ID: 1172870930

View in Genome Browser
Species Human (GRCh38)
Location 20:38135135-38135157
Sequence GGGTCCCGATGGTGACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172870926_1172870930 -1 Left 1172870926 20:38135113-38135135 CCAGTGCGGAACAATGCTCTCAG No data
Right 1172870930 20:38135135-38135157 GGGTCCCGATGGTGACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172870930 Original CRISPR GGGTCCCGATGGTGACTTAG AGG Intronic