ID: 1172847440

View in Genome Browser
Species Human (GRCh38)
Location 20:37938330-37938352
Sequence TTGGGTTCTGAACATGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172847434_1172847440 0 Left 1172847434 20:37938307-37938329 CCCAGGTCTGGGGAGAACCTGAG 0: 1
1: 0
2: 1
3: 42
4: 1069
Right 1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG 0: 1
1: 0
2: 3
3: 13
4: 156
1172847435_1172847440 -1 Left 1172847435 20:37938308-37938330 CCAGGTCTGGGGAGAACCTGAGT 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG 0: 1
1: 0
2: 3
3: 13
4: 156
1172847432_1172847440 10 Left 1172847432 20:37938297-37938319 CCTTCTGGGGCCCAGGTCTGGGG 0: 1
1: 0
2: 2
3: 50
4: 427
Right 1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG 0: 1
1: 0
2: 3
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172847440 Original CRISPR TTGGGTTCTGAACATGCTGA GGG Intronic
903058716 1:20654661-20654683 TTTGGTGCTGGACATCCTGACGG - Exonic
904813386 1:33178712-33178734 TTGGGTTCCAAACCTGCTGTGGG - Intronic
908458102 1:64323697-64323719 TTGGTTTCTGAGGATGCTTAGGG - Intergenic
915526476 1:156479404-156479426 TTGGGGACTGAACATGAAGAGGG + Intronic
919219764 1:194611989-194612011 TAGTGTTCAGAACATACTGAGGG + Intergenic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
921105791 1:211976441-211976463 ATGGGTTCTGAAGATGAGGAAGG - Intronic
924289384 1:242523277-242523299 TTGGTTTAAGAAGATGCTGATGG + Intronic
1064056275 10:12100241-12100263 TTGGGTTCTTTACTTGCTCAAGG + Exonic
1068340948 10:55701875-55701897 TAGAGTTCTGAACATTATGAAGG + Intergenic
1076095715 10:127733892-127733914 TTGAGATCTGCAAATGCTGATGG + Intergenic
1078525240 11:12095822-12095844 TTAGCTTCTAAACATGCTCAAGG + Intronic
1080892000 11:36417148-36417170 TTGGGTACTCATGATGCTGAGGG - Intronic
1087819145 11:102691413-102691435 ATGGGTTCAGAACATGCATAGGG + Intergenic
1087927173 11:103932363-103932385 ATGCGTTCTGAACATGTTTAAGG + Intronic
1088664097 11:112076894-112076916 TTTGGTTTTCAACATGTTGATGG + Intronic
1088751036 11:112842264-112842286 GTGGGTTGGGATCATGCTGAGGG + Intergenic
1091556239 12:1575663-1575685 TTGGCTTCTGCCCATGCTGTGGG + Intronic
1092277474 12:7072669-7072691 TTGGGTTCTGCCCTTGCTGATGG + Intergenic
1093312600 12:17608954-17608976 TAGGGTTTAGAACGTGCTGAAGG + Intergenic
1093591185 12:20904346-20904368 TTGGGTTCTGAACTTGCATGGGG - Intronic
1095813624 12:46397774-46397796 TGGGGTTCTGAACAGAGTGATGG + Intergenic
1097636818 12:62133116-62133138 TTGGGTTGTGACAATGCTGGGGG - Intronic
1098574540 12:72026276-72026298 TTGGGTTTTGAAAAAGCTGATGG + Intronic
1098998911 12:77153943-77153965 TTGTCTTCTGGAGATGCTGATGG + Intergenic
1099155790 12:79174327-79174349 GTGGCTTCAGAACATGCTGTTGG + Intronic
1100036884 12:90262513-90262535 TTGAGAGCAGAACATGCTGAAGG - Intergenic
1100872153 12:98921299-98921321 TTAGGCTATGAACTTGCTGAGGG - Intronic
1101139673 12:101782484-101782506 TTGGATTCTGGACATTTTGAAGG - Intronic
1102633150 12:114299768-114299790 TAGGGTTCTGAACACACTGAAGG - Intergenic
1102738473 12:115184714-115184736 TTGGGTTCTGGAGATGCAGCAGG - Intergenic
1102966347 12:117130654-117130676 TTTGGTTCTGAAGCTGCCGATGG + Intergenic
1103010149 12:117451966-117451988 TTGGGTTCTGAACTTGGGGTGGG + Intronic
1104311818 12:127660183-127660205 TTAGGTGCTGAAATTGCTGAGGG - Intergenic
