ID: 1172864541

View in Genome Browser
Species Human (GRCh38)
Location 20:38085691-38085713
Sequence CTTTGGGTCTGGAGAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172864541_1172864548 7 Left 1172864541 20:38085691-38085713 CCTTCATCTCTCCAGACCCAAAG 0: 1
1: 1
2: 4
3: 35
4: 308
Right 1172864548 20:38085721-38085743 CCTGGAAAGTCAGCTAGTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 139
1172864541_1172864546 6 Left 1172864541 20:38085691-38085713 CCTTCATCTCTCCAGACCCAAAG 0: 1
1: 1
2: 4
3: 35
4: 308
Right 1172864546 20:38085720-38085742 ACCTGGAAAGTCAGCTAGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172864541 Original CRISPR CTTTGGGTCTGGAGAGATGA AGG (reversed) Intronic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
900943778 1:5817866-5817888 CTGTGGAGCTGGACAGATGAGGG - Intergenic
901805220 1:11734591-11734613 CTTTGCATCTGGAGAGACTATGG + Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902527254 1:17067325-17067347 CTCTGGGGCTGGAGAGATCTGGG + Exonic
903297886 1:22356992-22357014 CTTGGGGAGTGGAAAGATGACGG - Intergenic
903490934 1:23727961-23727983 CTTTAGGTATGGAGAGATTTAGG + Intergenic
904256721 1:29259274-29259296 CCTGCGGTCTGGGGAGATGAGGG - Exonic
904288867 1:29470996-29471018 CCATGGGTCTGCAGAGAGGATGG - Intergenic
904447993 1:30590032-30590054 ATTAGGTTATGGAGAGATGAAGG - Intergenic
904637107 1:31890642-31890664 ATTTGAGTCTGGAGAGATCGAGG + Intergenic
905490771 1:38342037-38342059 CTTCTGGTCTGGGGAGAGGACGG + Intergenic
905547371 1:38810514-38810536 ATTTGGGTGGGCAGAGATGAGGG - Intergenic
905572329 1:39015605-39015627 CTTTGGGTCTGGACAGAGAGAGG + Intergenic
906683636 1:47748460-47748482 CTGGGAGGCTGGAGAGATGAGGG + Intergenic
907542091 1:55224973-55224995 GTTTGTGTCTTGAGAGATGGGGG - Intergenic
908998490 1:70188560-70188582 TTTTGTGTGTGTAGAGATGAGGG - Intronic
910928279 1:92418287-92418309 TGTTGGGCCTGCAGAGATGACGG + Intergenic
912394867 1:109334525-109334547 CTTGGGGTATGGGGAGATGAAGG + Intronic
914195473 1:145446077-145446099 CATGGGGACTGGAGAGCTGAAGG - Intergenic
915319280 1:155047402-155047424 CCTTGGGTGTGGAGAGATGGGGG + Intronic
916231373 1:162544468-162544490 ATTTGGGTATGGACAGCTGAGGG - Intergenic
916915731 1:169404529-169404551 CTTTGGTTCTGTTTAGATGATGG - Intronic
917761638 1:178166067-178166089 ATTTGGCTTTGGTGAGATGAGGG - Intronic
918666938 1:187163038-187163060 CTTTGTGTGAGGAAAGATGAGGG - Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
922540312 1:226414275-226414297 CTTTGTGTGTGGGGAGGTGAGGG + Intergenic
923247399 1:232145787-232145809 CTTTGGTTCAAGAAAGATGATGG + Intergenic
923280600 1:232439394-232439416 CTTTGGGTCTGGCGACCTGATGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063377774 10:5564257-5564279 CTTGTGGTTTGGAGAGATCATGG - Intergenic
1063424550 10:5941210-5941232 GATTGGGACGGGAGAGATGAAGG + Intronic
1063907496 10:10796189-10796211 ATTTGGGTGTGGAGAAATTAAGG - Intergenic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1064891470 10:20179343-20179365 CTTAGGCTCTGGAGATATAAGGG - Intronic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1068149591 10:53115148-53115170 CTTTGGTTCTGTTGATATGATGG - Intergenic
1069894960 10:71674830-71674852 CTTTAGGTCAGGGGAGATGGAGG + Intronic
1070797991 10:79228355-79228377 CCTTGAGTCTGAAGAGAAGAAGG + Intronic
1073574986 10:104615071-104615093 CTTTCTGTCTAGAGAGATGCTGG + Intergenic
