ID: 1172870926

View in Genome Browser
Species Human (GRCh38)
Location 20:38135113-38135135
Sequence CTGAGAGCATTGTTCCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172870926_1172870934 5 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870934 20:38135141-38135163 CGATGGTGACTTAGAGGTGAGGG No data
1172870926_1172870937 26 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870937 20:38135162-38135184 GGCTGACTCCACAGAGGCCTGGG No data
1172870926_1172870930 -1 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870930 20:38135135-38135157 GGGTCCCGATGGTGACTTAGAGG No data
1172870926_1172870938 29 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870938 20:38135165-38135187 TGACTCCACAGAGGCCTGGGAGG No data
1172870926_1172870935 20 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870935 20:38135156-38135178 GGTGAGGGCTGACTCCACAGAGG No data
1172870926_1172870936 25 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870936 20:38135161-38135183 GGGCTGACTCCACAGAGGCCTGG No data
1172870926_1172870933 4 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870933 20:38135140-38135162 CCGATGGTGACTTAGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172870926 Original CRISPR CTGAGAGCATTGTTCCGCAC TGG (reversed) Intronic