ID: 1172861487

View in Genome Browser
Species Human (GRCh38)
Location 20:38056860-38056882
Sequence TGATGCAAAAAGAATGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172861486_1172861487 14 Left 1172861486 20:38056823-38056845 CCACAATTGTTTGGCATTTATTT 0: 1
1: 0
2: 2
3: 88
4: 628
Right 1172861487 20:38056860-38056882 TGATGCAAAAAGAATGATTTTGG 0: 1
1: 0
2: 2
3: 36
4: 490
1172861485_1172861487 15 Left 1172861485 20:38056822-38056844 CCCACAATTGTTTGGCATTTATT 0: 1
1: 0
2: 0
3: 34
4: 336
Right 1172861487 20:38056860-38056882 TGATGCAAAAAGAATGATTTTGG 0: 1
1: 0
2: 2
3: 36
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172861487 Original CRISPR TGATGCAAAAAGAATGATTT TGG Intronic
901103392 1:6736718-6736740 TGCTGCAAAATATATGATTTTGG + Intergenic
902170219 1:14604255-14604277 GGGTTCAGAAAGAATGATTTAGG + Intronic
902209861 1:14896834-14896856 AGTTGCAAAAAGGAAGATTTGGG + Intronic
903051841 1:20606951-20606973 TGATGCAAGAAAAATGACATGGG + Intronic
903303406 1:22394852-22394874 TGATGTAAACAGGATGCTTTTGG - Intergenic
904052829 1:27650525-27650547 TATTGCAGCAAGAATGATTTCGG + Intergenic
904829517 1:33297812-33297834 TGATCTAAAAAGAATAATGTAGG - Intronic
906466317 1:46083201-46083223 ACATGCAAAAAGAATGAAGTTGG + Intronic
907749734 1:57251257-57251279 TGCTGCAAGAAGAATGGCTTTGG + Intronic
908066009 1:60405284-60405306 TGCTGCAAAAGAAATGGTTTCGG - Intergenic
908327742 1:63040235-63040257 AAATGAAAAAAGAATGAATTTGG + Intergenic
909149838 1:71987919-71987941 TCATTCAAAAAGGATGCTTTGGG + Intronic
909853842 1:80503710-80503732 TTATGCATTAAGAATGATCTAGG - Intergenic
910293652 1:85623021-85623043 GGATGCCAAAAGAATGAGTATGG + Intergenic
910567327 1:88658946-88658968 TGATGCCAAGAGAATGGGTTGGG + Intergenic
910725587 1:90335354-90335376 TGATTCAATAAGAATTATTTTGG + Intergenic
910870774 1:91830809-91830831 TGGTGCAAAAGGAATGATCCTGG + Intronic
911142084 1:94515122-94515144 TAATACAAAGAAAATGATTTAGG - Intronic
911441379 1:97930516-97930538 TCATGCCAAAAGAATGTTTTTGG - Intergenic
911971553 1:104444376-104444398 TGTTACAAAAACAATGCTTTGGG - Intergenic
912039797 1:105375352-105375374 TTCTGCAAATAGAATGCTTTGGG - Intergenic
912158003 1:106946161-106946183 TGACAGGAAAAGAATGATTTGGG - Intergenic
912352090 1:109023815-109023837 AGATGAAACAAGAATGATTATGG + Intronic
912461440 1:109834829-109834851 TGATGAAAACAGAGTGTTTTGGG - Intergenic
912527351 1:110293335-110293357 TTATGCAAAAAGAGTGGTTCTGG - Intergenic
912581112 1:110721817-110721839 TGATGCTAATAGACTGATTTTGG + Intergenic
913590163 1:120316750-120316772 GGATGCAACAAGTAAGATTTGGG - Intergenic
913618021 1:120581614-120581636 GGATGCAACAAGTAAGATTTGGG + Intergenic
914572193 1:148928609-148928631 GGATGCAACAAGTAAGATTTGGG - Intronic
914600645 1:149201656-149201678 GGATGCAACAAGTAAGATTTGGG + Intergenic
915185316 1:154100147-154100169 TGAATCAAAAACCATGATTTTGG + Intronic
915257220 1:154643131-154643153 TCCTGATAAAAGAATGATTTTGG - Intergenic
916237066 1:162600717-162600739 ATATGCTAAATGAATGATTTAGG - Intergenic
916706946 1:167360719-167360741 TTATGTAAAAAAAATGATGTTGG + Intronic
916756605 1:167776655-167776677 TGATGAACAAGGAATGGTTTTGG + Intronic
916768833 1:167888217-167888239 TGAAGCAAAAAGAATAAATCAGG - Intronic
916811654 1:168311106-168311128 TGAGGGAAAAACATTGATTTGGG + Intronic
917302937 1:173596821-173596843 TAAGGCAAAAAGCATTATTTGGG + Intronic
917546191 1:175971112-175971134 AGATGCAACAATAATGATTCTGG + Intronic
918381468 1:183959842-183959864 TGGGGCATAAAGAATGAGTTGGG - Intronic
918929839 1:190840581-190840603 TGATGCAAAAAACATGCTCTGGG + Intergenic
919000971 1:191830653-191830675 TGGAGAAAAGAGAATGATTTAGG - Intergenic
919598438 1:199592961-199592983 TGATGCTACAAAAATGATTAAGG + Intergenic
922300662 1:224296924-224296946 TGAAACAGAAACAATGATTTTGG + Intronic
923300625 1:232637389-232637411 TGATCCAACAAGAACGATTCTGG + Intergenic
923349981 1:233094877-233094899 TGATTTAAAAAGTATGAGTTGGG + Intronic
924370471 1:243343199-243343221 TTCTCCAAAAATAATGATTTTGG - Intronic
1062851450 10:745990-746012 TGATGCAAAAAGAAGCATTTGGG + Intergenic
1063014776 10:2064877-2064899 TGAAGTAAGAGGAATGATTTAGG - Intergenic
1063659347 10:8023024-8023046 TGATTCAAACACAAAGATTTGGG - Intergenic
1063701683 10:8390560-8390582 GGAAGCAAAAACTATGATTTTGG - Intergenic
1064681988 10:17819406-17819428 TGGAGCAAAGAGAATGAATTAGG + Intronic
1065852927 10:29805748-29805770 TAATGCCAAAAGAAACATTTTGG + Intergenic
1066063696 10:31746517-31746539 TGATGCAAAATAAATTAGTTTGG + Intergenic
1066203726 10:33166472-33166494 TGAGGAGAGAAGAATGATTTGGG - Intergenic
1068108502 10:52650779-52650801 TGATGTAAAAAGGAAGCTTTAGG - Intergenic
1068257342 10:54530226-54530248 TGATGCAAAAAACATAAATTTGG - Intronic
1068507108 10:57915039-57915061 TGTTGGAAAAGAAATGATTTAGG + Intergenic