1105070201 12:133229730-133229752 TTGGGTTATGACCATGCTGATGG - Intronic
1107665560 13:42686317-42686339 TTGTGTTCTGAACATCAGGAAGG + Intergenic
1109334270 13:60972434-60972456 TTGGGTTGTGAACTTGATGCAGG + Intergenic
1111724314 13:91985862-91985884 TTGTGTTCTGAAAATTCTTAGGG + Intronic
1112732500 13:102381002-102381024 ATGTGTTCTGAACATGTTTAAGG - Intronic
1113557118 13:111246358-111246380 TTAGGTTTTGAACGTGGTGAGGG + Intronic
1113574191 13:111382602-111382624 TGGGGTTGTGGAGATGCTGAGGG + Intergenic
1114644057 14:24243823-24243845 TTAGGTTCTGTGCTTGCTGATGG - Intergenic
1118055262 14:62073320-62073342 CTGGGTTCTACACATGTTGATGG + Intronic
1123769303 15:23512629-23512651 TTGGGTTTTGGACTTGCTTAGGG - Intergenic
1125102434 15:35930072-35930094 CTGCCTTCTGAAGATGCTGATGG + Intergenic
1125490210 15:40141765-40141787 TTGTGGTCTGAACAAGCAGAAGG - Intergenic
1126994895 15:54430465-54430487 TTGCTTTCTTATCATGCTGAAGG + Intronic
1131075346 15:89492055-89492077 TTGGGTTGGCAACTTGCTGAGGG + Intronic
1131117285 15:89803182-89803204 TTGGGGTCTTGAGATGCTGAAGG - Intronic
1135068686 16:19333397-19333419 TTGGGTTCTGATCATTCTTTTGG + Intergenic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1136025571 16:27466183-27466205 TTGGGTTTTTTACATACTGAAGG + Intronic
1136291233 16:29272704-29272726 TTGGGTTATGAACATGGGCAAGG - Intergenic
1137400694 16:48152145-48152167 TTGGGTACAGAAAATTCTGAAGG - Intronic
1137966685 16:52941685-52941707 GTGAGTTCTCAATATGCTGATGG + Intergenic
1141580338 16:84993750-84993772 GTAGGTTCAGAAAATGCTGAAGG - Intronic
1142919154 17:3169470-3169492 TTGGGTTCTGACCCAGCTGCTGG - Intergenic
1147732958 17:42615261-42615283 TTGGGTTCTGGAGATGCGGTGGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148346386 17:46906176-46906198 CTGGCTTCTGACCAGGCTGATGG + Intergenic
1152257797 17:79250342-79250364 CTGGGTTCTGTTCATGCAGAAGG + Intronic
1152799013 17:82322508-82322530 CTGGGTTCTGAAACTGCTGGAGG + Intronic
1153452246 18:5242531-5242553 AAGTGTTCTGAACATGTTGAAGG + Intergenic
1154277603 18:12975890-12975912 TTGGTTTCTGACCTAGCTGATGG + Intronic
1156199156 18:34810303-34810325 TTGTGTCCAGAAGATGCTGAGGG - Intronic
1157942809 18:51947400-51947422 TTGGGGTCAGGACATTCTGAGGG + Intergenic
1160071160 18:75629112-75629134 TTGTGTTTTGACCATGCTTAAGG + Intergenic
1162855017 19:13461463-13461485 TTGTGTCCTTAACATGCTCATGG - Intronic
1164797472 19:31045698-31045720 TTGGCTTCTGAACATGTTCAAGG - Intergenic
1167068511 19:47205255-47205277 TTGGGGTCTGTACATTCTGGAGG + Intronic
1167535479 19:50048366-50048388 TTAGGTGCTGAAAATGGTGAGGG + Exonic
1168726790 19:58587738-58587760 TTTCCTTCTGGACATGCTGATGG - Intergenic
926566330 2:14478873-14478895 TTGGATTCTGTACATGCTATGGG + Intergenic
927355299 2:22166285-22166307 TTGATTTCTGCACATGGTGAAGG + Intergenic
929464623 2:42133473-42133495 CTGGGCTCTGAACGTGCTGCTGG + Intergenic
934761485 2:96859324-96859346 TGGGGTTCTCAACCTGCTTAGGG - Intergenic
935725076 2:106016811-106016833 ATGTGTTCTGAGCATGTTGAAGG + Intergenic
936263294 2:110980279-110980301 ATGGGTTCTGCATATGGTGATGG + Intronic
936571765 2:113623468-113623490 TTTCCTTCTGGACATGCTGATGG + Intergenic
938243486 2:129760649-129760671 TGGGCTTCTGAACATGTTCAAGG - Intergenic
