ID: 1172864453

View in Genome Browser
Species Human (GRCh38)
Location 20:38084981-38085003
Sequence CCCTAGCCCAGAAGAGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172864453_1172864460 16 Left 1172864453 20:38084981-38085003 CCCACGGCTCTTCTGGGCTAGGG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1172864460 20:38085020-38085042 GGTACTTGCCGCTGAATGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1172864453_1172864459 12 Left 1172864453 20:38084981-38085003 CCCACGGCTCTTCTGGGCTAGGG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1172864459 20:38085016-38085038 AGTAGGTACTTGCCGCTGAATGG 0: 1
1: 0
2: 0
3: 4
4: 73
1172864453_1172864457 -5 Left 1172864453 20:38084981-38085003 CCCACGGCTCTTCTGGGCTAGGG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1172864457 20:38084999-38085021 TAGGGCAGGTTTGCCGCAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172864453 Original CRISPR CCCTAGCCCAGAAGAGCCGT GGG (reversed) Intronic
901789989 1:11648995-11649017 CCCCAGCCCAGGAGCGCTGTGGG + Intronic
902694350 1:18130173-18130195 CCCCATCCCACAAAAGCCGTGGG + Intronic
903139935 1:21333315-21333337 CTCCAGCCCACCAGAGCCGTGGG + Intronic
903183156 1:21615165-21615187 CCCAAGCCCAGAGGAGCCCCCGG + Intronic
906640793 1:47439282-47439304 CCCTGGCGCAGAAGTGCGGTGGG - Exonic
906712438 1:47940945-47940967 CTCCAGCCCAGAAGAGCAGTAGG + Intronic
907114861 1:51959615-51959637 TCCCAGCCCAGAAGAGCCTAAGG + Intronic
909861138 1:80607165-80607187 CCCCAGCCTAGAAGAGCTGCAGG + Intergenic
915243849 1:154542650-154542672 CCCTAACCCACAAGAGGCCTTGG - Intronic
919085484 1:192916374-192916396 TCCTTGCCTAGAAGAGCCATTGG + Intergenic
922173654 1:223178222-223178244 CCCTAGCCCAGCAGAACCGTGGG + Intergenic
922225499 1:223642542-223642564 CCCTGGCCCAGAATAGTCCTCGG - Intronic
923208114 1:231778024-231778046 GTCCAGCCCAGCAGAGCCGTGGG + Intronic
924638944 1:245815273-245815295 GCAGAGCCCAGAAGAGCTGTTGG + Intronic
924708467 1:246516591-246516613 CCCTGGGCCAGGAGAGCCCTTGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1074612656 10:115036913-115036935 CCCTAGCCCAGAAGCCCAGCTGG - Intergenic
1074938973 10:118216228-118216250 CCTTACCCCAGCAGAGCCGAAGG + Intergenic
1076169494 10:128307700-128307722 TCCTAGCCCAGGAAAGCAGTGGG - Intergenic
1078612004 11:12829049-12829071 CCCTCGCCCTTAAGAGCCATCGG + Intronic
1083212721 11:61198720-61198742 CCCTTGACCAGAAGAACCCTTGG - Intergenic
1083433229 11:62625791-62625813 CCCTAACCCAGAACATCCCTTGG + Exonic
1083958195 11:65998538-65998560 TCCAAGCCCAGAAGAGCCAGGGG + Exonic
1088868903 11:113875273-113875295 CCCGAGCCCCGCAGAGCCCTTGG + Intronic
1091373665 12:12888-12910 CGCCAGCCCAGCAGAGCCCTAGG - Intergenic
1091712300 12:2750565-2750587 CCCTAGCCAAGGGAAGCCGTGGG - Intergenic