1073591928 10:104765993-104766015 CTTTGGGGCTAGAGAGGTTAGGG + Intronic
1073988118 10:109232496-109232518 CTTTGGGACTGGAGAGTGGTAGG - Intergenic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1076581892 10:131517375-131517397 CTCTGGGGCTGGATGGATGAGGG + Intergenic
1076652814 10:132001589-132001611 ACTTGGGTGTGGAGAGATGAGGG - Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1076907474 10:133370517-133370539 CTTTGTGTCTGGGCAGATGTGGG - Intronic
1078748589 11:14138841-14138863 GTTTGGGTGTGGAGAGATCAAGG - Intronic
1079505278 11:21146374-21146396 CTTTAGGTCTGAAAGGATGAGGG + Intronic
1079712314 11:23701162-23701184 CTCGGGGTATGGAGAGATAAAGG - Intergenic
1080700503 11:34640210-34640232 CTTTGGAGCTGGAGAGATGCAGG - Intronic
1081253724 11:40867286-40867308 CTTTGGATTTAGAAAGATGAGGG + Intronic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1083245223 11:61421600-61421622 CTCTGGGTCCTAAGAGATGAGGG + Exonic
1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG + Intronic
1085311268 11:75518303-75518325 CTTCCTGCCTGGAGAGATGAGGG - Intronic
1085641800 11:78197362-78197384 GTGAGGGTCTGGAGAGGTGATGG + Intronic
1085816198 11:79739736-79739758 CTTTGGACATGGAGAGATGCAGG - Intergenic
1086969724 11:93067262-93067284 CTCTGTGTCTTCAGAGATGAGGG + Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088424705 11:109690754-109690776 GTCAGGTTCTGGAGAGATGAAGG + Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1089756323 11:120690155-120690177 TTTAGGGTCTGGAGTGACGAGGG - Intronic
1090272958 11:125400629-125400651 GTTTGGTTGTGCAGAGATGATGG - Intronic
1091852240 12:3708869-3708891 ATTTAGGTCTGGAGACTTGAAGG - Intronic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1095046309 12:37511006-37511028 CTCTAGGTCTGAAGGGATGAAGG - Intergenic
1096519041 12:52173877-52173899 CTGTCCCTCTGGAGAGATGATGG + Intronic
1097163480 12:57067772-57067794 ATTCAGGTCGGGAGAGATGATGG - Intronic
1098108432 12:67095641-67095663 GTATGTGTCTGGTGAGATGAAGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100158710 12:91832478-91832500 CTTAGGGTCTGAACAGATTATGG - Intergenic
1101701731 12:107180096-107180118 GTTTGGGTCTAGAGAGTTTAAGG - Intergenic
1101874827 12:108591307-108591329 CTTTGGGGCTGCTGAGGTGAAGG + Exonic
1102519281 12:113468757-113468779 ATTGAGGTCTGGAGAGAGGAGGG - Intronic
1103163008 12:118745895-118745917 CTCTTGGTCTGCAGAGATGTGGG + Intergenic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1103943766 12:124514943-124514965 CTTAGGGTCTGGAGAGATGGGGG - Intronic
1104469859 12:129020973-129020995 CTTTGGGGGTGAAGAGAGGAAGG - Intergenic
1104600613 12:130150883-130150905 ATTTGGGTCTGGGGAGCTGGGGG - Intergenic
1105728615 13:23189054-23189076 CCTAGGATGTGGAGAGATGACGG + Intronic
1106959383 13:34979881-34979903 TTTTGTGTCTGGTGAGATAAGGG + Intronic
1107463529 13:40628486-40628508 CTTTGGGACTGGGGAGGGGAAGG - Intronic
1107597916 13:41982607-41982629 CTTTAGTTATGGAGATATGACGG - Intergenic
1110160628 13:72373972-72373994 TTTTGTGTGTGGAGGGATGATGG + Intergenic
1110800205 13:79685239-79685261 ATTTGGGGCTTGAGAGATTAGGG + Intergenic
1111497479 13:89071027-89071049 CTTTGTCTCTAGAGACATGAAGG + Intergenic
1111863137 13:93733863-93733885 CTTAGGAACTGGTGAGATGATGG + Intronic
1112998598 13:105604539-105604561 CTTGGTGTCTGGAGAGGAGAGGG + Intergenic
