ID: 1172870930

View in Genome Browser
Species Human (GRCh38)
Location 20:38135135-38135157
Sequence GGGTCCCGATGGTGACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172870926_1172870930 -1 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1172870930 20:38135135-38135157 GGGTCCCGATGGTGACTTAGAGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172870930 Original CRISPR GGGTCCCGATGGTGACTTAG AGG Intronic
900523378 1:3116792-3116814 TGGCCCCGCTGGTGACTTGGTGG + Intronic
902515164 1:16986160-16986182 GGGTCCAGTTGGTGGCTCAGAGG + Exonic
1075188296 10:120282935-120282957 GGGTCCCTATGGTGCCTCTGTGG + Intergenic
1078470158 11:11580149-11580171 AGGTCACAATGGTGAGTTAGTGG - Intronic
1089257049 11:117199560-117199582 GGGCCCCCATGCTGACTGAGAGG - Intronic
1106403496 13:29452826-29452848 TTGTCCCCAGGGTGACTTAGGGG - Intronic
1125250325 15:37694565-37694587 AGGACCCCATGGTGACTCAGTGG - Intergenic
1126618442 15:50611739-50611761 GGGATCCTATGGTTACTTAGTGG - Intronic
1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG + Intergenic
1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG + Intergenic
1146257938 17:31402382-31402404 GGGACCAGATGGTGACTTTCGGG + Intronic
1155387279 18:25292331-25292353 TGGTACAGATGGTGACTGAGAGG - Intronic
1160767268 19:814128-814150 GGGTCCCGAAGGGGTCTTAGGGG - Intronic
1161324292 19:3656021-3656043 GGGGCCCAAGGGTGACTCAGAGG - Intronic
935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG + Intronic
947109121 2:226699553-226699575 GGGTCCAGTTGTTGTCTTAGTGG + Intergenic
948656458 2:239479579-239479601 GGGACCCTGTGGTGACTGAGAGG - Intergenic
1172870930 20:38135135-38135157 GGGTCCCGATGGTGACTTAGAGG + Intronic
1182516492 22:30861955-30861977 GGTGCAGGATGGTGACTTAGTGG - Intronic
1183077321 22:35435361-35435383 GGGCCTCGATGGGGACTTGGTGG + Intergenic
949905266 3:8853487-8853509 GGGGCCCCATGGTGATCTAGAGG - Intronic
956149371 3:66224972-66224994 GGGTTCCCATGGTGGCTTTGTGG + Intronic
968830880 4:2932553-2932575 GGGTCCTGGTGGTGACTTCTGGG - Intronic
969439739 4:7210002-7210024 GGGAGCAGATGGTGACTTGGGGG + Intronic
972154503 4:36142530-36142552 GAGTCCCTCTGGTGACTTGGGGG - Intronic
986539586 5:8829489-8829511 GGGTCAGGAGGGTGACTCAGAGG + Intergenic
998407739 5:141883409-141883431 GGGTCCCGATGGAGATCTGGTGG - Intergenic
999959406 5:156737865-156737887 GGGTCCCCATCGCGAGTTAGTGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1011747452 6:90419888-90419910 GGGTCCCCATGGGGAATGAGAGG - Intergenic
1018225235 6:161622108-161622130 GGGTCCTCATGGTGAGTGAGAGG + Intronic
1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG + Intronic
1029599661 7:101556243-101556265 TTGTCCCTATGGTGACATAGGGG + Intronic
1031229915 7:119093049-119093071 GGGTCCTGATGCAGAATTAGAGG + Intergenic
1038022432 8:23561711-23561733 GGGTCTAGATGGTCACTTAGTGG + Intronic
1061213436 9:129206527-129206549 GGGACCTGAGGGTGACTGAGAGG - Intergenic