ID: 1172869432

View in Genome Browser
Species Human (GRCh38)
Location 20:38126606-38126628
Sequence CCGGCTATACAGCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172869432_1172869448 23 Left 1172869432 20:38126606-38126628 CCCTGCCCCTGCTGTATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1172869448 20:38126652-38126674 AGAGTTGGCAGCCCTTGTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1172869432_1172869446 21 Left 1172869432 20:38126606-38126628 CCCTGCCCCTGCTGTATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1172869446 20:38126650-38126672 CCAGAGTTGGCAGCCCTTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 139
1172869432_1172869447 22 Left 1172869432 20:38126606-38126628 CCCTGCCCCTGCTGTATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1172869447 20:38126651-38126673 CAGAGTTGGCAGCCCTTGTTGGG 0: 1
1: 0
2: 1
3: 11
4: 125
1172869432_1172869443 8 Left 1172869432 20:38126606-38126628 CCCTGCCCCTGCTGTATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1172869443 20:38126637-38126659 TCAGGCCTGGAAGCCAGAGTTGG 0: 1
1: 0
2: 1
3: 46
4: 423
1172869432_1172869441 -5 Left 1172869432 20:38126606-38126628 CCCTGCCCCTGCTGTATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1172869441 20:38126624-38126646 GCCGGGAGGCTGTTCAGGCCTGG No data
1172869432_1172869440 -10 Left 1172869432 20:38126606-38126628 CCCTGCCCCTGCTGTATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 120
Right 1172869440 20:38126619-38126641 GTATAGCCGGGAGGCTGTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172869432 Original CRISPR CCGGCTATACAGCAGGGGCA GGG (reversed) Intronic
900308942 1:2024302-2024324 CGGGGTAGACAGCAGGGCCATGG - Intronic
900419023 1:2547587-2547609 CGGGCTTTCCAGCAGGGGCCAGG - Intergenic
903742903 1:25568610-25568632 GTGGCTACAGAGCAGGGGCAAGG - Exonic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
916061760 1:161103572-161103594 CCAGCTACTCAGCAGAGGCAGGG + Intronic
916511353 1:165474804-165474826 CAGGCTGTAAAGCAGGGTCAAGG + Intergenic
917012666 1:170491605-170491627 CAGGCTAAACTGCAGTGGCATGG - Intergenic
921032705 1:211347642-211347664 CTGGCTGTTCAGCAGGAGCAAGG + Intronic
921134349 1:212246821-212246843 CTGGGTATACACCAGGGGCCTGG + Intergenic
923828603 1:237527961-237527983 CAGCCTATACAGCATGGGCCAGG - Intronic
1063210905 10:3880410-3880432 CCTGCTTTATGGCAGGGGCAAGG + Intergenic
1063598572 10:7459955-7459977 CCTGCCATTCAGCAGGGCCACGG + Intergenic
1066080575 10:31927981-31928003 ACGTCCATCCAGCAGGGGCAGGG + Intronic
1066252601 10:33649068-33649090 GTGGATATACAGCAGGGGGATGG + Intergenic
1067764086 10:49072220-49072242 CCAGCTCTACAGCAGGCACAGGG - Intronic
1070864913 10:79702495-79702517 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1070878702 10:79840627-79840649 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071631807 10:87224716-87224738 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071645261 10:87356937-87356959 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1077220875 11:1415644-1415666 CCAGCTATCCAGCAGGGACCAGG - Intronic
1078472940 11:11606223-11606245 CCAGGTATACAGTAGGGGCTAGG - Intronic
1082727307 11:56751537-56751559 CCGGGAATAAAGCAGGGGCTTGG + Intergenic
