTCTCTGCATGCACTGGGTGG + Intronic
1134784299 16:16926994-16927016 TGTTGTCTGTCTACTCTAGCAGG + Intergenic
1137462040 16:48673249-48673271 TGTTACCTGCAAACTCTAGTGGG - Intergenic
1142907291 17:3052586-3052608 TGGTCTCTGCATCCCCTTGGGGG - Intergenic
1142927275 17:3251655-3251677 TGGTCTCTGCATCCCCTTGGGGG + Intergenic
1147775024 17:42894765-42894787 TGTTTTCTACATACTATAGATGG - Intergenic
1149359027 17:55873602-55873624 TGTTCTGTGCAGACTCCAGTTGG + Intergenic
1149817621 17:59741819-59741841 TGTACTCTACATACACTATGAGG - Intronic
1152557603 17:81061850-81061872 AGTCCTCTGTATACTCTAGATGG + Intronic
1154133713 18:11758188-11758210 TGTTCTCTGCCTTCTCAAGTGGG - Intronic
1154247611 18:12713630-12713652 TGTTCTCTGCAGACTCTACTTGG + Intronic
1154935305 18:21048804-21048826 TGTTATCTGAATACTTTGGGAGG - Intronic
1155313812 18:24551348-24551370 TGTTCTCTACCTGCTTTAGGAGG - Intergenic
1159322576 18:66872429-66872451 TCTGTTCTGCATACTCAAGGAGG - Intergenic
1164007080 19:21160107-21160129 TGTTATGTGCAGATTCTAGGTGG - Intronic
1166030891 19:40126790-40126812 TGTCCTATGAAGACTCTAGGGGG - Intergenic
1168074965 19:53975979-53976001 TGTTCTCTGCATTTTATAGGTGG + Intronic
925515124 2:4673455-4673477 TGTTCTTTGCATATTCTTGAGGG - Intergenic
926781474 2:16476314-16476336 CTTTCTCTGCATACTTTAGCTGG + Intergenic
926832241 2:16976298-16976320 GGATCTCAGCATACTCAAGGGGG + Intergenic
928682616 2:33717821-33717843 TGTTCTCTGCACACTGCAGGTGG - Intergenic
930171895 2:48260097-48260119 TGTTCATTGCAGAATCTAGGTGG + Intergenic
930631021 2:53755398-53755420 TGTTTTCTGCAAACTCTAACAGG + Intronic
931415414 2:62075969-62075991 TTTTCTCTGAATTCTGTAGGGGG + Intronic
937559413 2:123203529-123203551 TGTTCTCTGATTGCTCTAGCTGG + Intergenic
938560022 2:132463914-132463936 TGATGTCTTCATCCTCTAGGAGG + Intronic
939779938 2:146433457-146433479 TGGTCTCTGAATACTCTAAGTGG + Intergenic
942791455 2:179765929-179765951 TGTTTTATGAATACTCTGGGCGG - Intronic
942837460 2:180317017-180317039 TTTTTTCTGCAGGCTCTAGGGGG - Intergenic
944177920 2:196854151-196854173 TGTTCTCTGAGCACTTTAGGAGG - Intronic
945912136 2:215661568-215661590 TGTTGACTGCATTCTGTAGGTGG - Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947490933 2:230593909-230593931 TGTTGTGTGCATACTCTTGTGGG - Intergenic
948734655 2:239993928-239993950 TGCTCTCTGCATCCTCTGTGTGG - Intronic
948735218 2:239999286-239999308 CGTCCTCTGCATTCTCTGGGTGG + Intronic
1169447812 20:5687153-5687175 TGTGCTCTGAATGTTCTAGGGGG + Intergenic
1171236482 20:23529891-23529913 TGTTCTCTCCACACTATATGGGG - Intergenic
1172835730 20:37871917-37871939 TGTTCTCTGCATACTCTAGGGGG - Exonic
1173257363 20:41404382-41404404 TGTTGTCTACCTAGTCTAGGAGG - Exonic
1180324355 22:11355663-11355685 TGTTCTCTGCAGACTCTGCGAGG - Intergenic
1181287636 22:21765814-21765836 TGTTAACTGTATAATCTAGGTGG + Intronic
1182278985 22:29207283-29207305 TGTTGTCTGCACACAATAGGTGG - Intronic
1182282894 22:29227446-29227468 TGTAATCTCCATACTTTAGGAGG + Intronic
1182374207 22:29834527-29834549 TGGTCTCTGCATACACGAGGTGG + Exonic
1184474728 22:44714336-44714358 TGTCCTCTGCACACACTATGTGG - Intronic
1184893705 22:47394737-47394759 CGCTCTCTGCAGGCTCTAGGGGG - Intergenic
949606945 3:5663574-5663596 TATTCTCTGCAGCCTCTAGCAGG + Intergenic
952150554 3:30585338-30585360 TGTTTTCTGCATACTTAAGCTGG + Intergenic
954415266 3:50390391-50390413 TGTTCTCTTCATACCCTCAGAGG - Intronic
961064387 3:123862135-123862157 TGGTCTCTAAATACTCAAGGTGG - Intronic
963012889 3:140790243-140790265 TGTTCTTTATATACTCTAGATGG - Intergenic
963242922 3:143027853-143027875 TGTTTTTAGCATTCTCTAGGAGG + Intronic
968401178 4:299095-299117 TTTTATGTGCATATTCTAGGTGG + Intronic
970935068 4:21559689-21559711 CTTTCTCTGCATAGTCTAGAAGG - Intronic
973995475 4:56454348-56454370 GGTTCTGTGCAGACTCTAGTTGG + Intronic
974595888 4:64014180-64014202 TGTTTTTTGGATACTCCAGGAGG - Intergenic