1113125377 13:106972559-106972581 CATAGGGTGGGGAGAGATGAAGG - Intergenic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113574142 13:111382441-111382463 GGTGGGGTCTGCAGAGATGATGG + Intergenic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1114176751 14:20328552-20328574 TTTTAGGTTTGGAGAGATCAAGG - Intronic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1115179631 14:30608437-30608459 CGATGGGTCTGAAGAGAGGAAGG + Intronic
1115571465 14:34670667-34670689 CTTTAGGCCTGGAAGGATGATGG - Intergenic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1117574164 14:57081527-57081549 TTTTAAGTCTGCAGAGATGATGG + Intergenic
1117582948 14:57171313-57171335 CTTTGGGTCTGTGGAGAGGGTGG + Intergenic
1117903754 14:60563225-60563247 CTGTGGTTCTTGACAGATGAAGG - Intergenic
1118105327 14:62652726-62652748 TTTGGGGTGGGGAGAGATGAGGG - Intergenic
1119395905 14:74326351-74326373 TTTGGGGACTGGAGAGATGGGGG + Intronic
1119716905 14:76866217-76866239 CTCTGGGTCTAGATAAATGAGGG - Intronic
1121735452 14:96214679-96214701 CTTGGAGGCTGGAGAGATGAGGG - Intronic
1121791076 14:96700196-96700218 CCTTAGGTCTGGGGAGATGGGGG + Intergenic
1121817135 14:96937402-96937424 CTTTGGGAGTGGAGAGATAGGGG + Intergenic
1122437881 14:101711887-101711909 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437893 14:101711927-101711949 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437934 14:101712042-101712064 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437940 14:101712062-101712084 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437977 14:101712198-101712220 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437988 14:101712238-101712260 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437999 14:101712278-101712300 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438118 14:101712710-101712732 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438158 14:101712846-101712868 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122438298 14:101713362-101713384 CGGTGGGTCCGGAGAGATGACGG - Intergenic
1122438302 14:101713382-101713404 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438313 14:101713422-101713444 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1124058149 15:26261474-26261496 ATTTGGCTCTGGACACATGAAGG - Intergenic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1126663104 15:51051755-51051777 CTTTGGGTTGGGGGAGATGAGGG - Intergenic
1126787187 15:52186800-52186822 CCCTGGGGCTGGAGAGATAATGG + Intronic
1127968816 15:63943494-63943516 CTTTGGGGCCTGAGAGATAAAGG - Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1129391016 15:75220966-75220988 CCTTGGGGCGGGAGGGATGAGGG + Intergenic
1129906915 15:79194949-79194971 ATGTGAGTTTGGAGAGATGATGG - Intergenic
1130554491 15:84913290-84913312 CTTGGGGTCTGGAGACATGAGGG + Intronic
1130665092 15:85862894-85862916 CCTTGGTCCTGGAGAGGTGATGG + Intergenic
1132046602 15:98567983-98568005 CTTTGGGTCTGGAAAGAACTAGG - Intergenic
1132240718 15:100255322-100255344 CTTTGGGCCCTGAGAGAAGATGG - Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133895887 16:9928547-9928569 TTTGGGGTCTGGAGAGATGAGGG - Intronic
1133895920 16:9928761-9928783 CTTTGGGTCTCGACGGATGAGGG - Intronic
1134202291 16:12209213-12209235 TTTGGAGCCTGGAGAGATGATGG + Intronic
1134312572 16:13089081-13089103 CTTTGGTTCTGTTGATATGATGG + Intronic