1068661932 10:59631712-59631734 TCATACAAAAGGAATCATTTAGG - Intergenic
1068995911 10:63203850-63203872 TCAATCAAAAAGAATGAGTTAGG - Intronic
1069144310 10:64870455-64870477 TTATGGAAAAAGAATTATTATGG - Intergenic
1069210745 10:65756605-65756627 TCTTGAAAAAAGAATGATGTTGG - Intergenic
1071917303 10:90308800-90308822 TCTTGCAAAAAGAATCCTTTAGG + Intergenic
1072326053 10:94299930-94299952 TTATGAAAACAGTATGATTTGGG + Intronic
1072392605 10:95003089-95003111 TGATGCATAAATACAGATTTTGG + Intergenic
1074330152 10:112498895-112498917 TGGTGAAAATAGAATAATTTAGG - Intronic
1074493921 10:113962192-113962214 TGAGGCAAACAGAATGGTTTAGG + Intergenic
1074633892 10:115291108-115291130 TGTTAGAAAAATAATGATTTTGG + Intronic
1074777481 10:116776843-116776865 TGATGCAAATATGATAATTTAGG + Intergenic
1074802564 10:117015990-117016012 GAATGCAAAAAGAAAGCTTTAGG - Intronic
1075894995 10:125987336-125987358 TGAATCACAAAGAATGATTCTGG + Intronic
1076432028 10:130410759-130410781 TGATGCAAAAGGAAGAATTAAGG - Intergenic
1077800890 11:5535568-5535590 TGAAGAAAAAAAAATGAGTTTGG + Intronic
1078024112 11:7678615-7678637 TGCTGCAAAGAATATGATTTTGG - Intergenic
1078969837 11:16395537-16395559 TGGATCAGAAAGAATGATTTGGG + Intronic
1080128332 11:28764386-28764408 TGATGATAAAAGACTGATTTGGG - Intergenic
1080524079 11:33095864-33095886 AGATTCAAAAAGAAACATTTTGG - Intronic
1080570850 11:33555606-33555628 TGATCCCAAAAGAATGAAGTTGG + Intronic
1081280364 11:41202264-41202286 TGATGCACAGAGGAGGATTTCGG + Intronic
1081706460 11:45184676-45184698 TGAGGGAAAAATCATGATTTGGG + Intronic
1081922727 11:46794056-46794078 ACATGCAAAAAGAATGAAGTTGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083143335 11:60739412-60739434 AGATGCAAAGAGAAGGATTCAGG + Intronic
1083512109 11:63219433-63219455 TGTGGCAAACAAAATGATTTTGG + Intronic
1086929241 11:92674251-92674273 TGATGGAGAAAGAAGGAGTTTGG + Intronic
1086957307 11:92946761-92946783 TGAAGAAAAAAGAGTGGTTTCGG + Intergenic
1088021166 11:105121382-105121404 TGGTGCAAAGAAAATGAGTTTGG - Intergenic
1088132399 11:106509074-106509096 TGATAGAAAATGAAAGATTTTGG - Intergenic
1088552922 11:111032495-111032517 TCAAGCAAAAAGAATAAATTTGG + Intergenic
1088559927 11:111103978-111104000 TGATTTAAAAAGAAAGATCTTGG - Intergenic
1092646259 12:10576476-10576498 TGATGCAAAGAGAAGAATATTGG - Intergenic
1093285953 12:17263150-17263172 CTAGGCAAAAAGAATCATTTGGG + Intergenic
1093386367 12:18560129-18560151 TGATTAAAAAAAAATTATTTTGG - Intronic
1093420684 12:18970912-18970934 TTAAGCAAAAAGAATGGTGTGGG - Intergenic
1093671920 12:21886710-21886732 TGATGCGAGAACAATGATTGAGG - Intronic
1093937193 12:25013817-25013839 TTATGCAAAAATAATCGTTTTGG - Intergenic
1094437367 12:30435354-30435376 AGATGCAAAAAAAATGATAAAGG - Intergenic
1094687088 12:32728700-32728722 TAATGCAAGAATAATGTTTTTGG + Intronic
1095047673 12:37526779-37526801 TTCTACAAAAAGAGTGATTTTGG + Intergenic
1095511649 12:42957254-42957276 TGAAGGAAAAAAAAAGATTTGGG + Intergenic
1096599150 12:52717209-52717231 GGATGCAGCAAGAAAGATTTAGG + Intergenic
1096719924 12:53513638-53513660 TAATGAAAAATTAATGATTTGGG + Exonic
1097252251 12:57642155-57642177 TTAGGGAAAAAAAATGATTTTGG - Intergenic
1097563089 12:61233038-61233060 TAATGCAACAATAATAATTTCGG + Intergenic
1098012005 12:66063052-66063074 TGTGACAAAAAGAATTATTTTGG - Intergenic
1098139947 12:67441205-67441227 TGATGCAAGACAAATGACTTGGG - Intergenic
1098717256 12:73845959-73845981 TGATGTAAAAAGAGTGATCAAGG + Intergenic
1098724941 12:73952075-73952097 TTATTCATAAAGAATCATTTGGG - Intergenic
1099047129 12:77735644-77735666 TGATCATAAAAAAATGATTTTGG + Intergenic
1099245222 12:80186166-80186188 TGAAGCAAACATAATGAATTTGG - Intergenic
1100785912 12:98077842-98077864 TAATGCAAAAAGAATAAAATTGG - Intergenic
1101130154 12:101681378-101681400 GGTTGGAAAAAGAAAGATTTTGG - Intronic
1102661452 12:114532363-114532385 TGATGCATAAAGAAGGACTTGGG + Intergenic
1103277963 12:119729740-119729762 TGATAGAAAAATAATTATTTGGG - Intronic
1104670652 12:130677802-130677824 TGCTGGATAAAGAATGATTTTGG - Intronic
1105056687 12:133107113-133107135 TGATACAAACACAGTGATTTGGG + Exonic
1105056808 12:133108726-133108748 TGATACAAACACAGTGATTTGGG + Exonic
1105264399 13:18803339-18803361 GGATTCAAAAACGATGATTTTGG - Intergenic
1105473706 13:20713694-20713716 TAATGCCAACAGAATGATTTGGG + Intronic
1105653431 13:22405882-22405904 TGGTGCAAATAGAAGAATTTTGG + Intergenic
1106254521 13:28010704-28010726 TGATGCAGAAACAAAGATTCTGG + Intronic
1106490743 13:30219214-30219236 AGATCTGAAAAGAATGATTTTGG - Intronic
1106917979 13:34535791-34535813 TGAGGGAAACAGAATGATTATGG + Intergenic
1106979763 13:35264686-35264708 TCATGCAAAAACAATGAATTTGG - Intronic
1107607531 13:42075462-42075484 TGGTGCAAAAATAATGATAGTGG - Intronic