977397541 4:96489546-96489568 TGTTCTGTGCAAACTCCAGTTGG + Intergenic
979268025 4:118725983-118726005 TGTTCTCTTCCTACTCTATAGGG - Intronic
979980310 4:127247101-127247123 TGTTCTGTGCAAACTCCAGTTGG - Intergenic
981866130 4:149421351-149421373 TGTTCTCTTCATATTTTTGGTGG - Intergenic
983031931 4:162813662-162813684 GGTTCTGTGCAGACTCTAGTTGG + Intergenic
984588020 4:181585266-181585288 TTTTCTCTGCATACTTAATGTGG - Intergenic
985968659 5:3357376-3357398 TGTTTTCTGCATAATCAAGTTGG - Intergenic
986851789 5:11821415-11821437 TGTTACCTGCACAATCTAGGTGG + Intronic
987800910 5:22695552-22695574 TGTTTTCTGCATATGCTAGCCGG - Intronic
997028154 5:130090544-130090566 CTTTCTCTGCACACTCCAGGTGG + Intronic
997164605 5:131646520-131646542 TGTTCTCTGGCCACTTTAGGTGG - Intronic
1003293776 6:4805758-4805780 TGTTCTCTCCAGGCTCTAAGTGG + Intronic
1004066580 6:12251686-12251708 TGTTCTGTGCAAACTCCAGCTGG - Intergenic
1005410413 6:25539346-25539368 AGTTCTCTGCATACACTAAATGG - Intronic
1008360719 6:50614513-50614535 TTTTCTCTGCATATTTAAGGTGG - Intergenic
1010700160 6:79035003-79035025 TGTTCTGTGCAGACTCCAGTTGG - Intronic
1010872680 6:81061719-81061741 TCTCTTCTGGATACTCTAGGAGG + Intergenic
1010895173 6:81353114-81353136 TTTTCTCTGCTTACTATAGGAGG - Intergenic
1013308472 6:108871749-108871771 TGTTGTCTGCATGCTCTGGGAGG + Intronic
1016037514 6:139398164-139398186 TGTAATCTGAATACTCTGGGAGG + Intergenic
1019323702 7:427013-427035 TGTTCTCTTATTACTCTGGGCGG - Intergenic
1019574455 7:1729683-1729705 AGGTCTCTGCAGACTCCAGGTGG + Intronic
1019871147 7:3763408-3763430 TGTTCGTTGCAGAATCTAGGTGG - Intronic
1019900466 7:4016567-4016589 TGTTCTTAGCATACTAAAGGTGG - Intronic
1022348420 7:29540603-29540625 TTTTCTCTGCATCCTCTTTGAGG - Intergenic
1024242722 7:47447981-47448003 TCTTCTCTGCCTTCTTTAGGTGG - Intronic
1029928350 7:104342893-104342915 TGTTCTCTGCACACTATGTGTGG - Intronic
1041940511 8:63382145-63382167 TGTTCTCTGCATGCTGTGGGAGG + Intergenic
1042180731 8:66085070-66085092 TGTTCTCTGTATCCTCTACATGG + Intronic
1046615215 8:116469806-116469828 TGGTCTCTGCATACTGGGGGAGG - Intergenic
1047413413 8:124643046-124643068 TTTTCTCTGCATAATTAAGGGGG + Intronic
1049028509 8:140014572-140014594 TGGTCTCTGCACTCCCTAGGGGG - Intronic
1051694458 9:19753097-19753119 TTTTCTTTGCATACTCTAGCTGG + Intronic
1052204801 9:25826989-25827011 TGTTTTTTGCAGACTCAAGGAGG + Intergenic
1052788761 9:32854496-32854518 TGCCCTCTGCATACTCTGAGGGG + Intergenic
1052924235 9:34001305-34001327 TGTTCTTTGGACACACTAGGAGG - Intronic
1055972676 9:81927573-81927595 TGTTCTGTGCAAACTCCAGTTGG - Intergenic
1055974429 9:81942645-81942667 TGTTCTGTGCAAACTCCAGTTGG - Intergenic
1060027844 9:120188004-120188026 GGTTCTGTGCAGACTCTAGTTGG + Intergenic
1061884442 9:133584546-133584568 CGTTCTCTGCCTACCCTTGGAGG - Intronic
1062114427 9:134800432-134800454 GCTTCTTTGCAAACTCTAGGAGG - Intronic
1192786267 X:74338920-74338942 TGTAATCTGAATACTTTAGGAGG - Intergenic
1193272226 X:79543165-79543187 TGTTCTCTGCATACTCCAAAGGG + Intergenic
1195620030 X:106943596-106943618 TGTTCTCTGCATACTCTTCTAGG - Intronic
1196088664 X:111714697-111714719 TGTTAACAGCAGACTCTAGGTGG - Intronic
1196578307 X:117348113-117348135 TGACCACTGAATACTCTAGGTGG - Intergenic
1196752455 X:119130203-119130225 TGTTCTCTGCCCACTGGAGGGGG + Intronic
1197012179 X:121579210-121579232 TCTGCACTGCAAACTCTAGGGGG - Intergenic
1197329054 X:125131342-125131364 TGTTCTCTTTATTCACTAGGTGG - Intergenic
1197709550 X:129655550-129655572 TGTTCCCTGCATCCCCCAGGAGG + Intergenic
1198334429 X:135652892-135652914 TGTTATCTACATACTGTAGGTGG - Intergenic
1198560683 X:137847019-137847041 TGTTCTTTGGATACTCAAGCAGG + Intergenic
1199580423 X:149354822-149354844 TGTTCTTTGCTTATTCAAGGAGG - Intergenic
1202028171 Y:20546588-20546610 TGTACTATGCCTACTCTTGGTGG - Intergenic