ID: 1172864373

View in Genome Browser
Species Human (GRCh38)
Location 20:38084348-38084370
Sequence CTGTTGTGCTACAGGACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172864373_1172864378 1 Left 1172864373 20:38084348-38084370 CCATATGTCCTGTAGCACAACAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1172864378 20:38084372-38084394 GCAAGATGATGGAGATTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 194
1172864373_1172864377 -10 Left 1172864373 20:38084348-38084370 CCATATGTCCTGTAGCACAACAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1172864377 20:38084361-38084383 AGCACAACAGGGCAAGATGATGG 0: 1
1: 0
2: 3
3: 55
4: 258
1172864373_1172864380 23 Left 1172864373 20:38084348-38084370 CCATATGTCCTGTAGCACAACAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1172864380 20:38084394-38084416 GAGTCCTCTACTTAGCAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172864373 Original CRISPR CTGTTGTGCTACAGGACATA TGG (reversed) Intronic
901110646 1:6791306-6791328 GCCTTGTGCTACAGGACAAAGGG - Intronic
905993302 1:42358923-42358945 CTGTCCTGCTACATGACACAAGG - Intergenic
907217870 1:52881456-52881478 ATGTTGTTCTACAGGTCAGATGG - Exonic
907717406 1:56940097-56940119 CTGCTATGCTACAGGAAGTAAGG - Intronic
907804982 1:57809967-57809989 GTGTTGTGCAACAGGAAATTTGG - Intronic
910843560 1:91584603-91584625 CTGATGTGCTATATGACATAAGG + Intergenic
910871279 1:91835382-91835404 GTGTTGTGCTACAGTTCATCTGG - Intronic
912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG + Intergenic
916690576 1:167186197-167186219 CTGGTGTGCTACAGCAGACATGG + Intergenic
917192315 1:172431057-172431079 CTGTTGTGTCTCAGGAAATAGGG - Intronic
918335194 1:183503542-183503564 TTGTGGTGGTAGAGGACATAGGG + Intronic
919813071 1:201421095-201421117 CTCTTGTGCTACACTACAGAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921614786 1:217253629-217253651 ATGTTATGCTACATGACAAAAGG - Intergenic
1064055546 10:12094192-12094214 CTGTTGTGCTACAGGCAGTGGGG + Exonic
1069207518 10:65710414-65710436 TTGTTGTGTCACAGGAAATAAGG + Intergenic
1074676441 10:115856624-115856646 CTGTTGCACTACAGGTCATCAGG + Intronic
1075193342 10:120331586-120331608 CTGTTGTGTTTCAGGGAATAGGG - Intergenic
1075354521 10:121758966-121758988 TTGTTGTGTTTCAGGAAATAGGG - Intronic
1075691366 10:124397008-124397030 CTGTTGAACTACAGGGTATATGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077522016 11:3042081-3042103 CTGTTGTGCGACAAGGCACATGG + Intronic
1079874607 11:25840947-25840969 ATGTTGTGGTACATGGCATATGG - Intergenic
1081485733 11:43526751-43526773 GTGTTGTGCTTCAGGGAATAGGG + Intergenic
1085863784 11:80263793-80263815 CTATTGTGCTACAGAACACTAGG + Intergenic
1089268970 11:117288166-117288188 CTCTTGTGGTGGAGGACATAAGG + Exonic
1093080805 12:14808490-14808512 CCGTAGTGCTAGAAGACATACGG - Intronic
1101553471 12:105785097-105785119 CTGATGTGCTACTGTACAGAAGG - Intergenic
1103008282 12:117438983-117439005 CAGTCGTGCTCCAGGACATGTGG + Intronic
1109844322 13:67965921-67965943 CTGTTGTGCTCCAGAATAAATGG - Intergenic
1110103889 13:71645570-71645592 AAGTTGTGCTACAGTACACAGGG + Intronic
1112623075 13:101071940-101071962 TTGTTGTGTCTCAGGACATAGGG + Intronic
1114652516 14:24294898-24294920 CTGGTGTGGTAGAGGACATGGGG + Intronic