1095514226 12:42988059-42988081 CCCTAGCCTAGAAAAGCAGGTGG - Intergenic
1096178344 12:49537908-49537930 CCCGCGCCCAGAGGAGCCGCCGG - Intergenic
1097119374 12:56719742-56719764 CCCTAGCAAAGAAAAGCCTTGGG - Exonic
1098635559 12:72780113-72780135 CCCTAGCCAAGGAAAGCCATGGG + Intergenic
1107472469 13:40703514-40703536 CCTGAGCCCAGAAAAGCCGCAGG + Intergenic
1111676836 13:91398789-91398811 CCCTAGCCGAGAAGAGTGGGCGG - Exonic
1112328079 13:98457138-98457160 CCCCAGCCCAGAGGGGCCCTGGG + Intronic
1117329435 14:54697802-54697824 TCCTAGCCCAGATAAGCCTTTGG - Intronic
1121736894 14:96225052-96225074 CCCATCTCCAGAAGAGCCGTTGG + Intronic
1124552410 15:30693663-30693685 CACTAGCCCAGAAGTGCTCTGGG + Intronic
1124594893 15:31084030-31084052 CCCTGGCCCAGGAGAGGGGTCGG - Intronic
1124678830 15:31712003-31712025 CACTAGCCCAGAAGTGCTCTGGG - Intronic
1129031731 15:72623591-72623613 GCCTAGCACAGAACAGCCGATGG + Intergenic
1134773335 16:16830066-16830088 GCCCAGCCCAGGAGAGCCATGGG - Intergenic
1137665804 16:50248253-50248275 CCCATACCCAGAAGAGCCCTGGG + Intronic
1138730547 16:59189322-59189344 ATCTAGCCCAGCTGAGCCGTCGG - Intergenic
1139459552 16:67110670-67110692 CCACAGCCCAGAAAAGCAGTGGG - Intronic
1142150552 16:88510749-88510771 CCTCAGCTCAGAAGAGCCCTGGG + Intronic
1142356069 16:89602680-89602702 CCCTGGCACAGCAGGGCCGTGGG + Intergenic
1143565025 17:7716028-7716050 CTCTAGCCCCGAAGAGCCCCTGG + Intergenic
1143715557 17:8765991-8766013 CCCTAGCCCAGAAGAGCATCAGG - Intergenic
1144494721 17:15738940-15738962 CCCTGGGCCAGGAGAGCCCTTGG - Intronic
1144576299 17:16431920-16431942 CCTTAGCCCAGGAGACCGGTGGG - Intronic
1144905535 17:18637732-18637754 CCCTGGGCCAGGAGAGCCCTTGG + Intronic
1148339948 17:46867489-46867511 ACCTAGGCCAGAACAGCCTTGGG + Intronic
1149015133 17:51900355-51900377 CCCTAGCCCAGAAGAGATTGGGG - Intronic
1150157842 17:62869053-62869075 CCCTCCCCCAGAGGAGCCTTGGG + Intergenic
1151473671 17:74333058-74333080 CCCGAGCCCAGAAGTGCTGCGGG + Intronic
1165150900 19:33759544-33759566 CACTGGCCCAGAAGAGCCACAGG + Intronic
926672980 2:15592326-15592348 GCCAAGCCCAGATGAGCCGCGGG - Intronic
927711513 2:25329015-25329037 CCCAAGCCCTGAAGACCCTTTGG - Intronic
932084690 2:68747590-68747612 CCAGAACCCAGAAGAGACGTTGG - Intronic
935737669 2:106119354-106119376 CCCTAGCCCATAAGTGGGGTTGG - Intronic
936807838 2:116358644-116358666 CCCTAGCCAAGAGAAGCCCTGGG + Intergenic
938630225 2:133158839-133158861 CCAGTGCCCAGAAGAGCAGTAGG - Intronic
945254270 2:207790881-207790903 CCCTATTCCAGAAGGGCAGTGGG - Intergenic
946967726 2:225055642-225055664 CCCTAGGTCAGAAGGGCAGTGGG - Intergenic
947702834 2:232249495-232249517 CCCTGCCTCGGAAGAGCCGTTGG + Intronic
948228748 2:236334384-236334406 CTCTGGCCCAGAAGTGCAGTGGG + Intronic