1107969755 13:45630032-45630054 TCATGCAAAAATAATGACCTTGG - Intergenic
1108019298 13:46110395-46110417 AGCTGCAAAAATTATGATTTTGG + Intergenic
1108439462 13:50435891-50435913 TAATGTAAAAACAAAGATTTGGG - Intronic
1109411811 13:61979929-61979951 AGATGCAAAAAAAATGATAAAGG - Intergenic
1109614825 13:64818739-64818761 TGAAGGAAAAAGAAAGATGTTGG + Intergenic
1109916702 13:68997058-68997080 TGCTGCAAAAAAAGTAATTTGGG + Intergenic
1110790684 13:79583415-79583437 TATTGTAAGAAGAATGATTTGGG - Intergenic
1110936782 13:81300470-81300492 TGTTGCAATAAGTATGAATTTGG - Intergenic
1110971567 13:81769356-81769378 AAATGCAAGAGGAATGATTTTGG + Intergenic
1111060182 13:83007776-83007798 TGGTGAAAAAAGAAAAATTTAGG - Intergenic
1111089097 13:83418275-83418297 TGATGTCAAAATAATGCTTTAGG - Intergenic
1111530206 13:89526677-89526699 TGTTAGAAAAAAAATGATTTGGG + Intergenic
1111695626 13:91620150-91620172 TGATGGTTAAAGCATGATTTGGG - Intronic
1112732743 13:102384533-102384555 TGACTCACAAAGAATGATTGAGG - Intronic
1113400009 13:109982755-109982777 TCATCCAATAAAAATGATTTAGG - Intergenic
1114327582 14:21604664-21604686 TGTTCAAAAAAGAATGTTTTAGG + Intergenic
1114480878 14:23033729-23033751 TGATGCAAAAAGAAGTATGTAGG - Intronic
1114722654 14:24898768-24898790 TAAAGAAAAAAGAATGCTTTTGG - Intronic
1114988461 14:28260357-28260379 TGCTGTAAAAACAAGGATTTAGG + Intergenic
1116023847 14:39492445-39492467 TCATGATAAAAGAATGAGTTTGG - Intergenic
1116310437 14:43318601-43318623 CGATGCAAAGAGAAACATTTAGG - Intergenic
1116451952 14:45077131-45077153 TGATTCAGAAAGCATGAATTTGG + Intergenic
1116672757 14:47864294-47864316 AGATGGAAAAAAAATGATATGGG - Intergenic
1119331294 14:73796017-73796039 TGATTCTAAAAGAGTGATATGGG - Intergenic
1120117667 14:80638747-80638769 TGATGGCAATAGAAAGATTTAGG - Intronic
1120849774 14:89159440-89159462 TTATGCAAAAAGAGTGGTTCTGG + Exonic
1121289948 14:92765984-92766006 TTCTGCATTAAGAATGATTTAGG - Intergenic
1121291267 14:92777603-92777625 TTCTGCATTAAGAATGATTTAGG + Intergenic
1121939389 14:98055404-98055426 GGATGCAAAAAAAATTTTTTTGG - Intergenic
1125258123 15:37790351-37790373 TCATGCAAAATGATTAATTTGGG - Intergenic
1125466793 15:39961051-39961073 TAATGCAAAAACAATAAATTAGG - Intronic
1126525830 15:49653025-49653047 TGCTGAAAAAAAACTGATTTGGG - Exonic
1126982922 15:54266765-54266787 TGAGGCATAAAGAATATTTTGGG - Intronic
1127319121 15:57825673-57825695 TGGGGCTAAAAGAATAATTTTGG + Intergenic
1128036718 15:64533392-64533414 TGATGTGAAATCAATGATTTAGG - Intronic
1128786696 15:70402940-70402962 GGATGCAGAAAGAAAGATTGAGG + Intergenic
1128873386 15:71181791-71181813 TGATGGAAGAGGAATGATTATGG - Intronic
1130240270 15:82181867-82181889 TTATGAAAAAAGAAGTATTTGGG - Intronic
1130815294 15:87425538-87425560 GGATGCAAAAAGAAGAATTTTGG - Intergenic
1130840789 15:87699023-87699045 ACATGCAAAAAGAATGAACTTGG - Intergenic
1132276806 15:100573418-100573440 TAAAGCATAAGGAATGATTTAGG - Intronic
1134339114 16:13328899-13328921 TTAGGGAAAAAAAATGATTTGGG - Intergenic
1135506914 16:23046461-23046483 TTATGCAAAAACAATAGTTTGGG + Intergenic
1135984139 16:27171361-27171383 AGATGGGAAAAGAATGATCTTGG + Intergenic
1137600963 16:49755996-49756018 TGAGGCAGAAAGAATGATGCAGG + Intronic
1138301405 16:55932857-55932879 TGCTGCGTAAAGAATGAATTTGG + Intronic
1138628063 16:58268317-58268339 TGATGCAAAGAGAACTTTTTGGG + Intronic
1139083477 16:63555464-63555486 TTATGTAAAATGAATGACTTTGG - Intergenic
1139298292 16:65922054-65922076 TGATGCCAAAGGCATGAATTAGG - Intergenic
1144198204 17:12916069-12916091 TGCTGGAAACAGAATGATTGAGG - Intronic
1145355345 17:22141036-22141058 TGATACAAAAAAAATCAATTAGG + Intergenic
1146885529 17:36468169-36468191 TGCTGCAAAAACAAAGATTGGGG + Intergenic
1149105244 17:52955608-52955630 TAATGCAAACAGAATCTTTTGGG - Intergenic
1149812420 17:59690099-59690121 TTATGCAAAAAGATTGAATATGG + Intronic
1150657904 17:67052416-67052438 AGGTGCAAGAAGAATGATTTAGG + Intronic
1152999295 18:438965-438987 GGAAGCAGAAATAATGATTTTGG + Intronic
1153057115 18:956831-956853 TGAGGCAAAAAGATTGCTTTAGG - Intergenic
1153105759 18:1524169-1524191 AGATGAAAACAGAATTATTTTGG - Intergenic
1153609977 18:6874330-6874352 TTAGACAAAAAGAATAATTTTGG + Intronic
1153678705 18:7479762-7479784 TGATATAAAAAGAATGATGTTGG - Intergenic
1154423996 18:14258222-14258244 GGATTCAAAAACGATGATTTTGG + Intergenic
1155428969 18:25735772-25735794 GGAAGCAGAAAGAAAGATTTTGG - Intergenic
1155731892 18:29170628-29170650 TGATTAAGAAAGAATTATTTTGG + Intergenic
1155829353 18:30493359-30493381 TGATGCTAATAGACTGATTTGGG - Intergenic
1156154962 18:34290850-34290872 TGAGGCAAAGGGAATAATTTGGG + Intergenic
1156437836 18:37152827-37152849 TGTTGGAAAACAAATGATTTGGG - Intronic
1156621931 18:38863221-38863243 TGATGAAAATAGACTTATTTTGG - Intergenic
