ID: 1172853003

View in Genome Browser
Species Human (GRCh38)
Location 20:37980078-37980100
Sequence CGTGATCTGCAGGCTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172853003_1172853006 6 Left 1172853003 20:37980078-37980100 CCTTCTACAGCCTGCAGATCACG No data
Right 1172853006 20:37980107-37980129 ACATCTCAAGCTGAAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172853003 Original CRISPR CGTGATCTGCAGGCTGTAGA AGG (reversed) Intergenic
No off target data available for this crispr