ID: 1172845300

View in Genome Browser
Species Human (GRCh38)
Location 20:37926657-37926679
Sequence ACAAGGCATTTGGACACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172845294_1172845300 16 Left 1172845294 20:37926618-37926640 CCTGCAATTACTTTTGCACTAAC 0: 7
1: 74
2: 177
3: 167
4: 219
Right 1172845300 20:37926657-37926679 ACAAGGCATTTGGACACTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1172845295_1172845300 -6 Left 1172845295 20:37926640-37926662 CCTATAGCTCTACCAGCACAAGG 0: 1
1: 0
2: 0
3: 1
4: 102
Right 1172845300 20:37926657-37926679 ACAAGGCATTTGGACACTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172845300 Original CRISPR ACAAGGCATTTGGACACTCT GGG Intronic
901105595 1:6753565-6753587 GAAAGGCAATTAGACACTCTAGG - Intergenic
905969667 1:42131949-42131971 AAAAGGCATGTGGACCCTCTTGG + Intergenic
907780611 1:57562814-57562836 AGATTGCATTTGGACACTTTGGG + Intronic
910686035 1:89917558-89917580 ACAGGGCCTTTGCACATTCTGGG + Intronic
912157385 1:106938555-106938577 ACAAGGAAATTGGAAATTCTGGG - Intergenic
912861773 1:113219839-113219861 ACCAGGCCTGTGGTCACTCTGGG - Intergenic
914919773 1:151839028-151839050 AGACGGGATTTGGACCCTCTCGG - Exonic
916128104 1:161589156-161589178 CAAAGGCATTTGGACACTAGTGG - Intronic
918463716 1:184800985-184801007 GCAAGCCATTTGGAAACCCTTGG - Intronic
1062851966 10:750930-750952 AGAAAGCATTTGGACCTTCTGGG + Intergenic
1064725186 10:18272085-18272107 AGAAGTCAATGGGACACTCTGGG - Intronic
1065268757 10:24004898-24004920 ACAAGGCTTCTGGTCACTCCTGG - Intronic
1065821978 10:29534058-29534080 AGAAGGCATGTGGCCAGTCTGGG + Intronic
1066011340 10:31196504-31196526 ACCAGGCATTCAGACACTGTTGG - Intergenic
1067234764 10:44438181-44438203 ACAAGGCATTTGGGATGTCTTGG + Intergenic
1068560527 10:58510611-58510633 ACAAGGAATTAGGACTCACTGGG - Intergenic
1070379576 10:75868696-75868718 ACCAAGCATCTGGACACACTGGG - Intronic
1070898435 10:80005986-80006008 TCAAGGCATTTGTACTCTCCTGG - Intergenic
1075237601 10:120745184-120745206 CCTAGGCTTTTGTACACTCTGGG + Intergenic
1077661412 11:4071845-4071867 ACTAGGAATTTTGACACTCCAGG + Intronic
1078361180 11:10669052-10669074 ACCATCCATTTGTACACTCTTGG - Intronic
1079520233 11:21317795-21317817 ACAAGGCATTTATAGTCTCTGGG + Intronic
1082006813 11:47423872-47423894 GCAAGGCATTTAAACTCTCTGGG + Intronic
1083243089 11:61404219-61404241 GCAAGGGGTTTGGACCCTCTTGG + Exonic
1086059580 11:82686787-82686809 ACAAGACATTTACAAACTCTGGG + Intergenic
1086476531 11:87180853-87180875 ATATTGCATTTTGACACTCTTGG - Intronic
1087292912 11:96339710-96339732 TCAAGGCATTTAGATACTTTTGG + Intronic
1088438122 11:109838258-109838280 ACAAAGCATATGCACACGCTGGG - Intergenic