1156955088 18:42952770-42952792 TAATGTATAAAGAATAATTTAGG + Intronic
1157091045 18:44637500-44637522 TGACACAAAAATAATAATTTAGG - Intergenic
1157241383 18:46013138-46013160 TAAAGCCAAAAAAATGATTTAGG + Intronic
1158144633 18:54298407-54298429 TAATGCTAAAAAGATGATTTAGG - Intronic
1158942148 18:62414668-62414690 AGATGCTAAAAGAATGCATTGGG - Intergenic
1159406682 18:68011791-68011813 GGATGGAAAAAGTATGATTTGGG - Intergenic
1159412345 18:68095582-68095604 TGATGCACAAATACAGATTTTGG - Intergenic
1159473401 18:68885746-68885768 TGATGTAAAAAACATGAGTTAGG + Intronic
1160307897 18:77758188-77758210 GGATGGCAAAAGAGTGATTTAGG + Intergenic
1161458778 19:4383984-4384006 GACTGCAAAAGGAATGATTTGGG + Intronic
1162008662 19:7797323-7797345 AGATGCAAAAAGAAAGACTAAGG - Intergenic
1164131492 19:22366466-22366488 TGAAGCAAAAAGGATGAGGTAGG + Intergenic
1164240915 19:23388336-23388358 TTATACAAAAACAATGTTTTTGG - Intronic
1164271921 19:23680366-23680388 TGCTGCAAAAGAAATGATCTTGG - Intronic
925787126 2:7442741-7442763 TGTTACAATAAGAATAATTTTGG + Intergenic
926801956 2:16666457-16666479 TGATGCAAAAAGAAAGTAGTGGG + Intergenic
927167800 2:20342721-20342743 TGAAGTAAAAGGAATCATTTAGG + Intronic
928110910 2:28507965-28507987 TGCTGGCCAAAGAATGATTTAGG - Intronic
929232222 2:39571540-39571562 AGATGTAAAAAGAATGATGAGGG - Intergenic
930214756 2:48683299-48683321 TGCTGTAAAAGGCATGATTTTGG - Intronic
931009698 2:57895988-57896010 TGAAACCAAAAGAATGGTTTAGG - Intergenic
933946416 2:87289780-87289802 TTTTGAAAAAAGAATGATTGAGG + Intergenic
935174882 2:100641051-100641073 TGCTGTAAAGAGAATGCTTTGGG + Intergenic
935193525 2:100796996-100797018 TTGTGCAAACAGAATAATTTAGG + Intergenic
935248606 2:101241144-101241166 TGATGAAAAAAGGGTGCTTTTGG - Intronic
935686260 2:105686639-105686661 TGTGGGAAAAAAAATGATTTAGG + Intergenic
936333779 2:111571761-111571783 TTTTGAAAAAAGAATGATTGAGG - Intergenic
937041319 2:118822903-118822925 AGATGCAAGAAGAAAGAGTTTGG + Intergenic
937594247 2:123654444-123654466 TGATGCCAGAAAAATAATTTGGG - Intergenic
938198767 2:129356006-129356028 GGGTGCAAAAAGAATGAGTCTGG - Intergenic
938280043 2:130057407-130057429 GGATTCAAAAAGGATGATTTTGG - Intergenic
938331000 2:130448122-130448144 GGATTCAAAAAGGATGATTTTGG - Intergenic
938358948 2:130673381-130673403 GGATTCAAAAAGGATGATTTTGG + Intergenic
938435340 2:131280032-131280054 GGATTCAAAAAGGATGATTTTGG + Intronic
939225519 2:139359068-139359090 AGATTCAATAAGAATGATTTGGG - Intergenic
939279505 2:140043837-140043859 TGAATCAAATAGAATGATATTGG + Intergenic
939474792 2:142673718-142673740 GGAGTCAAAAGGAATGATTTAGG + Intergenic
940171832 2:150836883-150836905 TGATGTAATAATAATTATTTGGG - Intergenic
940913824 2:159232860-159232882 TGAGGCAAAAAGACTAAATTTGG - Intergenic
940936149 2:159497207-159497229 AGATGCAAACACAAAGATTTTGG + Intronic
942553675 2:177148733-177148755 TAATGCCCAAAGATTGATTTAGG - Intergenic
942695030 2:178632476-178632498 AAAGGCAAAAAAAATGATTTTGG + Intronic
943141616 2:183990218-183990240 TCAGGCAAATAGAATGAATTAGG + Intergenic
943700612 2:190985182-190985204 TGATGCAAAGGCAATGCTTTTGG + Intronic
944025733 2:195165057-195165079 TGATTTAAAAAGAAAGATATGGG + Intergenic
944291347 2:198009380-198009402 AAATGCAAAAAGAGTGAATTTGG - Intronic
945054928 2:205860170-205860192 TGATGCAAAATGAATGAAGCAGG + Intergenic
945182251 2:207103886-207103908 CGTTGCATAAAGAAGGATTTTGG - Intronic
946931808 2:224678464-224678486 TGATGCAATAAAAAAGATTAAGG + Intergenic
948953017 2:241267152-241267174 CAATGCAAGAAGAATGATCTTGG + Intronic
1168811051 20:704779-704801 TGGTCCACAAATAATGATTTGGG + Intergenic
1169739224 20:8872188-8872210 TGAAGCAAATATAATTATTTAGG + Intronic
1169935513 20:10879374-10879396 TTATGCTAAAAGGATAATTTTGG + Intergenic
1171798807 20:29589652-29589674 TTCTACAAAAAGAATGATTTTGG - Intergenic
1171845253 20:30266908-30266930 TTCTACAAAAAGAGTGATTTTGG + Intergenic
1171885220 20:30647082-30647104 GGATTCAAAAATGATGATTTTGG - Intergenic
1172861487 20:38056860-38056882 TGATGCAAAAAGAATGATTTTGG + Intronic
1172922217 20:38494106-38494128 TGATGCAGAAAGTATCATATAGG - Intronic
1172924523 20:38520039-38520061 TGATACAAAAATCATAATTTTGG + Intronic
1175142296 20:56870039-56870061 TTAAGCAAAAAAAATGAGTTAGG + Intergenic
1175354655 20:58354949-58354971 TGATACAAAGAAAATAATTTAGG + Intronic
1176668767 21:9712381-9712403 TGTTAGAAAAATAATGATTTGGG - Intergenic
1176849473 21:13901781-13901803 GGATTCAAAAACGATGATTTTGG - Intergenic
1177544676 21:22541159-22541181 TGTTGCAAAAGATATGATTTTGG - Intergenic
1177725700 21:24964251-24964273 AGATGCAAAAAGAATAATAAAGG + Intergenic
1177835447 21:26182128-26182150 TGTTGCACAAAGCATGCTTTAGG + Intergenic
1180872420 22:19154072-19154094 TGATTCAAAAAGCAAGATTTAGG + Intergenic
