ID: 1172851856

View in Genome Browser
Species Human (GRCh38)
Location 20:37972179-37972201
Sequence GTCTCCTCCATCAGACTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172851852_1172851856 29 Left 1172851852 20:37972127-37972149 CCTGGCCTGTAAGTGTGTCATTA No data
Right 1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG No data
1172851854_1172851856 24 Left 1172851854 20:37972132-37972154 CCTGTAAGTGTGTCATTATAGGT No data
Right 1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG No data
1172851851_1172851856 30 Left 1172851851 20:37972126-37972148 CCCTGGCCTGTAAGTGTGTCATT No data
Right 1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172851856 Original CRISPR GTCTCCTCCATCAGACTGTG AGG Intergenic
No off target data available for this crispr