1088598616 11:111457255-111457277 ACAAGGCAGTGGCTCACTCTTGG + Intronic
1089709500 11:120305025-120305047 ATCAGGCATTTGGGCACCCTGGG + Exonic
1092227069 12:6754181-6754203 TCAGGGCATTTGGACTGTCTAGG + Intronic
1094469918 12:30794323-30794345 AAAAGGCATTTGGACAGCCCTGG - Intergenic
1094648740 12:32353353-32353375 ACAAGGCATTTTCAAACACTTGG + Intronic
1094737001 12:33246032-33246054 GCAAGGTATTTGGACAATGTGGG + Intergenic
1097141868 12:56908853-56908875 ACCAGGCATTTTTGCACTCTTGG + Intergenic
1098757263 12:74381152-74381174 ACAAGAGATTTGGATACTTTTGG - Intergenic
1102156049 12:110728951-110728973 ACACTGCATCTGGAGACTCTAGG + Intronic
1102582285 12:113897464-113897486 ACAAGTCATTTAAACACTCTGGG - Intronic
1104370559 12:128220365-128220387 ACAAGACAGTGGGACTCTCTTGG + Intergenic
1106080879 13:26499443-26499465 AAAAGGTCTTTGGACACTTTGGG + Intergenic
1110382389 13:74868119-74868141 ATAAGGCATTTGCACACTTAAGG - Intergenic
1112051809 13:95650098-95650120 AACAGTCATTTGGCCACTCTCGG + Intergenic
1114290660 14:21285794-21285816 AAAAGCCATTTGGAGACTTTTGG + Intergenic
1114344004 14:21776757-21776779 ACAAGTCATCTGCACACTCCAGG - Intergenic
1115449021 14:33524865-33524887 AGAAGACATTTGGACACACACGG - Intronic
1126563307 15:50068423-50068445 ACAAGGCATTTGCAGATTCTAGG + Intronic
1127913605 15:63437763-63437785 AAAATGCATTTGGGGACTCTTGG + Intergenic
1130540935 15:84820355-84820377 AAAAGGCCTTTGGACAGTCCTGG - Intronic
1133071457 16:3249377-3249399 GCCAGGCACTTGGACACACTGGG - Intronic
1133125947 16:3646145-3646167 AGGTGGCACTTGGACACTCTGGG - Intronic
1133731498 16:8582198-8582220 ACAAGGCATTTGACCTCTCTGGG + Intronic
1135233488 16:20732008-20732030 ACAAGGCAGTTGGCCATTCTTGG - Intronic
1135604395 16:23810630-23810652 CCCAGGCATTTGGACCCTTTGGG - Intergenic
1140750419 16:78018458-78018480 ACAAGGCATTTGGCCAACCAAGG - Intergenic
1144468425 17:15515730-15515752 AGAAGACATTTGGAGACCCTAGG - Intronic
1148514762 17:48206204-48206226 TCAAGGCATTTGCCAACTCTAGG + Intronic
1149407948 17:56374137-56374159 ACAAGGAATTTGGCCACTTGGGG + Intronic
1151895238 17:76975642-76975664 AAAAGGCAATTAGAAACTCTAGG + Intergenic
1153170189 18:2307643-2307665 ACAAGGCATCGGGACTCTCAAGG + Intergenic
1156671722 18:39478576-39478598 ACATGGCATTTCCACATTCTTGG - Intergenic
1160432637 18:78822458-78822480 ACATTTCATTTGGACACTGTAGG + Intergenic
1166999900 19:46739556-46739578 ACAGGTCATTTGGAGACACTGGG + Intronic
1167821859 19:51935644-51935666 ACCAGGCATGTGGACACACGTGG + Intronic
925885618 2:8391796-8391818 ACAAGCCGTGTGGACACTGTGGG + Intergenic
930822957 2:55666208-55666230 AAAAGGCATGAGGAAACTCTTGG + Intronic
933625291 2:84590849-84590871 ACATGGCATTCTGACACTTTAGG + Intronic