938276372 2:130028386-130028408 CTGGGTTCTGAAGTTGCTGGTGG + Intergenic
938712865 2:133990471-133990493 CTGGATTCTGAACAAGCTGAGGG + Intergenic
938830426 2:135044781-135044803 TTGGGTTCTTATCAGGCAGAGGG - Intronic
941062505 2:160864067-160864089 TAGGATTCTTAGCATGCTGAAGG + Intergenic
941658925 2:168174575-168174597 TTGGGCTCTAAAAGTGCTGAGGG + Intronic
945902310 2:215552798-215552820 TTTGGTGCTGAATATACTGAGGG - Intergenic
946640470 2:221778319-221778341 ATAGGATCTGAACATGCTGTAGG - Intergenic
1169659252 20:7959847-7959869 TTGGGTTCAGCACATGCTCTTGG + Intergenic
1169797533 20:9480579-9480601 TTGGGTGAAAAACATGCTGAGGG - Exonic
1170379094 20:15736744-15736766 ATGGGCTCTGCACATACTGAGGG + Intronic
1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG + Intronic
1174569868 20:51493860-51493882 GTTGGTTCTGAGCAGGCTGATGG - Intronic
1176130780 20:63495987-63496009 CTGGGTGCTGGACAAGCTGAAGG - Exonic
1177717992 21:24865598-24865620 TTGGGATATGAACATGTGGAAGG - Intergenic
1180032833 21:45224023-45224045 TGGGGTTCTGCACCTGCAGAAGG + Exonic
1183079364 22:35446788-35446810 TTGGGTGATGAAGATGCTCAGGG - Intergenic
1184286494 22:43474676-43474698 GTGGCTTCTGGACAAGCTGACGG + Intronic
1185428431 22:50787421-50787443 TTTCCTTCTGGACATGCTGATGG - Intergenic
952176270 3:30866670-30866692 TTGCGTTCTGAACATGGTGGAGG - Intronic
953084675 3:39654891-39654913 TAGGGTTCTGAGCATGTTTAAGG - Intergenic
953210162 3:40868520-40868542 TTGGGCTCTGTACAGACTGATGG + Intergenic
955942144 3:64156871-64156893 TAGGGTTCTGAACTTACTTAGGG + Intronic
956888336 3:73583588-73583610 TTGGGTCCTGAAGGTGCTTATGG - Intronic
958954750 3:100455505-100455527 TTTGCCTCTGAACATACTGAGGG - Intronic
960056521 3:113279846-113279868 CCGGGCTCTGAACATGCTGGGGG + Exonic
963001377 3:140684821-140684843 TTGGGTCCTCAGCATGGTGAAGG + Intronic
963027115 3:140931015-140931037 TTGGGTTGAGAACACACTGATGG + Intergenic
963446731 3:145420641-145420663 TTGGGTTTGCAACCTGCTGAAGG - Intergenic
963997161 3:151722782-151722804 TTTGGTTCTGAACTTGTAGAAGG + Intergenic
966684573 3:182679896-182679918 TTGCCTTTTGAAGATGCTGAAGG - Intergenic
967731883 3:192914798-192914820 TAGGGTTCTGCACAGGCTGTGGG - Intronic
968054847 3:195683592-195683614 GTGGGTTCTGAACGTGTTGATGG + Intergenic
968101064 3:195965680-195965702 GTGCGTTCTGAACGTGTTGATGG - Intergenic
970815441 4:20150767-20150789 TTGTGTTTTGGACCTGCTGAAGG - Intergenic
976057399 4:81084328-81084350 TTAGGATTTGAAGATGCTGAAGG - Intergenic
979102675 4:116641165-116641187 TTGGATTCTGAGCATACTGTAGG + Intergenic
981505986 4:145500199-145500221 CTGGGTTGAGAACATACTGAAGG - Intronic
982112007 4:152065487-152065509 TTGGGTTCTGGACATGATTTAGG - Intergenic
983217381 4:165014549-165014571 ATGGGTCCTGAACATACTGTAGG - Intergenic
983382294 4:167011828-167011850 TTTGGTTCTGAACTTCTTGATGG - Intronic
983617488 4:169724374-169724396 TTGGATTCGAGACATGCTGAAGG + Intergenic
985502020 5:254233-254255 GTGGGTTCTGAACATGTTGATGG + Intronic
985734997 5:1574433-1574455 GTGGGTTCTGAACATGTTGATGG - Intergenic
986317073 5:6596682-6596704 AAGTGTTCTGAGCATGCTGAAGG + Intergenic
988906184 5:35792780-35792802 TTGTTTTCTGAACATTCTTAAGG - Intronic
994183222 5:96790616-96790638 TTGTATTCTGAATATGCTAAGGG - Exonic
994504553 5:100625678-100625700 TTGGGTTCTGAACAGGTTCAAGG + Intergenic
