ID: 1172866664

View in Genome Browser
Species Human (GRCh38)
Location 20:38105082-38105104
Sequence ATGCTGGTATAGATGGAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172866659_1172866664 -9 Left 1172866659 20:38105068-38105090 CCCAATAGAGTGTGATGCTGGTA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG 0: 1
1: 0
2: 0
3: 8
4: 76
1172866660_1172866664 -10 Left 1172866660 20:38105069-38105091 CCAATAGAGTGTGATGCTGGTAT 0: 1
1: 0
2: 1
3: 17
4: 255
Right 1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG 0: 1
1: 0
2: 0
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172866664 Original CRISPR ATGCTGGTATAGATGGAACG GGG Intronic
903342979 1:22666107-22666129 ACGCTGGTTTAGAAGGAACCTGG - Intergenic
907735691 1:57109474-57109496 AGTCTGGTATGGATGGAACTTGG + Intronic
909965803 1:81908662-81908684 TTGCTGGTAGAAATGGAAAGTGG - Intronic
910071123 1:83214465-83214487 ATGCTGCTATGGATGGAAATAGG + Intergenic
924328994 1:242923657-242923679 ATGCTGGAATAGAAGGAGAGAGG - Intergenic
924645133 1:245870497-245870519 ATGCAGGGATAGATGGAGCGAGG - Intronic
1069610823 10:69771419-69771441 ATGCTAGGAGAGATGGAAGGTGG - Intergenic
1071270843 10:84005935-84005957 GTGGTGGTATAAATGGAATGGGG + Intergenic
1077894432 11:6443180-6443202 ATTCTGGGATAGATGGATCCGGG - Intergenic
1079848100 11:25495742-25495764 ATGCAGATATAGATAGAACCAGG - Intergenic
1081366954 11:42247438-42247460 ATGGGGGTATAAATGGAACATGG - Intergenic
1087932806 11:103998209-103998231 ATTCTGGTATGGTTGGAAGGGGG - Intronic
1098348255 12:69528948-69528970 ATGCTGGTATAGCTTGAATGGGG + Intronic
1100280002 12:93109300-93109322 ACGTTGGTATACATGGAACATGG - Intergenic
1103835518 12:123816884-123816906 GTGCTGGTATGGATGTAAAGGGG - Intronic
1104658316 12:130590807-130590829 TTGCTGGTAAAAATGGAAGGTGG - Intronic
1106136325 13:26976265-26976287 CTGCTGGTACAGATGGAATGAGG - Intergenic
1113555910 13:111234350-111234372 ATGCTGGGGCAGATGGAAGGTGG - Intronic
1114036471 14:18634076-18634098 ATGATGGTATAGGTGGAGAGGGG - Intergenic
1114122164 14:19680961-19680983 ATGATGGTATAGGTGGAGAGGGG + Intergenic
1114422131 14:22593180-22593202 ATGCTGGCATGAATGGCACGAGG + Intergenic
1123009215 14:105339145-105339167 ATGCTGCCAAAGATGGAAAGTGG + Intronic
1130871736 15:87977483-87977505 ATGCTGGGATGGATGGAGCCTGG + Intronic
1133837592 16:9380604-9380626 ACACGGGTATAGATGGTACGAGG - Intergenic
1136228632 16:28874526-28874548 GTGCTGGAAGAGATTGAACGTGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139184034 16:64782805-64782827 TTGCTGGTGTAGATGCAAAGTGG - Intergenic
1141214928 16:82014294-82014316 ATGGTGAAATAGATGGAATGTGG - Intergenic
1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG + Intronic
1146905035 17:36612779-36612801 ATGGTGGTATGGATTGAAAGAGG + Intergenic
1149591175 17:57830985-57831007 AGGCTGGTATAGATGTCACTTGG - Intergenic
1155367231 18:25060820-25060842 ATGCTGGTATTGCTGGTATGGGG - Intergenic
1157333690 18:46721676-46721698 CTGCTGGTACAGATGGAATGAGG - Intronic
1158737383 18:60098710-60098732 AGGCTGACATAGTTGGAACGTGG - Intergenic
1158792256 18:60795474-60795496 AAGTTGGATTAGATGGAACGTGG - Intergenic
931693773 2:64857514-64857536 ATGCTGGTATGTGTGGAAGGGGG - Intergenic
938441447 2:131338117-131338139 ATGATGGTATAGGTGGAGAGGGG - Intronic