1181710670 22:24685831-24685853 TGTTGGAAAAAGAATTACTTTGG + Intergenic
1181847678 22:25725459-25725481 TGAACCAAAGAGAATGTTTTAGG - Exonic
1182042360 22:27248378-27248400 TGATGCAAAAATAAGGATGAGGG + Intergenic
1184538631 22:45104940-45104962 ACATGAAAAAAGAATGACTTTGG + Intergenic
1185007046 22:48285811-48285833 CAATGCCAAAAGTATGATTTAGG + Intergenic
949539034 3:5017993-5018015 TGAGGCCAAAAGAATAACTTGGG - Intergenic
950310360 3:11952721-11952743 TGATTTAAAAAAAATCATTTTGG - Intergenic
951438709 3:22696614-22696636 TTCTGCAAAAAGTATGCTTTTGG + Intergenic
951890724 3:27565607-27565629 AGATGCAAAAACAAAGAGTTGGG - Intergenic
951989407 3:28659252-28659274 AGATGCAAAAAGAAGTATGTTGG - Intergenic
952108289 3:30093573-30093595 TCATGCAAAAGGAATGCTCTCGG + Intergenic
953206328 3:40833346-40833368 TGATGCAAAAGGATTGCTTGAGG - Intergenic
956150520 3:66237139-66237161 TGATTCAAAAATAATGGGTTAGG - Intronic
956249494 3:67220882-67220904 TGATGCAGAAGGGATAATTTGGG - Intergenic
956600715 3:71019230-71019252 TGGTGGGAAAAGGATGATTTGGG + Intronic
957191309 3:77013349-77013371 TAATGGAAAAGGCATGATTTTGG + Intronic
957400085 3:79700147-79700169 TGCTGCAAAAGACATGATTTTGG + Intronic
958442215 3:94169568-94169590 TCATGCTATAGGAATGATTTTGG + Intergenic
958514000 3:95088744-95088766 TGATGCAAGAAAAATGAGATTGG - Intergenic
958539537 3:95452710-95452732 AAATGCAAAATGAATTATTTAGG + Intergenic
958663563 3:97104595-97104617 TGATGAAAAAAGAAAGCTTCAGG - Intronic
958705805 3:97653750-97653772 TCATTCAAAAAGAAATATTTAGG - Intronic
959561112 3:107782602-107782624 TGCTGAAAAATGAATGTTTTGGG - Intronic
959748575 3:109806551-109806573 TGAAGCAAAAATAGTCATTTTGG + Intergenic
960349159 3:116572890-116572912 TTATGCAAAATAAATGCTTTTGG + Intronic
960597119 3:119416248-119416270 GGAGGCAAATAGAATGATTTCGG + Exonic
960689240 3:120326696-120326718 GGATGAAAAAAGGATCATTTAGG + Exonic
961254582 3:125537347-125537369 TGGTGCAAAAGGAATGCTGTGGG - Intronic
961395821 3:126588827-126588849 TGATGCAATAAAAATGATAAAGG - Intronic
961984557 3:131118822-131118844 AGATGCAAAAAAAATGATAAAGG - Intronic
962168143 3:133072252-133072274 TGAGGTAAAAATAATGATTAAGG + Intronic
963634240 3:147774665-147774687 TGAGGCCAGTAGAATGATTTAGG - Intergenic
963923452 3:150927046-150927068 TGATGCAAAATGACTTATTAGGG - Intronic
964675083 3:159268960-159268982 TGATGTTAAAAGGATAATTTGGG - Intronic
965722135 3:171673650-171673672 CGATGCAAAATAACTGATTTAGG + Intronic
967196308 3:187029170-187029192 TGATGCTAAAAGACTGATCAGGG + Intronic
967679770 3:192347449-192347471 TGATTCAAAAACAAAGATTTTGG + Intronic
968268810 3:197383748-197383770 GGATGCAAAAATAATCATATTGG - Intergenic
969974737 4:11086978-11087000 TGATTTAAAAAAAATGACTTAGG - Intergenic
970651651 4:18185215-18185237 GGAAGCAAAAAGAGTGAATTGGG - Intergenic
973128709 4:46621785-46621807 TGATGCCACAAGTATGCTTTGGG - Intergenic
973368874 4:49229350-49229372 GGATTCAAAAATGATGATTTTGG - Intergenic
973392172 4:49566065-49566087 GGATTCAAAAATGATGATTTTGG + Intergenic
974860235 4:67511617-67511639 TTATGCAAAAAATATGGTTTAGG + Intronic
975234480 4:71975912-71975934 TGATGGAAAACAAATGAATTTGG - Intergenic
975243455 4:72090264-72090286 TGAAGCAAAAAGAATAAATCTGG - Intronic
975637779 4:76467466-76467488 TTGTGGATAAAGAATGATTTTGG + Intronic
977314806 4:95432465-95432487 TGAGTCAAAAACATTGATTTTGG + Intronic
977870992 4:102090591-102090613 TGATGCAAAGACAATGGTTTTGG + Intergenic
978290284 4:107129985-107130007 TGAAGAAAAAAAAATGATTCAGG - Intronic
978321871 4:107505486-107505508 TGAATGAAAAAGAATGAATTAGG - Intergenic
978851690 4:113345139-113345161 TGATGCAATATGAATGAACTTGG + Intronic
979501289 4:121443391-121443413 AGATGCAATAAAAATGATATAGG + Intergenic
979579341 4:122338121-122338143 TGATGAAAACAGAATGAATGAGG + Intronic
979966498 4:127082935-127082957 TAATGTATAAAGAATGACTTTGG - Intergenic
980698991 4:136398214-136398236 TCATGCAACTAGAATTATTTTGG - Intergenic
981007100 4:139886662-139886684 TGATCCAAAAATAAGTATTTTGG - Intronic
981122049 4:141063414-141063436 TTATTCAAAAAGAAAAATTTTGG - Intronic
981201903 4:141989867-141989889 AGATGCAATAAAAATGATATAGG - Intergenic
981572625 4:146169024-146169046 GGATGCAAAAAGTCAGATTTGGG + Intergenic
981665064 4:147215137-147215159 TGGGGCACAAAGAATGATTGTGG - Intergenic
981768572 4:148280078-148280100 TGATGCAAACAGATTATTTTAGG - Intronic
982123324 4:152162566-152162588 TGATTCAAAATTAATCATTTGGG + Intergenic
982155728 4:152518527-152518549 TGAGGCAAAAGGATTGCTTTAGG - Intronic
982763961 4:159322272-159322294 GTATTCAAAAAGAATGTTTTAGG - Intronic
983426548 4:167591087-167591109 ACATGCAAAAACAATGATATTGG + Intergenic
983438924 4:167755627-167755649 CCATGCAAAAAGAATGATACAGG + Intergenic
983788793 4:171768402-171768424 GAATGTAGAAAGAATGATTTTGG + Intergenic