997400791 5:133600264-133600286 CAGTGTTCTGAGCATGCTGAAGG + Intronic
1000721936 5:164718959-164718981 TTGGGACCTGAAAATGCTGGAGG + Intergenic
1003555500 6:7136364-7136386 TTGGGATCTGAAGCTACTGAAGG - Intronic
1004640717 6:17512839-17512861 TAGGATTCTAAACATGCTGGTGG + Intronic
1006298397 6:33180222-33180244 TGGGTTTTGGAACATGCTGATGG - Intronic
1006933986 6:37704993-37705015 TTGAGTTATGTACAGGCTGAAGG + Intergenic
1007008662 6:38393291-38393313 CTGGGTTCTGCATATTCTGAGGG + Intronic
1008022623 6:46598022-46598044 TTAGGTTGTGAAGATGCAGAAGG - Intronic
1009229186 6:61042806-61042828 ATGGTTTCTTAACATCCTGAAGG - Intergenic
1010585117 6:77649818-77649840 CTGGATTCTAAACATCCTGAAGG - Intergenic
1011631372 6:89328534-89328556 CTGCGAACTGAACATGCTGAAGG + Exonic
1011966597 6:93165839-93165861 TTAGGTTCTCACCATACTGACGG - Intergenic
1014777841 6:125530931-125530953 CTGGATGCTGAAGATGCTGAAGG - Intergenic
1014847650 6:126298288-126298310 GTGGGTTCAGAACATGTTCAGGG + Intergenic
1015589066 6:134805048-134805070 TTGGCTTCTCAACCTGCTAAAGG - Intergenic
1017816801 6:158022096-158022118 TAGGGTTCTGAACCTGCGGGTGG + Intronic
1017841771 6:158228188-158228210 TTTTGTTCTGAACATGCAGAGGG + Intergenic
1019209125 6:170390824-170390846 TTGGGATGTGGTCATGCTGAAGG + Intronic
1022272843 7:28826971-28826993 TTGGATTCTGATCTTGCTGATGG - Intergenic
1022603320 7:31782901-31782923 ATGTGTTCTGAGCATGCTTAAGG + Intronic
1026524789 7:71144382-71144404 TCAGGTTCTGGACATGCTGAGGG - Intronic
1028767679 7:94578468-94578490 TTGGTTTCTGACCATTCTGTTGG + Intergenic
1029218715 7:98970813-98970835 ATGGGTTCTGAGCAGGCTGCTGG - Intronic
1029546595 7:101213353-101213375 TTGGGTTCTGACCAGGCTGCTGG + Intronic
1031076303 7:117216243-117216265 TTTGGTTGTGAATTTGCTGAAGG - Intronic
1032319196 7:130869329-130869351 GTGGGGTCTGAAAATGCTGAGGG + Intergenic
1033543943 7:142382674-142382696 TGGGTTCCTGAACATGCTCATGG - Intergenic
1035659212 8:1334151-1334173 TGAGGTTCTGGACATTCTGATGG + Intergenic
1037601147 8:20395239-20395261 TTGGGGTCTGCACATGGTGTGGG + Intergenic
1038656992 8:29461862-29461884 ATGGGATCTGAAGATGATGAGGG + Intergenic
1039587028 8:38715325-38715347 TTGTGTTCTGGAGATGCTCATGG + Intergenic
1042614467 8:70633240-70633262 CTGGGTTCTTCACATGATGAAGG - Intronic
1045346742 8:101300390-101300412 TTGGATTCTGAAGCTGATGAGGG - Intergenic
1046855734 8:119029648-119029670 TTGGGTTATAACCATCCTGAGGG + Intronic
1048434646 8:134404905-134404927 TTGTGTCCTGAGCTTGCTGATGG + Intergenic
1051270450 9:15350133-15350155 TTGGTTTCAGAACATGATGGTGG - Intergenic
1055825969 9:80325152-80325174 TTGTGTTTTAAAAATGCTGAGGG - Intergenic
1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG + Intronic
1186154764 X:6713511-6713533 ATGTGTTCTGAACATGTTTAAGG + Intergenic
1192723842 X:73727486-73727508 TTGGGTTCTCAATAGGCTTAGGG - Intergenic
1192920736 X:75703234-75703256 TTGGGTTCTCTAAATCCTGAAGG - Intergenic
1196106796 X:111905328-111905350 TTGGTTTGTGAACTTTCTGAGGG - Intronic
1197111509 X:122780439-122780461 TGGGTTGCTGAACATGCAGAAGG + Intergenic
1199164271 X:144651531-144651553 AAGGGTTCTGAACAGGATGAAGG + Intergenic
1199736471 X:150691048-150691070 CTGGATTGTGAACATCCTGAAGG + Intergenic
1200725427 Y:6664130-6664152 TGGGTTTGTGAACATGCTCACGG + Intergenic