ID: 1172871793

View in Genome Browser
Species Human (GRCh38)
Location 20:38140425-38140447
Sequence TAGTGCCTTGGGGGGATCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172871793_1172871803 13 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871803 20:38140461-38140483 GGGGTCTATGAACCCTATGATGG No data
1172871793_1172871799 -8 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871799 20:38140440-38140462 AGGCACTACCAACAGAATTCAGG 0: 1
1: 0
2: 1
3: 7
4: 121
1172871793_1172871801 -6 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871801 20:38140442-38140464 GCACTACCAACAGAATTCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 113
1172871793_1172871800 -7 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871800 20:38140441-38140463 GGCACTACCAACAGAATTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 106
1172871793_1172871806 23 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871806 20:38140471-38140493 AACCCTATGATGGGGAAAAAAGG 0: 1
1: 0
2: 1
3: 20
4: 370
1172871793_1172871804 14 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871804 20:38140462-38140484 GGGTCTATGAACCCTATGATGGG 0: 1
1: 0
2: 0
3: 3
4: 38
1172871793_1172871807 24 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871807 20:38140472-38140494 ACCCTATGATGGGGAAAAAAGGG 0: 1
1: 0
2: 0
3: 28
4: 264
1172871793_1172871805 15 Left 1172871793 20:38140425-38140447 CCACGGATCCCCCCAAGGCACTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1172871805 20:38140463-38140485 GGTCTATGAACCCTATGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172871793 Original CRISPR TAGTGCCTTGGGGGGATCCG TGG (reversed) Intronic
904856357 1:33500970-33500992 CAGTGCTTTGGGGGGATTCGTGG + Intergenic
909990325 1:82215671-82215693 TGGTGCCATGGCAGGATCCGAGG + Intergenic
914267444 1:146050020-146050042 TAGTGCGGTGGGGGGCACCGCGG + Intergenic
914519696 1:148404605-148404627 TAGTGCGGTGGGGGGCACCGCGG - Intergenic
914644203 1:149638674-149638696 TAGTGCGGTGGGGGGCACCGCGG - Intergenic
922796958 1:228344997-228345019 TGGTGCCTTGGGGTGGTCCAGGG - Intronic
1069430714 10:68332045-68332067 TACTGGCTTGGGGGGATGGGAGG - Intronic
1072808719 10:98443662-98443684 TAGTGCCTGGTGTGGATCGGAGG + Intronic
1074878822 10:117635481-117635503 TTGTGCTTTGGGGGGACACGTGG + Intergenic
1075003971 10:118817527-118817549 TAGTGCTTTGGGGAGGCCCGGGG - Intergenic
1076468867 10:130704621-130704643 TAGTGCCCTGGGGTGATACAGGG - Intergenic
1078565236 11:12408800-12408822 TAGTGGCTTGGTGGGAAGCGGGG + Intronic
1081183210 11:40010338-40010360 TAGTGCCTTGTAGGGAGCCCTGG - Intergenic
1089667357 11:120029074-120029096 TAGGGCCTCTGGTGGATCCGCGG + Intergenic
1091324109 11:134671255-134671277 TAGTGCCTTGAGGGGCTCAGCGG + Intergenic
1091985950 12:4910374-4910396 CAGTGCCCTGGCGGGAGCCGCGG - Exonic
1097356633 12:58609445-58609467 TACTGCTTTTGGGGGATCCTTGG + Intronic
1100191820 12:92200911-92200933 CAGAGCCTTGGGGGAATCCCTGG + Intergenic
1102218718 12:111180008-111180030 TAGTGCCATGGCATGATCCGGGG - Intronic
1105614344 13:21998784-21998806 TAGTGACTTTGTGGGATCCTGGG - Intergenic