948912085 2:241009842-241009864 GCCTAGCCCAGTATTGCCGTCGG + Intronic
1171472485 20:25383205-25383227 CCCTAACCCAGAAGAGTGGGTGG - Intronic
1172864453 20:38084981-38085003 CCCTAGCCCAGAAGAGCCGTGGG - Intronic
1175470624 20:59224369-59224391 CCCTAGGGCAGAAGAGCACTGGG + Intronic
1175802934 20:61811535-61811557 CCCTAGCCCAGAACATCCCAGGG + Intronic
1175851029 20:62093093-62093115 CCCCTGCCCAGCAGAGCCCTGGG + Intergenic
1176035518 20:63034480-63034502 CCAAAGCCCAGCAGAGACGTGGG - Intergenic
1176369440 21:6053598-6053620 CCCTAGCCCAGAGGAGGCCCCGG + Intergenic
1177464554 21:21458390-21458412 CCCTAGCTCTGGAGAGCCGCTGG + Intronic
1179638694 21:42732390-42732412 TCCCATCCCAGAAGAGCCGGTGG - Intronic
1179754079 21:43484943-43484965 CCCTAGCCCAGAGGAGGCCCCGG - Intergenic
1180373939 22:12073369-12073391 CCCTTACCCAGAAGAACTGTTGG + Intergenic
1182966704 22:34528408-34528430 CCCTAGCCAATGAGAGCCTTGGG - Intergenic
1183084060 22:35475615-35475637 CCCTCCCCAAGAAGAGCCGTGGG - Intergenic
1183304964 22:37077936-37077958 CCCCAGCCCAGCAGGGCCGGTGG + Intronic
1184241694 22:43214389-43214411 ACCTATCCCAGAAGAGCCTGGGG + Intronic
1184243054 22:43221418-43221440 CCCCACCCCAGGAGAGCTGTCGG - Intronic
1184870182 22:47232864-47232886 CCCTGGCCCAGAACAGCCCCCGG - Intergenic
1185140581 22:49098845-49098867 CCCTTTCCCAGAAGAGCTCTGGG - Intergenic
950768733 3:15293519-15293541 CCCTAGCCAAGAAGAGGCAGGGG + Intronic
956726368 3:72159737-72159759 CCCTAGCACAGAAGAGAGGGTGG + Intergenic
957907051 3:86570414-86570436 CTCTAGCCCAGATAAGCCGCTGG - Intergenic
959564704 3:107822580-107822602 CCCTTGCCCAGCATAGCCTTGGG + Intergenic
963600871 3:147378016-147378038 CCCTAGCCCAGGAGAGGCGGGGG + Intergenic
968648546 4:1751473-1751495 CCCTGGCCCAGAAGAGCCCCAGG - Intergenic
969841949 4:9889233-9889255 GCCAAGCACAGAAGAGCCCTAGG + Intronic
980105740 4:128586615-128586637 CACTAGACCAGAAGAGGCCTGGG - Intergenic
980719770 4:136680041-136680063 CCCTAGCCCTGATGAGCTGGTGG - Intergenic
982598314 4:157413841-157413863 TGCTAGCCTAGAAGAGTCGTAGG - Intergenic
983605150 4:169574649-169574671 TCCTAACACAGAAGAGCAGTAGG + Intronic
1202755524 4_GL000008v2_random:58808-58830 CCCTTACCCAGAAGAACTGTTGG + Intergenic
986697106 5:10367173-10367195 CCCGAGCCCAGAGGAGCCCAAGG + Intronic
997109395 5:131058340-131058362 CCCCAGACCAGGAGAGCTGTGGG - Intergenic
997821448 5:137069713-137069735 AACTAGCCCAGAAGAGGCGGAGG - Intronic
1001822022 5:174718074-174718096 CCAGTGCCCAGAAGAGCCTTTGG - Intergenic
1001931831 5:175678638-175678660 CGCTCGCCCAGAAGGGGCGTCGG + Intronic
1011489052 6:87872002-87872024 CCCTAGCCCAAGAGAGCAATGGG + Intergenic
1015245430 6:131068947-131068969 CCTGAGCCCAGAAGAACTGTGGG - Intergenic
1016751309 6:147633353-147633375 CCGCAGCCCAAAAGAGCCCTCGG - Intronic
1019443142 7:1057423-1057445 CCCTGGCCCAGAAGTGCTGCAGG - Intronic
1020881099 7:13764194-13764216 CCCTAGCCTAGGAAAGCTGTAGG + Intergenic
1027829051 7:83154990-83155012 GCCTAGCCCAGCAAAGCCCTCGG - Exonic
1029524578 7:101087207-101087229 CCCTAGCCCTGGGGATCCGTGGG + Intronic
1031306368 7:120131678-120131700 CCCAAGGCCAGAATAGCCCTGGG - Intergenic
1031973824 7:128081662-128081684 TCCAAGCCCAGAGGAGCAGTGGG - Intronic
1032251732 7:130263304-130263326 CTCTAGCCCAGATCAGCCCTGGG + Intergenic
1033790901 7:144791369-144791391 CCCTGTCCCATAAGAGCCGGAGG + Intronic
1036425937 8:8645429-8645451 CCCTAGCCCTGCAGTGCCCTCGG + Intergenic
1036617099 8:10396795-10396817 CCCAAGCCCAGTAAAGCCGATGG + Intronic
1036649298 8:10632110-10632132 CCCTGGCCCGGAAGAGGCTTCGG + Intronic
1037480807 8:19303444-19303466 CCCAAGCCCAGAACAGCCTCAGG - Intergenic
1037646322 8:20795887-20795909 CCCTGGGGCAGAAGAGGCGTGGG + Intergenic
1038010976 8:23475531-23475553 CTCTACCCCAGAGGAGGCGTAGG - Intergenic
1038436804 8:27541889-27541911 CCCCAGCCCAGAGGAGCGTTAGG + Intronic
1040341738 8:46444530-46444552 ACCTAGCCCAGGAAAGCCCTGGG + Intergenic
1040761378 8:50849446-50849468 CCCTAGACCTGAAGTGCTGTAGG + Intergenic
1044082602 8:87903997-87904019 CTCTAGCCCAGGAGAGCCACAGG - Intergenic
1047784433 8:128139949-128139971 CCCTTGCTCAGAAGAGCCCCAGG + Intergenic
1049831749 8:144705248-144705270 CCCTTGCCCAGCAGACCCTTGGG + Intergenic
1051689526 9:19695333-19695355 CCAAAGCCCAAAAGAGCCTTTGG - Intronic
1052881431 9:33603045-33603067 CCCTGGGCCAGGAGAGCCCTTGG - Intergenic
1053309201 9:37005170-37005192 CCCTAGCCCAGCAGAGCTGGTGG + Intronic
1053494886 9:38542800-38542822 CCCTGGGCCAGGAGAGCCCTTGG + Exonic
1053667308 9:40325217-40325239 CCCTGGGCCAGGAGAGCCCTTGG - Intronic
1054378453 9:64465245-64465267 CCCTGGGCCAGGAGAGCCCTTGG - Intergenic
1054517302 9:66051066-66051088 CCCTGGGCCAGGAGAGCCCTTGG + Intergenic
1057191131 9:93088239-93088261 CCATTGCCCAGGAGAGCTGTGGG + Intergenic
1060102865 9:120856058-120856080 CCCTAGCCCAGGGGTGCTGTGGG - Exonic
1061366473 9:130174538-130174560 GCCTGGCCCAGAAGAGCTCTTGG - Intronic
1061481882 9:130901545-130901567 CCCTAGCCCTGCAGAGCCTACGG - Intergenic
1061905180 9:133693015-133693037 CCCCAGCCCCGAAGACCCGCTGG + Intronic
1062075473 9:134586331-134586353 CCCCAGCCCAGCAGAGGCCTGGG - Intergenic
1203536325 Un_KI270743v1:43644-43666 CCCTTACCCAGAAGAACTGTTGG + Intergenic
1190047966 X:47127757-47127779 GCCCAGCCCAAAAGAGCCCTAGG - Intergenic
1195434756 X:104829357-104829379 CCCTAGCCAAGGGAAGCCGTGGG - Intronic
1196285304 X:113872209-113872231 CCTTATCTCAGAAGAGCCTTTGG + Intergenic
1197173345 X:123458477-123458499 CCCTAGCTCAGAGGAGGCATAGG - Intronic
1198154534 X:133945842-133945864 CCCTCTCACAGAAGAGCCATAGG + Intronic