1134798658 16:17064855-17064877 CTTGGGGGCTGGAGTGGTGAGGG - Intergenic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139568979 16:67798669-67798691 CCTTTGGTATGAAGAGATGAAGG - Intronic
1141627469 16:85268836-85268858 CTTTGAGTGTGGAGAGAGCACGG - Intergenic
1142492704 17:289069-289091 CTTTGGGGCAGGAGAGAGCAGGG + Intronic
1142598677 17:1042055-1042077 GCTTGGGTCTGGAGAGAAGGAGG + Intronic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1144151059 17:12446887-12446909 GTTGGTGTCTGGAGAGATGGTGG + Intergenic
1145746488 17:27323898-27323920 CCTTGGGTATGGACAGATCATGG + Intergenic
1145806177 17:27732899-27732921 CTTTCAGTCTGGGTAGATGAAGG - Intergenic
1146153881 17:30502681-30502703 CTTTCAGTCTGGGTAGATGAAGG - Intronic
1147258292 17:39195023-39195045 CTCTGGGGCTGGCAAGATGAGGG - Intronic
1148126052 17:45237531-45237553 CCTTGGTTCTGGAGAGAGAAGGG - Exonic
1148718837 17:49736006-49736028 CTCTGGGTGTTGAGAGTTGAGGG - Intronic
1151696354 17:75720102-75720124 CTTGGGGTGTGGAGAGGTCAAGG + Intergenic
1153748214 18:8202140-8202162 CTGTGAGTCTGAAGACATGAAGG - Intronic
1154961231 18:21310961-21310983 CTTTGGGTTTGGTGAGTAGAGGG + Intronic
1155456614 18:26022650-26022672 CTTAGAGTCTGGAGAGAAAAAGG + Intronic
1156208685 18:34914244-34914266 CTTTGGGGCTGGGGAGATGGTGG - Intergenic
1157532700 18:48435116-48435138 CCTGGGTTCTGGAGAGCTGAAGG - Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1162307570 19:9884557-9884579 CTATGGGACTGTAGAGATGCTGG + Intronic
1162740594 19:12771470-12771492 CTGCGGGACTGCAGAGATGAGGG + Exonic
1163325103 19:16598445-16598467 CTTGGGTTCTGGCGACATGATGG + Intronic
1163471162 19:17497683-17497705 CCTTGGGTCAGGAGAGTTGGAGG + Intronic
1165186302 19:34025370-34025392 CTTTGGGTTTGGAGATGGGAGGG - Intergenic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1166399578 19:42468426-42468448 TGTTGTATCTGGAGAGATGAGGG - Intergenic
925743731 2:7027957-7027979 ATGCGGGTCTGGTGAGATGAGGG + Intronic
925826126 2:7850024-7850046 ATGTGGGTCTGGGGAGACGAAGG + Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926523627 2:13949007-13949029 GATTGGGTGTAGAGAGATGATGG - Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
928433991 2:31241949-31241971 ACTGGGATCTGGAGAGATGAGGG + Intronic
928672772 2:33619411-33619433 GTCTGGATCTGGAGAGCTGATGG + Intergenic
929357891 2:41048700-41048722 CTTTGGGTATGTAGAAATAAAGG - Intergenic
929378089 2:41315472-41315494 ATTAGGGTCTGGATAGATGGAGG + Intergenic
930206079 2:48587702-48587724 CTGTGGGCCTGGTGATATGACGG - Intronic
931588146 2:63851529-63851551 CTTTGGGGATTGAGAGATCAGGG + Intronic
932293651 2:70606555-70606577 CTTTGAGTCTGGAGAAATGGAGG + Intergenic
934645512 2:96056888-96056910 CTTTGAGTCTGGACACACGAGGG + Intergenic
934838916 2:97612977-97612999 CTTTGAGTCTGGACACACGAGGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
934987509 2:98898593-98898615 CTGTGGGTCTGGGCAGACGAGGG - Intronic
936003101 2:108854226-108854248 CTTTAGGTCTAGAGAAATGTAGG + Intronic
937625339 2:124037022-124037044 CTGTGGGTCTAGACACATGAGGG - Intronic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
937983469 2:127628200-127628222 CTGTGGGTCTGGACAAATGAAGG - Intronic
938100457 2:128494497-128494519 CTATGGGTCTGCAGAGGTGCAGG + Intergenic
938783546 2:134606415-134606437 CTTTGATTGTGGCGAGATGAAGG - Intronic
938962777 2:136358035-136358057 TTTTGGAACTAGAGAGATGATGG - Intergenic
939103787 2:137926039-137926061 ATTTGGGTATGGAGATATTATGG - Intergenic