943537500 2:189170714-189170736 GCAAGGCAGCTGGATACTCTTGG + Intronic
945807528 2:214508602-214508624 AAAAGGAAATTGGAAACTCTAGG - Intronic
947743077 2:232493841-232493863 ACAAGGCAATAGGAAAATCTAGG - Intergenic
1170520326 20:17178517-17178539 ACACGTCATCTGGAGACTCTAGG - Intergenic
1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG + Intergenic
1172845300 20:37926657-37926679 ACAAGGCATTTGGACACTCTGGG + Intronic
1176887855 21:14277408-14277430 AAAAGTCATTTGCACATTCTTGG + Intergenic
1184873421 22:47257064-47257086 ACACGGCACTTGGACACTTAGGG - Intergenic
949510071 3:4759749-4759771 AAAAGGCATTTGGAAACTGCTGG + Intronic
951313936 3:21165067-21165089 ACAAGTTATTTAGACCCTCTAGG + Intergenic
951599833 3:24361492-24361514 AGGAGGCATTTGGAAATTCTGGG + Intronic
952625473 3:35397502-35397524 ACAGGTCATTTGGAGAATCTGGG - Intergenic
958903099 3:99911409-99911431 ACAAGGCCTGTATACACTCTAGG + Intronic
960194615 3:114749775-114749797 ACAAGTCATTTAGCCTCTCTAGG + Intronic
960743768 3:120863433-120863455 ACAAATCATGTGAACACTCTCGG - Intergenic
962408845 3:135123659-135123681 ACAAGACATTCTGTCACTCTGGG + Intronic
962951743 3:140226011-140226033 CCAAGGCATTTTCACACCCTAGG - Intronic
963959626 3:151294793-151294815 TCAAGCCATTTGGGGACTCTCGG - Exonic
964245280 3:154644697-154644719 ACAAGGCATTTGCCAATTCTAGG - Intergenic
964731271 3:159867873-159867895 AGAAGACATTTTGGCACTCTGGG - Intronic
967889813 3:194357016-194357038 CCAAGGCATTTCCACACTATTGG - Intronic
970784796 4:19783147-19783169 TTAAGGCATTGGGAGACTCTTGG - Intergenic
971431582 4:26573624-26573646 ACAAGGTAGTTGGAAAGTCTTGG - Intergenic
975515330 4:75241216-75241238 ACAGGGCATAAGGAAACTCTTGG - Intergenic
975627414 4:76363589-76363611 ACAAGACACGTGGACAGTCTGGG + Intronic
977561569 4:98538218-98538240 ACAATGACTTTGGACACTTTAGG + Intronic
978643828 4:110904905-110904927 ACACAGCATTTTTACACTCTTGG - Intergenic
981054431 4:140345771-140345793 GCAAGGCATTTAGACTCTCTGGG - Intronic
983255204 4:165391554-165391576 ACCAGGCATTTGGAAATTCCAGG + Intronic
985439507 4:189970241-189970263 ACATGGCATTTGTACAAGCTAGG + Intergenic
986357888 5:6946853-6946875 CCAATGCATTTGGAGACTCAGGG + Intergenic
987959679 5:24789865-24789887 ACAAGGCATTTAGTCACTTTGGG + Intergenic
988499630 5:31773799-31773821 ACAAGTCACTTGGGCTCTCTGGG + Intronic
990591470 5:57269580-57269602 ACTAGGCCTTTGGAAACTCAAGG + Intergenic
993349546 5:86831559-86831581 ACAATGCATCTGGTCACTCAAGG - Intergenic
994320880 5:98393063-98393085 AGGAGGCAGTTGGAGACTCTGGG - Intergenic
1001673607 5:173494197-173494219 ACAAGGCATTCAGGCACTTTGGG - Intergenic
1005342827 6:24859128-24859150 ACAAGTCATTTAGCCTCTCTAGG + Intronic
