ID: 1172849931

View in Genome Browser
Species Human (GRCh38)
Location 20:37954245-37954267
Sequence TACATCCCATGTTCACTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172849931_1172849933 14 Left 1172849931 20:37954245-37954267 CCCTAAAGTGAACATGGGATGTA No data
Right 1172849933 20:37954282-37954304 TTACCCATTATGCATGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172849931 Original CRISPR TACATCCCATGTTCACTTTA GGG (reversed) Intergenic
No off target data available for this crispr