ID: 1172851641

View in Genome Browser
Species Human (GRCh38)
Location 20:37970710-37970732
Sequence GCTTTGTCCAGAACTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172851638_1172851641 -8 Left 1172851638 20:37970695-37970717 CCTAACCTGAGCCTGGCTTTGTC No data
Right 1172851641 20:37970710-37970732 GCTTTGTCCAGAACTGCTGTAGG No data
1172851637_1172851641 -7 Left 1172851637 20:37970694-37970716 CCCTAACCTGAGCCTGGCTTTGT No data
Right 1172851641 20:37970710-37970732 GCTTTGTCCAGAACTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172851641 Original CRISPR GCTTTGTCCAGAACTGCTGT AGG Intergenic
No off target data available for this crispr