ID: 1172869569

View in Genome Browser
Species Human (GRCh38)
Location 20:38127339-38127361
Sequence GTTCCTTGGACGCTACAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172869569 Original CRISPR GTTCCTTGGACGCTACAACC TGG (reversed) Intronic
900730624 1:4256816-4256838 GTTCCTTGGTGGCAAGAACCAGG + Intergenic
906567010 1:46807905-46807927 GTTCCCTGGAAGATACAACATGG + Intronic
911203790 1:95072797-95072819 GTTCCATGGACGTTACGCCCCGG - Exonic
919240886 1:194914579-194914601 GTTCCCTGGACACTGCAACAGGG + Intergenic
922979775 1:229815944-229815966 GTTCCTTGAAAGTTACACCCTGG - Intergenic
1085401436 11:76238203-76238225 GTTCCTTGGACACTCCAGACAGG + Intergenic
1089804010 11:121066353-121066375 ATTCCTTGGAAGCTAGAACATGG - Intronic
1109763439 13:66861329-66861351 GTTCCTTAGACACTGCAATCAGG - Intronic
1114419475 14:22569088-22569110 GTTACTTGGATGCTAAAACATGG - Intronic
1125679856 15:41523785-41523807 GTTCCTGGGAGCCTACTACCAGG - Exonic
1125769565 15:42156167-42156189 GCTCCGTGGACTCTACAGCCAGG + Intronic
1132647982 16:1007826-1007848 GTTCCTGGGATGCTCCCACCTGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1146932924 17:36790977-36790999 GGTCCTTGGTCTCTACAGCCTGG + Intergenic
1148333432 17:46825648-46825670 GTTCCTTGCAGGCCAAAACCTGG - Intronic
1161021873 19:2014732-2014754 GTTCCTGGGACCCTCCAACTCGG - Intronic
1163798200 19:19349206-19349228 CTTCCAGGGACGCTACAACGAGG + Exonic
1165355893 19:35303823-35303845 GTGACTTGGCTGCTACAACCTGG - Intronic
1167674072 19:50873838-50873860 GTTCCTTGGACCCTATCACTGGG + Intronic
934560368 2:95310155-95310177 GTTCCTTTCACTCTACACCCTGG - Intronic
1171311895 20:24151242-24151264 TTGCCATGGACCCTACAACCAGG - Intergenic
1172869569 20:38127339-38127361 GTTCCTTGGACGCTACAACCTGG - Intronic
950499735 3:13356013-13356035 GGTCCTTGGGCTCTACAATCAGG - Intronic
959379725 3:105627473-105627495 ATTCCTTGGAGACTACAACTGGG + Intergenic
964631811 3:158818643-158818665 ATTCCTTGGTCGATACAGCCTGG + Intronic
964835223 3:160930632-160930654 GTTCCTTTGAGGCTTCAGCCTGG - Intronic
974310630 4:60205244-60205266 TTTCCTTGGACACTCCAACCTGG - Intergenic
980706408 4:136502005-136502027 GTTCCTTTGACCCAACAACGTGG + Intergenic
1005981974 6:30843633-30843655 GTTCCTTAAACCCTAAAACCAGG - Intergenic
1007180831 6:39927951-39927973 GGTCCTTGGAGAGTACAACCTGG + Intronic
1007410857 6:41660434-41660456 CTACCTTGGACTCTACTACCCGG + Intergenic
1027561137 7:79731947-79731969 TTTTCTTGGACCCTAAAACCAGG + Intergenic
1029432562 7:100540392-100540414 GTTTCCTGGATGCTACCACCAGG - Intronic
1040879625 8:52191135-52191157 GTTGCTTGGGCCATACAACCTGG + Intronic
1041469834 8:58196511-58196533 GTTAATTGGACGCATCAACCTGG + Intronic
1051747793 9:20311469-20311491 GTTCCTTGGACCCTAGAAAGAGG + Intergenic
1059684387 9:116620583-116620605 GTTCCTTGCACTCTACTATCAGG + Intronic
1195741830 X:108072691-108072713 CTTCCTTGAACGCTACAAAGGGG - Exonic