984661664 4:182381418-182381440 TAAAGAAAAAATAATGATTTTGG + Intronic
985043444 4:185916176-185916198 GGATGCAAGAAGACTGAATTAGG + Intronic
985211090 4:187595473-187595495 TCATGCAAAAAGAGGAATTTAGG + Intergenic
985406014 4:189639144-189639166 TGTTAGAAAAATAATGATTTGGG + Intergenic
985519366 5:364851-364873 TAATGTAAAAAAATTGATTTTGG + Intronic
986278842 5:6306182-6306204 TGCTTCACAAAGAATGCTTTGGG + Intergenic
986901194 5:12436007-12436029 TGACGCAAAAGGGATCATTTTGG + Intergenic
986922406 5:12703380-12703402 TAATGCAAGAAGAACAATTTAGG + Intergenic
987534668 5:19168414-19168436 TGATGCAAATAAAATGTTATGGG + Intergenic
988134163 5:27147741-27147763 TGATGCTATTAGAATGATATAGG + Intergenic
988212191 5:28217995-28218017 AGCTTCAAAAAGAATGATTAGGG + Intergenic
988334114 5:29883035-29883057 TAATGCAACAATAATAATTTCGG + Intergenic
988421621 5:31012635-31012657 ATATGCAAAAAAAATTATTTAGG - Intergenic
988589153 5:32533906-32533928 TCATGTTAAAAGTATGATTTAGG + Intronic
989329047 5:40234271-40234293 TGATATAAAAAGATTTATTTGGG - Intergenic
989563946 5:42882369-42882391 TTATTCACAAAGAATAATTTGGG + Intronic
989681558 5:44035468-44035490 TGGTGTAAAATGAATGCTTTAGG + Intergenic
990218657 5:53562727-53562749 TAATGGAAAAAGAATGCTTAAGG - Intronic
992874426 5:81039379-81039401 TGATGCCAAATGTATAATTTGGG + Intronic
993074251 5:83207556-83207578 TGCTGCAAAAAGAAATGTTTAGG + Intronic
993330194 5:86590165-86590187 TCAAGAAAAAATAATGATTTTGG + Intergenic
994498070 5:100538167-100538189 GGAAGCAAAAAGTATGAGTTCGG - Intronic
994514471 5:100753225-100753247 TGATGCTGACACAATGATTTGGG + Intergenic
994968452 5:106703916-106703938 TGAGACCAAAAGAATCATTTAGG - Intergenic
995881788 5:116851525-116851547 TGATAGAAAACAAATGATTTTGG + Intergenic
996066443 5:119084426-119084448 TTAAGCAAAAAGAACGCTTTTGG - Intronic
996529702 5:124515309-124515331 TGAAACAAAATGAATGAATTTGG + Intergenic
996689928 5:126329475-126329497 TGAGGCAATCAGAATGCTTTTGG + Intergenic
996697553 5:126415473-126415495 GCATGCAAAAAAAATGTTTTTGG + Intronic
999882983 5:155888085-155888107 AGAGGCAAAAAGACTGAATTTGG - Intronic
1000084509 5:157877590-157877612 TGAAGCAAAAAGATTGCTTGAGG - Intergenic
1000877155 5:166655140-166655162 TGAGGCGAAAATAATGATTGAGG - Intergenic
1000884806 5:166739064-166739086 TTATGCAAAAAGCATTGTTTGGG - Intergenic
1003428277 6:6013361-6013383 TGTTGAAAATATAATGATTTTGG + Intergenic
1004080265 6:12385796-12385818 TGAAGCAGACAGAATGAGTTAGG - Intergenic
1004126388 6:12878072-12878094 AGGTGGAAAAAGCATGATTTTGG - Intronic
1004285704 6:14318614-14318636 TTCTGCAAATAGAATTATTTTGG + Intergenic
1004910510 6:20278257-20278279 TTAAACACAAAGAATGATTTAGG - Intergenic
1005130519 6:22502292-22502314 TTCTGGAAAAAGAATGATTCAGG + Intergenic
1005238277 6:23791867-23791889 TGTTGGATAAAGAACGATTTAGG - Intergenic
1005277956 6:24239785-24239807 TAATGCAAAAAGAATTTTGTGGG + Intronic
1005610701 6:27521632-27521654 TGATGGAAAAAGAAAAGTTTAGG - Intergenic
1006251982 6:32795274-32795296 TTAAGCATAAACAATGATTTGGG - Intergenic
1006993655 6:38237903-38237925 TGAGGCAAAAAGACTGCTTGAGG + Intronic
1007909045 6:45494803-45494825 TTATTCAATAAGTATGATTTGGG + Intronic
1008148825 6:47925263-47925285 TGAAGCAAAAAGTTTGTTTTTGG + Intronic
1008185050 6:48378444-48378466 TCATGCAAATAGAATGATGCTGG - Intergenic
1008198961 6:48562591-48562613 AGATGAAAAAAGTATGAATTTGG + Intergenic
1008602234 6:53107490-53107512 TGATGCAAATAGGAAGGTTTGGG + Intergenic
1008715395 6:54283370-54283392 TGGTGCAGAAAGAGTGTTTTGGG + Intergenic
1010049796 6:71489364-71489386 TGATGTAAAAAGAAACCTTTAGG - Intergenic
1010817163 6:80371922-80371944 TGAAGCAAAAAGAACAAATTTGG - Intergenic
1010931029 6:81803545-81803567 TGAAGGCAACAGAATGATTTAGG - Intergenic
1011439799 6:87375885-87375907 TGATTCAGAAAGAATTAATTCGG + Intronic
1011671705 6:89689701-89689723 TGATTCAAGAAAATTGATTTAGG - Intronic
1012062443 6:94505796-94505818 GGATTCCAAAAGAATCATTTGGG + Intergenic
1012106823 6:95171994-95172016 TGCTGCTAAATGAATGAATTGGG + Intergenic
1012122164 6:95382767-95382789 TGAAGTAAAAAAAATGATCTGGG + Intergenic
1012382138 6:98632742-98632764 TGTTATAAAAAGAATGAGTTGGG + Intergenic
1012804129 6:103873863-103873885 CAATGCACAAAGAAGGATTTAGG + Intergenic
1012831284 6:104206379-104206401 TGATGCAAAAATGAAAATTTTGG - Intergenic
1013050611 6:106531153-106531175 GAATGCAAAAAGCATGATTAAGG - Intronic
1013920328 6:115395567-115395589 TTATGTAAAAAGACTGATTAGGG - Intergenic
1014066793 6:117136496-117136518 TGATGCAATAGGCATGATTAGGG - Intergenic
1014367912 6:120567585-120567607 TTATGCAAATATAATCATTTTGG + Intergenic
1014443902 6:121504371-121504393 ACATGCAAATATAATGATTTAGG + Intergenic
1015491162 6:133827138-133827160 AGATTCTAAAAGTATGATTTGGG + Intergenic
