ID: 1172853049

View in Genome Browser
Species Human (GRCh38)
Location 20:37980555-37980577
Sequence GGCCTCTCAGGACAGCATCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172853045_1172853049 13 Left 1172853045 20:37980519-37980541 CCAAGTTTTTATCAGGATGCGTG No data
Right 1172853049 20:37980555-37980577 GGCCTCTCAGGACAGCATCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172853049 Original CRISPR GGCCTCTCAGGACAGCATCG CGG Intergenic