938449362 2:131402918-131402940 CTGCTGGTAAAGATGGGAGGTGG + Intergenic
947402772 2:229744935-229744957 ATGGTGGAAAAGATGGAAAGGGG + Intergenic
1172642492 20:36449154-36449176 ATGCTGGGAAAGATGGCACTGGG - Intronic
1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG + Intronic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1178098671 21:29242408-29242430 ATGCTGCCATACATGGAAAGAGG - Intronic
1180460597 22:15561133-15561155 ATGATGGTATAGGTGGAGAGGGG - Intergenic
1183470914 22:38006260-38006282 ACGCTGGTCTAGATGGAATTTGG + Intronic
1183473326 22:38021284-38021306 TTGCTGGTAGAGAGGGAACTTGG + Intronic
949894342 3:8758181-8758203 AGGCTGGGAAGGATGGAACGTGG - Intronic
951295958 3:20934824-20934846 ATGCTGGTATTGAAGAAACGTGG + Intergenic
962377044 3:134867058-134867080 ATGTTTGTATAGATGGGAGGGGG + Intronic
962991463 3:140581107-140581129 ATGCTGGGAGAGATGAAACGAGG + Intergenic
965741638 3:171881431-171881453 AGGCTGGTGTAGCTGGAGCGTGG + Intronic
967427878 3:189348296-189348318 AAGCTGGTATAGCTGCAATGTGG + Intergenic
974344903 4:60666879-60666901 AAGCTGCTATAGAAGGAAAGGGG - Intergenic
974529850 4:63093599-63093621 ATTCTGGTCTAGATGGAATATGG + Intergenic
974576771 4:63735272-63735294 ATGCCGGTATACTTAGAACGTGG - Intergenic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
978094389 4:104757981-104758003 ATGCTGGGATTGATAGAAAGAGG - Intergenic
978361398 4:107934005-107934027 ATGCTGCTATAAATAGAAGGGGG + Intronic
978474520 4:109110832-109110854 ATGGTGGTAGACATGGAAAGAGG - Intronic
980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG + Intergenic
988010717 5:25479278-25479300 ATGCTAGTGTAGATGGAATATGG + Intergenic
988050140 5:26017147-26017169 ATGTTGGTATACATGAAACATGG - Intergenic
1001289594 5:170447386-170447408 AGGCTGGAATGGAGGGAACGTGG - Intronic
1002582138 5:180215370-180215392 ATGCTGGTGTAGAGGGATCCAGG + Intergenic
1004115869 6:12767494-12767516 ATGCAGGTGTAGATGAAATGGGG + Intronic
1004535143 6:16493153-16493175 ATGAAGGTATGGATGGCACGGGG - Intronic
1008540550 6:52543048-52543070 ATGCTGGTATAGCTTGAACTTGG + Intronic
1021422451 7:20461101-20461123 ATCCTGGTACAGATGGATTGAGG - Intergenic
1027288837 7:76679324-76679346 ATGCTGCTATGGATGGAAATAGG + Intergenic
1027858457 7:83543669-83543691 AAGATGATATAGATGGAAAGAGG + Intronic
1029974055 7:104815988-104816010 GTGCTGGTCTATATGGAATGTGG - Intronic
1030265053 7:107611778-107611800 ATGCAGCTATAGAAGGAACATGG + Intronic
1031533031 7:122899362-122899384 TTGGTGCTATAGATGGAACAAGG + Intergenic
1034799006 7:154040530-154040552 AGGCTGGTAAATATGGAGCGAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041739790 8:61145980-61146002 ATGCTGGGATAGAAGGAAACTGG - Intronic
1043670093 8:82873757-82873779 ATTCTAGCATAGATGGAAGGAGG - Intergenic
1056201376 9:84280071-84280093 ATGCTGGGAAACATGGAAGGAGG + Exonic
1057975571 9:99602482-99602504 ATGGTGGGAAAGGTGGAACGGGG + Intergenic
1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG + Intergenic
1186235246 X:7500998-7501020 ATGATGGCAAAGATGGAACAAGG + Intergenic
1187211397 X:17235887-17235909 CTTCTGTTATAGATGGAATGGGG + Intergenic
1187575208 X:20546565-20546587 ATGCTGGCATGGATGTAAGGTGG + Intergenic
1194759493 X:97777492-97777514 ATGCAGGTATAGATTTAAGGAGG + Intergenic
1201226374 Y:11822759-11822781 ATGCTGGAATAGAAGGAGAGAGG - Intergenic