1015721625 6:136248663-136248685 TAATGGAAAGAGGATGATTTAGG - Intronic
1016015840 6:139185124-139185146 TTCTGAAAAGAGAATGATTTGGG + Intergenic
1016545536 6:145219018-145219040 TGAAGGAAGAAGAAAGATTTTGG + Intergenic
1016559608 6:145380506-145380528 AGATGCAAAAAACATGCTTTGGG + Intergenic
1019114602 6:169749631-169749653 TAATGCAAAGAAAATGATTGAGG - Intronic
1021652138 7:22842730-22842752 TAAAGCAAAAAGCATGATTTAGG + Intergenic
1022279369 7:28890509-28890531 TGTTGGAAAAAAAATGTTTTTGG + Intergenic
1023043845 7:36194941-36194963 AGTTGCAAAGAGAAAGATTTTGG - Intronic
1023266818 7:38414963-38414985 TGTTAGAAAAAAAATGATTTGGG - Intronic
1023296530 7:38720898-38720920 TGGGGCAAAAAGATTAATTTTGG + Intergenic
1023355068 7:39358278-39358300 TGAAGGAAAAAGAATAATGTGGG + Intronic
1025205955 7:56993577-56993599 TGATGCACAGAGAATGAGTGGGG + Intergenic
1025293666 7:57756582-57756604 TTCTACAAAAAGAGTGATTTTGG + Intergenic
1025665985 7:63583362-63583384 TGATGCACAGAGAATGAGTGGGG - Intergenic
1027633753 7:80643194-80643216 TGAATAAAGAAGAATGATTTGGG + Intronic
1028483510 7:91333767-91333789 TGATGTAATAAGAAGGAATTAGG - Intergenic
1028635503 7:92984755-92984777 TGATTCAATAAGAATGAAGTAGG - Intergenic
1028705629 7:93841704-93841726 TGATGATAAAATATTGATTTGGG + Intronic
1028735611 7:94208701-94208723 TGCAGCAAAAACAATGTTTTGGG - Intergenic
1029056864 7:97754518-97754540 TTATGCAAAAAGAAATACTTAGG + Intergenic
1029122861 7:98280380-98280402 TGATGCAAAAGGATTGGTTGAGG + Intronic
1030488801 7:110205350-110205372 TGATGGAAAAAGACACATTTAGG - Intergenic
1030849542 7:114466013-114466035 TGTTGCAATAAATATGATTTGGG - Intronic
1030867496 7:114717453-114717475 TTATCCAGAAAGGATGATTTAGG + Intergenic
1030913667 7:115284832-115284854 TAATGCAAAAATTCTGATTTTGG - Intergenic
1031065145 7:117096550-117096572 TGATGCTAAAAGCATGAGCTTGG + Intronic
1031154352 7:118091799-118091821 TGATGAATAAATAATGAATTAGG + Intergenic
1031205020 7:118745282-118745304 TGATGAAAAATGAATGAAGTGGG + Intergenic
1031287830 7:119894265-119894287 TAATTCAAAATGAAAGATTTTGG - Intergenic
1031678972 7:124647071-124647093 TAATAAAAACAGAATGATTTGGG + Intergenic
1032375228 7:131408595-131408617 TGATTTAAAAAACATGATTTAGG - Intronic
1032412623 7:131708894-131708916 TGATACAATAAGAATGAAATCGG - Intergenic
1032542489 7:132714913-132714935 TGATGGAAAAAACAGGATTTAGG - Intronic
1033137107 7:138794733-138794755 TGATGCAAAATGTATGAGTGAGG + Intronic
1033295797 7:140133670-140133692 AGATTAAAAAAAAATGATTTTGG + Intronic
1034678165 7:152907472-152907494 TGATGCAGAAAGAATATTTGAGG + Intergenic
1035692502 8:1569324-1569346 TTAGGGAAAAAGAATGATTGGGG - Intronic
1037133189 8:15430851-15430873 AGATGCAAAAAGAATAAAATTGG - Intronic
1037412476 8:18613262-18613284 TTATTCAGAAAGAATCATTTGGG - Intronic
1039826044 8:41174863-41174885 TGCTGAAAACAGAATGATTGTGG - Intergenic
1039993946 8:42514894-42514916 TGATGGAAAAAGAGAGACTTTGG + Intronic
1040102541 8:43518381-43518403 TGAAGCAAAAAGGATGATTTTGG + Intergenic
1040370637 8:46769207-46769229 TTATGCAAAAAGAAATATTTAGG - Intergenic
1041813197 8:61935711-61935733 TAATGCAAATACAAAGATTTGGG - Intergenic
1041822722 8:62056744-62056766 TGCTACAAAAACAATGCTTTGGG + Intergenic
1042213778 8:66408259-66408281 TGAATCAAAAAAAATTATTTTGG - Intergenic
1043006115 8:74820819-74820841 TGAGGAACAAAGGATGATTTGGG + Intronic
1043464298 8:80489150-80489172 TAATGGAAAAAGAATGGATTTGG + Intronic
1043589682 8:81815046-81815068 TGTTTCAAAAAAAATGATTTGGG - Intronic
1043705549 8:83344466-83344488 TGATTCAAACAGAATTTTTTTGG - Intergenic
1044034467 8:87283239-87283261 GGAAGCAAAAAGAAGTATTTTGG - Intronic
1044327598 8:90877315-90877337 GGATGCACTAAGGATGATTTGGG - Intronic
1045257504 8:100540576-100540598 TGATGGAGAAAGAAAAATTTAGG - Intronic
1045644105 8:104283495-104283517 TGTTAGAAAAAAAATGATTTGGG - Intergenic
1046082994 8:109395135-109395157 TGATTTAAAAATAATGAATTTGG - Intronic
1046124985 8:109894820-109894842 AGATGCAAGAAGAATCACTTGGG + Intergenic
1046169301 8:110484668-110484690 GGCTGTAAAATGAATGATTTTGG + Intergenic
1046856294 8:119035610-119035632 GGATGCAAAATGACTGAGTTGGG - Intronic
1047445080 8:124912428-124912450 TGTTGGAAAAGAAATGATTTGGG - Intergenic
1047890921 8:129308412-129308434 TGCTGCAAAATGAAAGATTGTGG - Intergenic
1048115655 8:131519016-131519038 TGATGCAAAGAGTGTGCTTTGGG - Intergenic
1048272698 8:133042171-133042193 TGAGTCAATAAGATTGATTTTGG - Intronic
1048475389 8:134738166-134738188 TGATGCACACAAAATGATTTAGG - Intergenic
1048584697 8:135764116-135764138 AGAGGCGAAAAGAATCATTTAGG + Intergenic
1048732320 8:137456663-137456685 TGATTCAAAATGAATGGTGTTGG + Intergenic
1050411463 9:5370417-5370439 AACTGCAATAAGAATGATTTTGG - Intronic
1050614986 9:7392623-7392645 CGATGCACAAAGTAAGATTTAGG - Intergenic
1050839842 9:10134533-10134555 TGCTGGAAAAAAAATGGTTTTGG - Intronic