1107988399 13:45796072-45796094 TATTGACTTGGTGGGACCCGAGG + Intronic
1108316610 13:49243006-49243028 TACTGCCTTGGGGGCATGCATGG + Intergenic
1115992928 14:39168290-39168312 AAGTGGTTTGGGGGGATCGGGGG + Intronic
1125725809 15:41867606-41867628 CAGTGCCTTGGGGAGCTCGGTGG - Exonic
1126097237 15:45098184-45098206 AAGTTCCTTGGAGGGATCCCTGG - Intronic
1129824337 15:78624934-78624956 GAATGCCTTGGAGGGATCCCAGG - Exonic
1137713783 16:50585336-50585358 TAGGGCCTTGGTGGGAGCAGAGG + Intronic
1141628070 16:85271922-85271944 GAGTGCCTTCGGGGGCTACGTGG + Intergenic
1143651122 17:8264817-8264839 GAGTGCCTTGGGGGCATGTGCGG + Intronic
1147796278 17:43045682-43045704 TAGTGGCTGTGGGGGATCTGGGG + Exonic
1161072127 19:2267829-2267851 GAGTCTCTTGGGGGGGTCCGTGG + Intronic
1161212618 19:3075445-3075467 GAGTCTCTTGGGGGGGTCCGTGG + Intergenic
1161946539 19:7440710-7440732 TAGTGCCCTCGAGGGATCCTTGG + Intronic
1162637957 19:11985154-11985176 GAGTTCCTTGGGGGCTTCCGGGG + Intergenic
1165097812 19:33419277-33419299 CAGTGCCTTGTGGGGCTCCCTGG - Intronic
1168270740 19:55248456-55248478 TAGTGACTTGGGGGTAGCAGTGG - Intronic
930873929 2:56193000-56193022 GAGTGCTTTGGGGCGATCTGGGG - Exonic
936250864 2:110867154-110867176 TAAGGCCCTGTGGGGATCCGGGG + Intronic
944539620 2:200743211-200743233 TATTGCCTTGGCTGGAGCCGGGG - Intergenic
945076570 2:206045858-206045880 TGGTCCCTTGGGGGGCTACGTGG - Intronic
1169121700 20:3100511-3100533 TAGTGCCTTGAGAGGATCTCAGG + Intergenic
1172871793 20:38140425-38140447 TAGTGCCTTGGGGGGATCCGTGG - Intronic
1175809844 20:61852123-61852145 TGGTGGGGTGGGGGGATCCGTGG - Intronic
1178531748 21:33381842-33381864 TCCAGCCTTGGGGGGATCCTGGG + Intergenic
1180042834 21:45288604-45288626 TGGAGACCTGGGGGGATCCGGGG + Intergenic
1180147253 21:45928397-45928419 TAGTACCCTGGGAGGATCGGGGG - Intronic
1184864383 22:47194179-47194201 CAGGGCCTTGGGGGAATCTGGGG + Intergenic
951953173 3:28224420-28224442 TAATGCCTTGTGGGGATAGGAGG - Intergenic
973787533 4:54347444-54347466 TGGTGACTTGGGGGGAACAGTGG + Intergenic
992866311 5:80960475-80960497 TGGGGGCTTGGGGGGCTCCGGGG + Intergenic
998770090 5:145533246-145533268 TAATGACTTGGGGAGATCTGGGG + Intronic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1005905894 6:30261198-30261220 ATGTGCCTTTGGGGGATCTGAGG - Intergenic
1019019179 6:168903051-168903073 AAGTGCCCTGGGGGTTTCCGTGG - Intergenic
1019193759 6:170269107-170269129 TAATGCCTTGGGGACATCAGAGG + Intergenic
1021903828 7:25313914-25313936 TAGAGCCTTGAGGGGAAACGTGG + Intergenic
1033595569 7:142855816-142855838 CAGTGCCTTGTGGGGAGCAGGGG - Intronic
1035585110 8:766865-766887 TAGTTCCTTGGGTGGATGGGCGG + Intergenic
1044995467 8:97834067-97834089 TAGTGCTTTGGGAGGATCACTGG + Intronic
1050938647 9:11430015-11430037 TGGTCCCATGGGGGGATCCTGGG + Intergenic
1053387523 9:37706203-37706225 CAGGGCCTGGGGGGGATCCTTGG + Intronic
1060410246 9:123395332-123395354 CAGATCCTTGGGGGGATCCTGGG + Intronic
1187379511 X:18787512-18787534 TAGTGCCTTAGGGAGAGCTGGGG + Intronic
1188572156 X:31600766-31600788 TAATGCCTTGGGAGGAGCAGTGG - Intronic