1083142057 11:60730040-60730062 CCAGCTATCTATCAGGGGCATGG + Intronic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1089755312 11:120681843-120681865 CCCCCTTGACAGCAGGGGCAGGG + Intronic
1091803838 12:3342233-3342255 CCAGCTAGACAGCAGGGGGCAGG + Intergenic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1101208466 12:102512766-102512788 CCTTCTAAACAGAAGGGGCAAGG + Intergenic
1104918202 12:132277398-132277420 CCGGCTATGCAACAAGGACAGGG - Intronic
1108151467 13:47540115-47540137 GCGACTATAGTGCAGGGGCAGGG + Intergenic
1109769526 13:66952781-66952803 ACACCTAGACAGCAGGGGCACGG + Intronic
1110100319 13:71592448-71592470 CAGGCTAGAGAGCAGTGGCACGG - Intronic
1120030771 14:79638145-79638167 CAGGCTAGAAAGGAGGGGCATGG - Intronic
1122152385 14:99732039-99732061 TGGGCTCAACAGCAGGGGCAAGG - Intergenic
1122207408 14:100154890-100154912 CCAGCTAGTCAGGAGGGGCAGGG - Intronic
1202930563 14_KI270725v1_random:29770-29792 CCAGTGATACAGCAGGGCCACGG - Intergenic
1127916906 15:63462125-63462147 CAGGCAATCAAGCAGGGGCAAGG + Intergenic
1128406333 15:67343620-67343642 CTGATTATACAACAGGGGCATGG + Intronic
1128778423 15:70341695-70341717 CCCTCCATGCAGCAGGGGCATGG - Intergenic
1129832617 15:78680664-78680686 CCCGCTTTCCAGCAGGTGCAAGG - Intronic
1131937298 15:97520923-97520945 GCGGATATACAGTAGGGTCAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132632124 16:923221-923243 ATGGCAAAACAGCAGGGGCAAGG + Intronic
1133216227 16:4294137-4294159 CCAGCTGTACGGCAGGGCCATGG - Intergenic
1135354942 16:21761184-21761206 CAGGCTAGAGAGCAGTGGCATGG - Intergenic
1135453426 16:22577326-22577348 CAGGCTAGAGAGCAGTGGCATGG - Intergenic
1135808494 16:25566117-25566139 CCTGCCATACAGCAGGGGCTTGG - Intergenic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1142291953 16:89197258-89197280 CCGGCCACACAGCAGGGTCCAGG - Intronic
1142984902 17:3689747-3689769 CCCACTTTACAGCAGGGGAAGGG + Intronic
1143595330 17:7910552-7910574 CCGGCTGGCCAGCAAGGGCACGG + Exonic
1144729348 17:17517764-17517786 CAGGCTGGGCAGCAGGGGCAGGG - Intronic
1145828769 17:27898042-27898064 CCGGGTATACTGCAGTGGTAAGG + Intergenic
1146468975 17:33109425-33109447 ACGGGTTTAAAGCAGGGGCAGGG - Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1154415748 18:14174387-14174409 CCAGCTCCACAGCACGGGCAGGG + Intergenic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
1160732405 19:647204-647226 CCGGCTTTTCAGAAGGGGCCAGG + Intergenic
1162110014 19:8394974-8394996 AAGGCTGTACAGCTGGGGCAAGG + Intronic
1162290118 19:9773014-9773036 CAGGCTAGAGTGCAGGGGCATGG - Intronic
1164823592 19:31268114-31268136 CAGGCAAGACAGCATGGGCAGGG - Intergenic
932499155 2:72166768-72166790 CAGCCTATACTGAAGGGGCAGGG - Intergenic
937469975 2:122166327-122166349 CGGGATAGAGAGCAGGGGCAGGG - Intergenic
945408923 2:209486336-209486358 CCAGCTACTCAGCTGGGGCAGGG - Intronic
947395604 2:229683860-229683882 GGGGCTGTACAGCAGGGACAAGG + Intronic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1173307329 20:41862906-41862928 CTGGATTTATAGCAGGGGCAGGG - Intergenic
1175245454 20:57579404-57579426 CCGTCTCCACAGCAGGGGCTGGG + Intergenic
1176366488 21:6036040-6036062 CAGGCTGGACAGCAAGGGCAGGG - Intergenic
1176592575 21:8658371-8658393 CCAGTGATACAGCAGGGCCAGGG - Intergenic