1114965799 14:27957601-27957623 CTGTGGCGCTACGGGAGATAAGG + Intergenic
1117305929 14:54473089-54473111 CTGTGGTGCTTCAGAACACAGGG - Intergenic
1125889988 15:43258710-43258732 CTGTGGTGCTGCAGGACAGGAGG - Intronic
1126986597 15:54318165-54318187 CTGTTGTGCTGCAATACACATGG + Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1131005537 15:88974440-88974462 CTGTTTTCCTACAGGGCAGACGG - Intergenic
1139082077 16:63534557-63534579 CTGTTGTGTTTCAGGAATTAGGG + Intergenic
1141154979 16:81591011-81591033 CAGTTGTGAGACAGGGCATATGG + Intronic
1146237817 17:31184774-31184796 CTCTTTTTCTACAGGAGATAAGG - Intronic
1146691653 17:34880867-34880889 CTGTTGTGGTAGAGAAGATAGGG - Intergenic
1146789412 17:35743038-35743060 CTGCTGTGCTGCAGGACTTTGGG + Exonic
1153571353 18:6476400-6476422 CTCTTGTGCTGCAGGAGATAAGG + Intergenic
1154254099 18:12767885-12767907 CTCTCTTGCTACAGGAGATAAGG - Intergenic
1156071264 18:33213332-33213354 CTCTTCTTCTACAGGAAATAAGG + Intronic
1160097296 18:75886580-75886602 CTTTTGTGCTTCAAGACCTAAGG - Intergenic
1165125018 19:33588253-33588275 TTGTTGTGTCTCAGGACATAGGG - Intergenic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
924982186 2:234355-234377 ATGTTTTGCTACAGTGCATATGG - Intronic
925439335 2:3870360-3870382 CTGTTGTCCCACATGACATCTGG + Intergenic
926722270 2:15969848-15969870 CTGTTGTGTTTCAGGGAATAGGG + Intergenic
932626398 2:73299698-73299720 CTGTTCTCCTACAGGAGAGAGGG + Intergenic
935934341 2:108165722-108165744 CTTTGCTGCTACAGGACATCAGG - Intergenic
936925394 2:117731322-117731344 CTGTTGTGGTGGTGGACATAAGG + Intergenic
940068973 2:149663335-149663357 CTTTTGTGCTCTAAGACATAAGG - Intergenic
942207910 2:173640710-173640732 CTGTTGTTCTGCATGACATATGG - Intergenic
944955490 2:204803053-204803075 CAGTTGTGCTCCAGTACATCTGG + Intronic
948244480 2:236467583-236467605 CTGTTGTGCTTCTGGTCATTAGG + Intronic
948692585 2:239715920-239715942 CTGTTGTGTTGCCGGACAGAGGG + Intergenic
1172864373 20:38084348-38084370 CTGTTGTGCTACAGGACATATGG - Intronic
1174652306 20:52137338-52137360 TTGCTGGGCTACAGGACCTAGGG + Intronic
1183198346 22:36368789-36368811 TTGTTGTGCTGCAGGACCTGGGG - Intronic
950362075 3:12456616-12456638 GTGTTGTGCTGCTGGAGATAAGG - Intergenic
950632424 3:14291620-14291642 CTGTTGTGTTTCAGGAAATAGGG - Intergenic
955897791 3:63719079-63719101 CTGAGGTGCTAAAAGACATAAGG - Intergenic
964400255 3:156291045-156291067 CTGTTGTGCTGCAGCAGATTTGG + Intronic
966118700 3:176497237-176497259 CCTTTGTGCTAAAGGATATAGGG - Intergenic
967420553 3:189267805-189267827 ATGTTGTGCTATAGGCTATAAGG - Intronic
968004936 3:195236362-195236384 CTGTGGTGGTACTGGACACAGGG - Intronic
974462643 4:62207351-62207373 CAGTTTTGCAACAGGATATAGGG - Intergenic
976058538 4:81098626-81098648 CTGTTGTGTCTCAGGAAATAGGG + Intronic
976938696 4:90672809-90672831 TTGTTGTGTTTCAGGAAATAGGG + Intronic
980482310 4:133402549-133402571 CTGTTTTCCTGCAGGACTTAGGG + Intergenic
980769282 4:137350882-137350904 CTGTGGTGGTACAGCACACAAGG - Intergenic
981026368 4:140080825-140080847 CTGTTGTGCTATTCCACATAAGG + Intronic
983311484 4:166067972-166067994 CTGTTGTTTTCCAGGTCATAAGG - Intronic
984807491 4:183764956-183764978 CTTATGAGCTACAGGACCTAGGG - Intergenic