1006501129 6:34459506-34459528 ACAATGCATGTGGAGGCTCTTGG + Intergenic
1007496179 6:42261475-42261497 CCAAGCTATTTGGACACTTTGGG + Intronic
1007965177 6:45997958-45997980 TCAAGGCACTTGGCCTCTCTGGG - Intronic
1011872538 6:91914067-91914089 ACAAGGAGTTTGGAGATTCTTGG - Intergenic
1012493564 6:99809868-99809890 AGAAGGCATTAGGACAATCCAGG - Intergenic
1013876830 6:114841468-114841490 ACAAAGCATGTGGACAATCTTGG - Intergenic
1020468805 7:8512073-8512095 CCAACTCATTTGGACACTCAGGG - Intronic
1022737907 7:33093190-33093212 ACAAGTGATGTGGACACTGTTGG - Intergenic
1023534002 7:41188577-41188599 ACAAGGGATTTTGCAACTCTTGG - Intergenic
1024938699 7:54739883-54739905 ACAAGGCACCGGGACACACTAGG + Intergenic
1028938285 7:96490071-96490093 CCAAGGCAGTTGGACACACATGG - Intronic
1029563366 7:101318911-101318933 CCGAGCCAGTTGGACACTCTGGG + Intronic
1030570190 7:111213086-111213108 CCCAGGCATTTCTACACTCTTGG + Intronic
1031888433 7:127265252-127265274 TGAAGGCATTTGAACACTCAAGG - Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1035884532 8:3277723-3277745 AGAAGGCAGGTGGACACTCAGGG + Intronic
1037588434 8:20294271-20294293 ACCAGGCATTTGGCTTCTCTGGG - Intronic
1042658855 8:71131964-71131986 ACATGGCATTTGTTGACTCTGGG + Intergenic
1043020275 8:74991475-74991497 ACAAGGGAGTTGACCACTCTGGG - Intronic
1047307272 8:123663033-123663055 AAAAGGCCTTTGGACAAGCTTGG - Intergenic
1047663512 8:127064702-127064724 ACATGGTATTTGGACAGCCTAGG + Intergenic
1048215240 8:132488016-132488038 AGAAGACATTTGGACACACAAGG - Intergenic
1049200627 8:141338624-141338646 ACAAGGCCCTAGGACACTCAGGG - Intergenic
1051382738 9:16475034-16475056 AAAAGGCTTTTCCACACTCTAGG + Intronic
1051880024 9:21830460-21830482 ACAAGTCATTTGGCCACTGAGGG + Intronic
1058625997 9:106933201-106933223 ATAATGCGTTTGGACAGTCTTGG + Intronic
1060202964 9:121662741-121662763 ACAATGCAATTCGACACACTTGG - Intronic
1060693421 9:125685345-125685367 ACAAGCCATGTAGACACTCCAGG + Intronic
1062371663 9:136242408-136242430 AGAAGGCGGCTGGACACTCTAGG + Intronic
1185817165 X:3166821-3166843 ACAAAACATTTGGCCACGCTGGG - Intergenic
1187659078 X:21518233-21518255 ACATGGCAATAGGAAACTCTAGG - Intronic
1188482611 X:30650781-30650803 ATAAGGCATTTGAGCATTCTCGG - Intergenic
1189419478 X:40843890-40843912 CCCAGGGAATTGGACACTCTTGG + Intergenic
1191720102 X:64222309-64222331 AGAAGGCACATGGACACTCTGGG - Intergenic
1193779024 X:85680332-85680354 ACCAAGCATGTGGACAATCTTGG + Intergenic
1194862331 X:99015822-99015844 ACAATGCACTTGGTCACTCAAGG + Intergenic
1196609241 X:117692303-117692325 AGAAGGCATTTAGAAGCTCTTGG - Intergenic
1201264173 Y:12190124-12190146 ACAAAACATTTGGCCACTCTGGG + Intergenic