939352917 2:141063874-141063896 CTTTGGCCATGGAGAAATGAAGG + Intronic
939422258 2:141987585-141987607 CTTTGTGTCTGTAGAGCTTAGGG + Intronic
943284793 2:185983973-185983995 CTTTTGTTCTGGAGAGAGCAAGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944557901 2:200906170-200906192 CTTTGGGACTGGTGAAAGGAGGG - Intergenic
945397005 2:209331436-209331458 ATTTAGGTCTGGAGATAAGATGG - Intergenic
945732228 2:213553192-213553214 TTTTGTGTATGGACAGATGAAGG - Intronic
947164158 2:227244593-227244615 CTCTGTGTCTGATGAGATGATGG + Intronic
947751946 2:232537493-232537515 CTGTTGGTCTGGAGAGAGTAAGG - Intergenic
948285070 2:236777793-236777815 CTTTGGGGATGGCCAGATGACGG - Intergenic
1170315520 20:15036701-15036723 CTTTGGGTATAGAAAGATGATGG - Intronic
1171139493 20:22728807-22728829 CTAGGGCTCTGGAGAGATGGAGG + Intergenic
1172047411 20:32090290-32090312 CTCTGCTTCTGGACAGATGAAGG - Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1173844811 20:46181462-46181484 CTTTGTGGCTGGAGGAATGAGGG + Intronic
1174273640 20:49387467-49387489 ATATGAGTCTGGAGAGATGCTGG + Intronic
1175778792 20:61669224-61669246 CTGTGGGCCTGGAGAGTTAAAGG + Intronic
1175889451 20:62309877-62309899 TTTTGGGGCTGGAGAGAGGCTGG - Intronic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1178127502 21:29530888-29530910 GTTTGGATCTGGAGAGATGGAGG + Intronic
1179946256 21:44679088-44679110 CCTTGGGTCTGGAGGGGTAATGG + Intronic
1180588362 22:16914120-16914142 CTTTGAGTCTGCAGAGGAGAAGG - Intergenic
1181561613 22:23706293-23706315 CTTTGTGTCTGGTGAGAGGGAGG - Intergenic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183405927 22:37630543-37630565 CTTTGGTGATGGAGAGATCAGGG - Intronic
950070282 3:10146519-10146541 CTTTGGCTCTTCAGAGATGCAGG + Exonic
951853685 3:27170815-27170837 CTTTGTGTCTGGAGAAAGGGAGG - Intronic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
952828381 3:37542922-37542944 CTCTGGGTCTGCAGTGATGCTGG + Intronic
953160380 3:40414259-40414281 CTTTCCGTCTGGTCAGATGAGGG + Intronic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
954034836 3:47845898-47845920 CCTTCAGTCTGGAGAGATGGAGG - Intronic
954224919 3:49175172-49175194 CTATGGGGCTGGGGAGAGGAGGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954758517 3:52856810-52856832 CCTTGGGTCTGTAGACACGATGG + Intronic
954791109 3:53134146-53134168 ATTTGAGTTTGGAGAGATCAAGG + Intergenic
955651259 3:61196704-61196726 CTTTGAGTCTGGAGTGTTAATGG - Intronic
955772827 3:62403557-62403579 CTTTGGTGCCAGAGAGATGAGGG + Intronic
956541966 3:70349639-70349661 ATTTGGCTATAGAGAGATGAAGG + Intergenic
959032943 3:101323396-101323418 CTTGGGGGCTGGAGAAATCAGGG - Intergenic
959539437 3:107523347-107523369 CTTTGGGTCGGGAGAGGTCGGGG + Intronic
959920320 3:111861463-111861485 CTCTGGGTCTCAAGAGATGAAGG - Intronic
961259789 3:125593108-125593130 ATTTGGGTCTGGAGAGAGCCGGG - Intronic
962982654 3:140504778-140504800 CTCTGGCTCTGGAGAGAAGGTGG - Intronic
963298704 3:143575785-143575807 CTCTGGGTCTGCAGAGCTCAGGG + Intronic
963522062 3:146367469-146367491 GGTTGGGTATGGAGAGATAATGG - Intergenic
964712848 3:159689870-159689892 CTTTGGGTCTGTTTATATGATGG + Intronic
965903786 3:173677258-173677280 CTTTGGGTCTGGTGAGAGACAGG - Intronic
966137495 3:176715925-176715947 CTTTGAGTTTGAAGAGATTAAGG + Intergenic
967185744 3:186943120-186943142 ATTTGGGTGTGCACAGATGATGG + Intronic
967985763 3:195094449-195094471 CTTTGTGTCTGGACAGAACAAGG - Intronic