1179757029 21:43502505-43502527 CAGGCTGGACAGCAAGGGCAGGG + Intergenic
1180275430 22:10635513-10635535 CCAGTGATACAGCAGGGCCAGGG - Intergenic
1180695979 22:17751855-17751877 CCGGCTCCACAGCAGAGGAAGGG + Intronic
1184595209 22:45509695-45509717 CCAGCTACTCAGGAGGGGCAGGG + Intronic
1185388287 22:50546558-50546580 CCGGCGCTGCAGCAGGGACAGGG - Intergenic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
960139724 3:114140351-114140373 CAGGATATAAAGCAGGGACAAGG - Intronic
964612265 3:158627193-158627215 CTGGTTCTACAGTAGGGGCAGGG + Intergenic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
967135421 3:186508937-186508959 CTGGCTAGACAGCAGGAGCCAGG + Intergenic
968575126 4:1362446-1362468 CCTGTGATAAAGCAGGGGCATGG - Intronic
968615440 4:1575610-1575632 GCGGCTGTCCAGCAGGGGGAGGG + Intergenic
968737705 4:2305933-2305955 CTGGCTATGCAGCAGGAGCTGGG + Intronic
968982631 4:3858696-3858718 CCTGGTATACAGCAGGCGCCAGG - Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
974833998 4:67224716-67224738 CCTCCTATACATCAGGGACATGG + Intergenic
977332013 4:95648329-95648351 CAGGCTATACAGCTGGGAAATGG - Intergenic
980054881 4:128069632-128069654 GCTGCTAGACAGAAGGGGCACGG + Intronic
982088621 4:151861455-151861477 CCGGAAATACACCAGGGCCACGG - Intergenic
993363110 5:87002379-87002401 CCTGAAATACAGTAGGGGCATGG - Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996666368 5:126064844-126064866 CCCGATATTTAGCAGGGGCAGGG - Intergenic
997262601 5:132476166-132476188 AGGGCTCTACTGCAGGGGCAGGG + Intergenic
997340840 5:133143470-133143492 CAGGCTATAGGGCAGGGCCAGGG - Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1004751839 6:18569543-18569565 CAGGCTGTACTGCAGTGGCACGG - Intergenic
1007363635 6:41375139-41375161 CCGTCTACACAGCAGGGTCTAGG - Intergenic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1019290920 7:249820-249842 CAGGCTGTGCAGCAGGGGCCTGG - Intronic
1019334464 7:476440-476462 CCGGCTGTCCTGCAGGGGCCTGG + Intergenic
1023822214 7:43986562-43986584 CCGGTCAAACAGTAGGGGCAGGG - Intergenic
1023924823 7:44660167-44660189 CAGGCTATAGTGCAGTGGCATGG + Intronic
1024709179 7:51996053-51996075 CTGGCTGTACTGCAGGGGGAGGG + Intergenic
1029750480 7:102539976-102539998 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1029768432 7:102639084-102639106 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1032391215 7:131556523-131556545 CCGGCTCTGCTGCAGCGGCAGGG - Exonic
1034222425 7:149456839-149456861 CAGCCTCTACAGCAGGGGCCGGG - Intronic
1035071476 7:156148223-156148245 ACGGTGATACGGCAGGGGCAGGG - Intergenic
1035773059 8:2165026-2165048 CCGGCTAAACATCAAGGGAAGGG - Intronic
1036531947 8:9598654-9598676 CAGGCTAGACTGCAGTGGCATGG - Intronic
1049431369 8:142566830-142566852 CAGGCTCTTCAGCAGGGCCAAGG - Intergenic
1061208645 9:129178272-129178294 CCGGCTAAATAGCTGGGGCCGGG - Intergenic
1062219967 9:135409844-135409866 CAGCCTAAACAGCCGGGGCAGGG - Intergenic
1203622629 Un_KI270749v1:137199-137221 CCAGTGATACAGCAGGGCCACGG - Intergenic
1186285316 X:8037617-8037639 CAGGTTCTACTGCAGGGGCAAGG - Intergenic
1187227316 X:17386038-17386060 CCAGCAATACAGTTGGGGCAGGG - Intronic
1198740194 X:139834084-139834106 CTGGCTCTACAGAAGAGGCACGG + Intronic
1199350377 X:146793964-146793986 CAGGCAAAAGAGCAGGGGCAGGG - Intergenic