985910177 5:2873217-2873239 CTCTTGTGCTACAAGACTTGAGG + Intergenic
990697481 5:58436852-58436874 CTGTTGTGTCTCAGGAAATAAGG + Intergenic
991618042 5:68517363-68517385 CTATTGTGTTACAGGGGATATGG + Intergenic
996307267 5:122061876-122061898 CATTTGAGCTATAGGACATAAGG - Intronic
996838841 5:127823942-127823964 CTGTTGTGCTAGGTGACATGAGG - Intergenic
1000621962 5:163495917-163495939 CTCTGGGGCTACAGGAGATAGGG + Intergenic
1001144574 5:169172524-169172546 GTGTTGTGCTAAAGGATGTATGG - Intronic
1005347630 6:24906034-24906056 CTGTTGTTTTTCAGTACATAAGG + Intronic
1008916841 6:56797301-56797323 CTGTTGTGTTTCAGGGAATAAGG - Intronic
1010614855 6:78000291-78000313 CTATTGTGCTAGATTACATATGG + Intergenic
1010771768 6:79840112-79840134 CTGCTGTGCTGCAGGAAATCAGG + Intergenic
1012197092 6:96356731-96356753 CTGTTGTCCTCCAAGAAATACGG - Intergenic
1014756117 6:125303177-125303199 CTGCTGAGATACAGGAAATAAGG - Intergenic
1014969188 6:127792809-127792831 CTGTGCAGCTACAGGAAATATGG - Intronic
1016120728 6:140338873-140338895 CTGTTGTGCAAAGGAACATAAGG + Intergenic
1017451872 6:154561908-154561930 CGGTTCTGCTATAGGAGATAAGG - Intergenic
1018201130 6:161396759-161396781 CTGCTGTGCTAGAGAGCATAAGG - Intronic
1023601209 7:41883351-41883373 ATTTTGTGCTACAGGACGTTTGG - Intergenic
1024578825 7:50785408-50785430 AGGCTGTGCTGCAGGACATAGGG - Intronic
1030136874 7:106260749-106260771 CTGTTGTGTCTCAGGGCATAGGG + Intronic
1031263357 7:119550897-119550919 CTATTTTCCTACAGGACCTAAGG + Intergenic
1031682517 7:124692027-124692049 CTGTTCTGCTACTGGAGATACGG + Intergenic
1033175314 7:139118434-139118456 CAGGTGTTCTACAGGAGATATGG + Intergenic
1033859127 7:145603367-145603389 CTATTTTCCTAGAGGACATAGGG + Intergenic
1035896056 8:3403609-3403631 CTATTATGGTAAAGGACATAAGG + Intronic
1038973887 8:32670175-32670197 CTGTTATGCTACAGGACTTCAGG + Intronic
1042617247 8:70663419-70663441 CTACTGTGCTACAGAACATAGGG - Intronic
1042829606 8:73012125-73012147 TTGTTGTGTTTCAGGAGATAAGG + Intronic
1045173861 8:99698994-99699016 CTGGTTTGCAACAGGTCATAAGG + Intronic
1045605476 8:103768823-103768845 CATTTGTGCTGCAGGACACATGG - Intronic
1045967053 8:108037004-108037026 TTGTTGTACCACAGGGCATAGGG - Intronic
1047475855 8:125228680-125228702 CTGGTGTGTTACATGCCATATGG + Intronic
1049124982 8:140778623-140778645 CAGTTGTGCTACAGCAGACATGG + Intronic
1050332400 9:4558485-4558507 TTGCTGTGCTCCAGGACAGAGGG + Intronic
1051638197 9:19200513-19200535 CGTTTGTGCTGCAGGACACATGG + Intergenic
1052336754 9:27328109-27328131 CTGATGCACTAAAGGACATAAGG + Exonic
1052783154 9:32801840-32801862 CTGCTGTGTTATAGGACCTAAGG - Intergenic
1055112938 9:72577347-72577369 CTGTTGTGCCTCAGCACACAGGG + Intronic
1056415799 9:86375150-86375172 CGATTGTGCTGCAGGACATGTGG + Intergenic
1059442299 9:114315282-114315304 CAGTTGTGCAACAGGAGATTGGG - Intergenic
1187777969 X:22785140-22785162 CTGTTGTGCTATCGGATAGAAGG - Intergenic
1193091735 X:77501069-77501091 CTATTGTGTTTCAGGACCTATGG - Intergenic
1193833372 X:86314112-86314134 CTGTTGTGCCTCAGGGAATAGGG - Intronic
1196285608 X:113876042-113876064 ATGTGGTGCAACAGGACAGAAGG + Intergenic
1197652087 X:129076271-129076293 CTGTTTTGCTGCAGCACAGAGGG + Intergenic
1198058766 X:133022329-133022351 ATGTTGTGTTACAAGACATATGG + Intergenic