1051809998 9:21037580-21037602 TGAGGCAAAAAGGATGATTCTGG + Intergenic
1052435381 9:28421399-28421421 TTCTGCAAAAAAAATGCTTTTGG - Intronic
1052877845 9:33580688-33580710 GGATTCCAAAAGGATGATTTTGG + Intergenic
1053219561 9:36300585-36300607 AGATGCAAAAAGAAATGTTTGGG - Intronic
1053662989 9:40297524-40297546 GGATTCAAAAAGGATGATTCTGG + Intronic
1053664428 9:40307590-40307612 GGATTCAAAAAGGATGATTCTGG + Intronic
1053664949 9:40310852-40310874 GGATTTAAAAAGAATGATTTTGG + Intronic
1053913495 9:42928054-42928076 GGATTCAAAAAGGATGATTCTGG + Intergenic
1053914527 9:42935902-42935924 GGATTTAAAAAGGATGATTTTGG + Intergenic
1054162826 9:61688949-61688971 TTCTACAAAAAGAGTGATTTTGG - Intergenic
1054375114 9:64443748-64443770 GGATTCAAAAAGGATGATTCTGG + Intergenic
1054519666 9:66065432-66065454 GAATTTAAAAAGAATGATTTTGG - Intergenic
1054520186 9:66068695-66068717 GGATTCAAAAAGGATGATTCTGG - Intergenic
1054521626 9:66078760-66078782 GGATTCAAAAAGGATGATTCTGG - Intergenic
1054950849 9:70849486-70849508 TGATCCAAAATGGATGATCTGGG + Intronic
1054989471 9:71306192-71306214 AGATGAAAAAAGAAACATTTTGG + Intronic
1055815043 9:80195083-80195105 ATATGCAAAAATAATGCTTTAGG - Intergenic
1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG + Intergenic
1056561822 9:87736822-87736844 TAAACAAAAAAGAATGATTTTGG + Intergenic
1056610375 9:88121990-88122012 GGATTCCAAAAGGATGATTTTGG + Intergenic
1057161319 9:92890395-92890417 GGATTCCAAAAGGATGATTTTGG - Intergenic
1057677607 9:97148013-97148035 GGATTCCAAAAGGATGATTTTGG - Intergenic
1058432518 9:104931184-104931206 AATTCCAAAAAGAATGATTTTGG - Intergenic
1058853292 9:109034368-109034390 TCATTCCAAAAAAATGATTTAGG + Intronic
1203657100 Un_KI270753v1:8560-8582 TGTTAGAAAAATAATGATTTGGG + Intergenic
1186049958 X:5581169-5581191 ATATGCAAAAAGAATGAAATTGG + Intergenic
1187382286 X:18814155-18814177 TGCTGCAAAAGAAATGATTTTGG + Intronic
1187738671 X:22330863-22330885 TGATGCCAAAAGCATGATCCAGG - Intergenic
1188181237 X:27058270-27058292 TGTTAGAAAAGGAATGATTTTGG + Intergenic
1188303636 X:28535492-28535514 TGATAAAGAAAGAATGATTTAGG - Intergenic
1188382796 X:29518153-29518175 AGAGGCAAAAATCATGATTTTGG + Intronic
1188830917 X:34895818-34895840 TGTTACAAAAGAAATGATTTTGG - Intergenic
1188872917 X:35396731-35396753 TGATTCAAAAATAATAATTTTGG + Intergenic
1189208773 X:39265163-39265185 TGGTGGAAAAAGAATGAGATAGG - Intergenic
1189658257 X:43269546-43269568 AGTTGCTAAAAGCATGATTTAGG - Intergenic
1189827526 X:44934854-44934876 TCAGGAAAAAAGAATCATTTTGG + Intronic
1190004316 X:46720466-46720488 TGATGGAGAAGGAATGATTGGGG - Intronic
1190189613 X:48266477-48266499 TTATGAGAAAGGAATGATTTGGG - Intronic
1190658374 X:52632981-52633003 TTATGAGAAAGGAATGATTTGGG - Intergenic
1191057662 X:56259256-56259278 TGATGCATGCAGAATAATTTAGG - Intronic
1191710187 X:64141788-64141810 AGATGCAAAAAAAATGATAAAGG + Intergenic
1192246454 X:69376497-69376519 TGATACTCAAAGAATGAGTTGGG - Intergenic
1192462414 X:71328635-71328657 TGATGGAAAAAAAATGATAGGGG - Intergenic
1192876505 X:75235077-75235099 AGATGCAAAAAAAATGATAAAGG + Intergenic
1192957335 X:76086354-76086376 AGATGCAATAAAAATGATATAGG - Intergenic
1193018187 X:76759595-76759617 AGATGCAAAAAAAATGATAATGG + Intergenic
1193136542 X:77977571-77977593 TGATGCAAACAGGCTGTTTTGGG - Intronic
1193242622 X:79189552-79189574 TGATGCAAAAAAAATACATTTGG - Intergenic
1193302900 X:79913142-79913164 GCATGCAAAAAAAATGAATTTGG + Intergenic
1193520346 X:82522310-82522332 TCATTGAAAAAGAATAATTTTGG + Intergenic
1193826981 X:86238154-86238176 TGAGGTAAAAAGAGTGATTAGGG - Intronic
1195215246 X:102693168-102693190 AGATGCAAAACAAATTATTTAGG + Intergenic
1196158720 X:112459171-112459193 TGAAGCAAAATAAATAATTTAGG + Intergenic
1196323876 X:114377907-114377929 TTATACATACAGAATGATTTAGG - Intergenic
1197721607 X:129748662-129748684 AGATGCAGAAAGAATGATTCTGG - Intronic
1198630798 X:138636190-138636212 TGATCCAAAAAAAATCAATTTGG - Intronic
1198845863 X:140909813-140909835 TGAAGAAACAAAAATGATTTAGG + Intergenic
1199544842 X:148997192-148997214 GGGTGGAAAAAGAATTATTTTGG - Exonic
1200880081 Y:8203331-8203353 ATCTGCAAAAAGAATGATTGAGG - Intergenic
1200973426 Y:9180664-9180686 TTATGCAAAATAAATGAATTTGG - Intergenic
1201408054 Y:13668767-13668789 TGTTAGAAAATGAATGATTTGGG - Intergenic
1201523256 Y:14901326-14901348 AAATACAAACAGAATGATTTCGG + Intergenic
1201622605 Y:15977122-15977144 TGATGAAAAAAGGGTGGTTTTGG + Intergenic
1201753222 Y:17457519-17457541 TTAAGCAAAAAGAATGAATCTGG + Intergenic
1201848331 Y:18448464-18448486 TTAAGCAAAAAGAATGAATCTGG - Intergenic
1202335397 Y:23803887-23803909 TTAAGCAAAAAGAATGAATCTGG + Intergenic
1202535370 Y:25866172-25866194 TTAAGCAAAAAGAATGAATCTGG - Intergenic