968542496 4:1175203-1175225 CTCTGGGTCTGAGGAGAGGAAGG + Intronic
968850725 4:3075574-3075596 GTTTGGAGCTGGAGAGATGTGGG + Intronic
969121476 4:4914547-4914569 CTTTGGGTCTGAAGAGATGAGGG + Intergenic
969421860 4:7102209-7102231 CTAGGCGTCTGGAGAGAGGAAGG - Intergenic
970783527 4:19768136-19768158 GTTTGGGTCTGGAGAATTTAGGG + Intergenic
972841515 4:42935437-42935459 ATTAGGGTCTGGACAAATGAGGG + Intronic
972917019 4:43893776-43893798 CTTTGGTTCTGTATATATGATGG + Intergenic
972926571 4:44015942-44015964 CTTTGGGTCTGGAGACAGGCTGG - Intergenic
976771183 4:88654156-88654178 CTTTGGTGCTGGGGATATGATGG + Intronic
979485236 4:121263094-121263116 CTTTTGCTCTGGAAAGATGCAGG + Intergenic
982956915 4:161781727-161781749 CTATGGATCTGGAGTGATAATGG - Intronic
984760580 4:183359567-183359589 CTTTTGGTCAGGAAAGATGAAGG + Intergenic
985685299 5:1278901-1278923 CTTGGGGTCTGGAGTGGTGGGGG - Intronic
985752514 5:1688962-1688984 CATTGGGTCTGGAGAGTGGTCGG + Intergenic
987165540 5:15194298-15194320 CTTTAGGCCTGAAGAGATGAAGG - Intergenic
992322604 5:75628723-75628745 ATTTGGGTGGGGAGAGATGGAGG + Intronic
992701504 5:79345820-79345842 ATTAGGGCCTGGTGAGATGAAGG + Intergenic
993821863 5:92629658-92629680 CTGAGAGTCTGGAGAGATTAAGG - Intergenic
995355984 5:111238208-111238230 CCTAGGCTCTGGAGAGATGAAGG - Intronic
995690040 5:114815440-114815462 CTTTGGTTCTGTTGATATGATGG + Intergenic
995942577 5:117601392-117601414 CTTTGAGAGTGGAGAGATAAGGG + Intergenic
1001375099 5:171248813-171248835 CTTTGGGTCTTGAGTGGTGCAGG - Intronic
1001575159 5:172758466-172758488 CTTTGGGTCTAGAAAGATAATGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002690460 5:181046259-181046281 GTTGGGGGCTGGAGAGATGGTGG - Intronic
1002690476 5:181046318-181046340 GTTGGGGGCTGGAGAGATGGTGG - Intronic
1002793866 6:455238-455260 CTTTGAGGCTGGACAGGTGAGGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1004231096 6:13834037-13834059 GTTTGGGTCTGGGGACTTGAGGG + Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1007379032 6:41474832-41474854 TTTTGGGTTTGGGGTGATGATGG - Intergenic
1007933622 6:45714217-45714239 CTTTGGTTCTTCAGAGATAACGG - Intergenic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1009192817 6:60650080-60650102 CTTTGGATCTGGTGAGACCATGG + Intergenic
1010281904 6:74031953-74031975 CTTTGGTTCTGGTGATGTGATGG + Intergenic
1013267736 6:108516370-108516392 CTTTGGTTCTGTAGATATGCTGG - Intronic
1013913269 6:115303699-115303721 TTTTGTGTGTGGAGAGATGGGGG + Intergenic
1014688604 6:124533513-124533535 CCTTGGGGCAGGGGAGATGACGG + Intronic
1015514332 6:134069656-134069678 CTTTGGGACTTTAGAGAAGAAGG + Intergenic
1016970977 6:149763563-149763585 CTTTGGCTCTACAGATATGAAGG - Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1019280043 7:194999-195021 CCTTGGGTGGGGAGAGAGGAAGG - Intronic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1019841574 7:3451295-3451317 CACTGAGTCTGGAGAGAGGAAGG + Intronic
1019844127 7:3479988-3480010 CTTTGGGCGTGGACAGGTGAGGG - Intronic
1019879048 7:3842249-3842271 CTTAAGGTCTGGGGAGAGGAAGG - Intronic
1021558070 7:21941913-21941935 CCTTGGGTTTGGAGAGTAGAGGG - Intronic
1022142844 7:27508181-27508203 TTTTGGGTTAGGAGAGAAGATGG - Intergenic
1022171797 7:27838607-27838629 CTTGGGTACTGGAGAGAAGAGGG - Intronic
1023371632 7:39517808-39517830 CTTTGGGTCTGGAGAGCCCCTGG - Intergenic
1023457851 7:40361112-40361134 GGTTGTGTCTGGAGAAATGAGGG + Intronic
1024038273 7:45527119-45527141 CCTTGGTTTTGGAGAGATGAAGG - Intergenic
1024141466 7:46466993-46467015 CTTTGGATCTGTAAGGATGATGG + Intergenic
1026215754 7:68347364-68347386 TTTTTGGTTTGTAGAGATGAGGG + Intergenic
1027592114 7:80130737-80130759 CTGTGGGACTGGAGAATTGATGG + Intergenic
1028821768 7:95219862-95219884 ATTTGGGGTTGGAGAGATGAGGG - Intronic
1030214709 7:107032492-107032514 CTTTGGGACATGAGAGATGTTGG + Intergenic
1030259132 7:107544044-107544066 CTTTGTGCCTGGAGCCATGAGGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031009395 7:116509770-116509792 CTTGGGTTCTGCAGGGATGACGG + Intergenic
1032459727 7:132101755-132101777 GGCTGGGGCTGGAGAGATGAAGG + Intergenic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1032996563 7:137453367-137453389 CTTTGGGGCTAGAGTGATAATGG - Intronic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1037659520 8:20914983-20915005 GTTTGTGTGTGGAGAGAGGAGGG - Intergenic
1037875539 8:22545472-22545494 CTTTGTGACTGCATAGATGAAGG - Intronic
1039184415 8:34900600-34900622 CTTTGTGTCTTCAGAGATAATGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040935392 8:52776945-52776967 CTTTGGGGCTTCAGAGATGCTGG - Intergenic
1041570058 8:59327752-59327774 TTTTGGGTGTGGAGAAATCATGG - Intergenic
1044132240 8:88538576-88538598 CTTTGAGTGAGAAGAGATGATGG - Intergenic
1044335475 8:90979269-90979291 AATTGGATCTGCAGAGATGAAGG + Intronic
1044684942 8:94817444-94817466 GTTTGGCTCTGAAGAGAAGAGGG - Intronic
1045286591 8:100796931-100796953 CTTTGGGGCTGGAGAGACCTCGG - Intergenic
1046537800 8:115538148-115538170 CTTTGGCTGTTGAGAGATTACGG - Intronic
1046893035 8:119443830-119443852 ATTTGTGTCTGGAGACAGGAAGG - Intergenic
1047220925 8:122917450-122917472 CATGGGGTGGGGAGAGATGAGGG - Intronic
1051298834 9:15626586-15626608 CTTTGGGTCTGTTTATATGATGG + Intronic
1051716675 9:19991938-19991960 CTTGGGGACTGGATGGATGAGGG + Intergenic
1058579078 9:106435396-106435418 AGCTGGGTCTGGAGAGATGGGGG - Intergenic
1059255036 9:112922154-112922176 CCTTGGATGTGGAGAGATGGAGG + Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061776756 9:132970779-132970801 CTCTGAGGCTGCAGAGATGAAGG - Intronic
1061972499 9:134052629-134052651 CTTGGGGTCTGGAGAGAGGTTGG - Intronic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1062699191 9:137890273-137890295 CATGGGGACTGGAGAGCTGAAGG + Intronic
1186182932 X:6990520-6990542 TTTTGGGGCAGGAGAGGTGAAGG - Intergenic
1186796943 X:13056268-13056290 GTTAGGGTCTGGAGAGAGAAGGG - Intergenic
1188882989 X:35513357-35513379 CCTTGGGTCAGGTGAGAGGAGGG - Intergenic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190325830 X:49206462-49206484 TCTGGGGTCTGGAGAGATGGGGG - Intronic
1191868830 X:65728236-65728258 CATTGAGTTTGGAGAGATGAAGG - Intronic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1193343421 X:80379220-80379242 CTTTGGTTCTGTATATATGATGG + Intronic
1195152328 X:102084697-102084719 CCTGGGGTGTGGGGAGATGAAGG - Intergenic
1196025052 X:111033325-111033347 GTTTGGATCTGTAGAGATGGAGG - Intronic
1196114812 X:111987505-111987527 GTTGGGGTGTGGGGAGATGAAGG - Intronic
1196815130 X:119659424-119659446 CTTTGGGTTTGGTGATATGAAGG - Intronic
1197086072 X:122477283-122477305 CTTTGTATCTGGAGTGCTGATGG - Intergenic
1198112031 X:133510248-133510270 CATTGGGCAAGGAGAGATGAGGG - Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic