ID: 1172872312

View in Genome Browser
Species Human (GRCh38)
Location 20:38143441-38143463
Sequence GGTATGCAGGGCCCTCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172872312_1172872317 -1 Left 1172872312 20:38143441-38143463 CCGGAGGGAGGGCCCTGCATACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1172872317 20:38143463-38143485 CTGCCAACGCCCTGTTTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 106
1172872312_1172872320 5 Left 1172872312 20:38143441-38143463 CCGGAGGGAGGGCCCTGCATACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1172872320 20:38143469-38143491 ACGCCCTGTTTGCTGGGAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
1172872312_1172872319 4 Left 1172872312 20:38143441-38143463 CCGGAGGGAGGGCCCTGCATACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1172872319 20:38143468-38143490 AACGCCCTGTTTGCTGGGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 107
1172872312_1172872321 6 Left 1172872312 20:38143441-38143463 CCGGAGGGAGGGCCCTGCATACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1172872321 20:38143470-38143492 CGCCCTGTTTGCTGGGAAAGGGG 0: 1
1: 0
2: 2
3: 9
4: 122
1172872312_1172872324 25 Left 1172872312 20:38143441-38143463 CCGGAGGGAGGGCCCTGCATACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1172872324 20:38143489-38143511 GGGGCTGATGTTGCAATGACAGG 0: 1
1: 0
2: 2
3: 24
4: 442
1172872312_1172872316 -2 Left 1172872312 20:38143441-38143463 CCGGAGGGAGGGCCCTGCATACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1172872316 20:38143462-38143484 CCTGCCAACGCCCTGTTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172872312 Original CRISPR GGTATGCAGGGCCCTCCCTC CGG (reversed) Intronic
900688441 1:3964701-3964723 GGTGTGCATGGCCCTCCACCTGG - Intergenic
901143454 1:7050399-7050421 GGGGTGCAGGGCCCACACTCTGG + Intronic
901167103 1:7228966-7228988 TGTGTGCAGAGCCCTCCCCCTGG - Intronic
901847437 1:11992463-11992485 GGTAAGCAGGGCCGGCGCTCTGG + Intronic
901855046 1:12039167-12039189 GGTGGGCAGGACCCTCCCTGGGG + Intergenic
901918626 1:12519782-12519804 GCTAAGCAGGTCCCTGCCTCAGG - Intergenic
903161956 1:21495416-21495438 GGGATGCAGTGCCCACACTCTGG + Intergenic
904581019 1:31544432-31544454 CGTGTCCAGGGCCCTGCCTCTGG + Intergenic
910294291 1:85628895-85628917 GCTGTGCAGGGCCCTCTCTCCGG + Intergenic
911275242 1:95852552-95852574 GGAATGCAGGTCACTGCCTCAGG - Intergenic
915313187 1:155014774-155014796 GGTATTCAAGGCCCTGCGTCCGG - Exonic
915599607 1:156913971-156913993 GAGATGAAAGGCCCTCCCTCAGG + Exonic
920295218 1:204951960-204951982 GGGCTGCAGGGACCTCCCTGGGG - Intronic
920647496 1:207814237-207814259 GATATGCTGGCCCCTCTCTCAGG + Intergenic
1062860127 10:804428-804450 GGTCTACAGGGTCCTCCCTGAGG - Intergenic
1063499777 10:6543070-6543092 GGAGGGCAGGGCCCACCCTCAGG - Intronic
1064094845 10:12416668-12416690 GCTAGTCAGAGCCCTCCCTCCGG - Intronic
1066044026 10:31580728-31580750 TGGATGCTGGGGCCTCCCTCGGG - Intergenic
1069556121 10:69399625-69399647 GGTAGGGAGTGGCCTCCCTCTGG + Intronic
1071113912 10:82194682-82194704 GGTAGGCAGAGTCCTCCCACCGG - Intronic
1071976457 10:90960821-90960843 GGGATGTAGCTCCCTCCCTCTGG + Intergenic
1072733772 10:97865733-97865755 GGTCTGCAAGGCCCTCACTCCGG - Exonic
1073449178 10:103599458-103599480 AGGCTGCAGGGCCCTCCCCCTGG + Exonic
1075729916 10:124630007-124630029 GCTCTGCAGGGCCCTTCCCCTGG + Intronic
1076159796 10:128234926-128234948 GGAATGCAGGGCTCTCCCTGGGG + Intergenic
1076732698 10:132446446-132446468 GGTACCCAGGGCCCACCCTGAGG - Intronic
1076789452 10:132768943-132768965 GGTGGGCAGGACCCTCCCGCGGG + Intronic
1076815390 10:132912068-132912090 GGTCTGCAGGGCTCTGTCTCAGG + Intronic
1077049299 11:559565-559587 GGGATGCTGGGGCCTCCCTCAGG - Intronic
1077508924 11:2945314-2945336 GGTCTACAGGGCCCTCCCACAGG + Exonic
1079373827 11:19874014-19874036 GGTTTGCACAGCCCTCCCTTTGG + Intronic
1079388379 11:20000447-20000469 GGTACCCCGGGCCCTCCCCCAGG - Intronic
1084716644 11:70878509-70878531 GGAACCCAGGGACCTCCCTCGGG + Intronic
1089121398 11:116138188-116138210 GGTATGCAGAGCCTTCCTCCTGG - Intergenic
1089960645 11:122614491-122614513 GGTGTGCATGTCCCTGCCTCAGG - Intergenic
1090255704 11:125282479-125282501 AGATTGCTGGGCCCTCCCTCTGG + Intronic
1091316981 11:134621367-134621389 GGCATGCAGTGCCCGCCCTCAGG - Intergenic
1091841908 12:3627575-3627597 GGCATGCACGGCCTTCCCTCTGG + Intronic
1092241055 12:6836907-6836929 GGGCTGCAAGACCCTCCCTCCGG - Intronic
1098387308 12:69933235-69933257 AGAATGCAGGGCCCTTTCTCAGG + Intronic
1098977617 12:76919791-76919813 GGCATGCACGGCAGTCCCTCTGG - Intergenic
1100992767 12:100267696-100267718 GGCATGGGGGGCTCTCCCTCCGG - Exonic
1101989125 12:109469974-109469996 GGGATGCATGGCCCTCTCTAGGG - Intronic
1102474344 12:113179161-113179183 GGTCTGCAGGGCCAGCTCTCGGG + Exonic
1102907488 12:116688017-116688039 GGGAAGGAGCGCCCTCCCTCTGG + Intergenic
1103896836 12:124278632-124278654 GATGTGCGGGGCCCTCCCTTTGG - Intronic
1104726982 12:131084293-131084315 AGGAAGCAAGGCCCTCCCTCTGG - Intronic
1107093285 13:36507691-36507713 GGTCTGCAGGGTTCTCCCTAAGG - Intergenic
1112780004 13:102890006-102890028 GGTAGGCTGGGCCCTTCCTGTGG + Intergenic
1113424392 13:110195987-110196009 GGGCTGTGGGGCCCTCCCTCGGG + Intronic
1113940406 13:114015887-114015909 GGTGTGCAGGGCAGACCCTCCGG + Intronic
1122693488 14:103542234-103542256 GGTATCCAGTGCCCTCCATGGGG + Intergenic
1122775327 14:104114440-104114462 GGGATGTAGGGCCCTACCACAGG + Exonic
1122986225 14:105212846-105212868 GCCAGGCAGGGCCCTGCCTCAGG - Intronic
1123055350 14:105566751-105566773 GTTATCCAGGGCCCTGCCTCAGG + Intergenic
1123079801 14:105686595-105686617 GTTATCCAGGGCCCTGCCTCAGG + Intergenic
1125205711 15:37151674-37151696 ATGATGCAGGGTCCTCCCTCAGG - Intergenic
1128385922 15:67148289-67148311 GGTGTGTGTGGCCCTCCCTCTGG - Intronic
1129299278 15:74616065-74616087 GGTCTGCAGTGACCGCCCTCCGG - Intronic
1129389272 15:75212550-75212572 AGTGTGCTGGGCCCACCCTCTGG + Intergenic
1129670998 15:77607638-77607660 GGAGTACAGGGCCCTCCCCCGGG - Intergenic
1129884905 15:79031141-79031163 AGTGCCCAGGGCCCTCCCTCGGG + Intronic
1132625786 16:890890-890912 GACATCCAGGGCCATCCCTCTGG + Intronic
1133632704 16:7636903-7636925 CTTATGAAGGGCCCACCCTCAGG + Intronic
1133843165 16:9428649-9428671 GTTAGGCAGTGCCCTTCCTCCGG + Intergenic
1136682873 16:31978115-31978137 GGTATGAAGGCCCCACACTCTGG - Intergenic
1136783511 16:32921681-32921703 GGTATGAAGGCCCCACACTCTGG - Intergenic
1136886278 16:33932168-33932190 GGTATGAAGGCCCCACACTCTGG + Intergenic
1137728601 16:50673589-50673611 GCGCTGCAGGGCCCTCTCTCCGG + Exonic
1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG + Intronic
1141134833 16:81458408-81458430 GGTAAGCAGGGCACCCTCTCTGG + Intronic
1141608918 16:85170395-85170417 GGCATGAAAGGGCCTCCCTCTGG + Intergenic
1203086160 16_KI270728v1_random:1185665-1185687 GGTATGAAGGCCCCACACTCTGG - Intergenic
1143118542 17:4593762-4593784 GCTATGGCGGGCCCTCCCTGGGG + Intronic
1144709645 17:17393090-17393112 CGTAGGCAGGGCCCTGCCTTTGG + Intergenic
1145007387 17:19345239-19345261 GGTAGGCAGGGCCCGACCACCGG + Intronic
1146418873 17:32663746-32663768 GGTATTCTAAGCCCTCCCTCTGG + Intronic
1147036743 17:37687246-37687268 GGTAAGCAGGGACCTCTCGCAGG + Exonic
1150106257 17:62464711-62464733 AGTATCCAGGGCCCTCCATGTGG - Intronic
1151472850 17:74328505-74328527 GGTATGCAGGGCTCTGCAGCAGG + Exonic
1152007544 17:77691913-77691935 GGTGTGCAGGGCTCTCCCCGGGG + Intergenic
1154050659 18:10953759-10953781 GGTGTGCAGTGTCCTCCCGCAGG - Intronic
1154274685 18:12948478-12948500 GGTACGCCGGGCCCTCTCCCAGG + Intronic
1160816386 19:1037846-1037868 GATATTCAGGGACCTCCCCCGGG - Exonic
1161703508 19:5807023-5807045 GGGATGGAGGGCTCTACCTCAGG + Intergenic
1162059746 19:8087302-8087324 GGTCTGCAGGGAACTCACTCAGG - Intronic
1162397192 19:10424086-10424108 GGTGGGCAGTGCCCTCTCTCTGG - Intronic
1162662454 19:12181154-12181176 GGTCTCCTGGGTCCTCCCTCCGG - Intronic
1162921479 19:13905892-13905914 GGTCTACAGCGCCCACCCTCAGG - Intronic
1162966709 19:14159635-14159657 GGCATGCAGAGCCCACCCCCAGG - Intronic
1163322810 19:16584494-16584516 GGGGTGCTGGCCCCTCCCTCAGG - Intronic
1163534489 19:17869333-17869355 TGTGTGCAGGGCCCTCCGGCAGG - Intergenic
1165230393 19:34383028-34383050 GGGATGCAGTGCCGGCCCTCAGG + Intronic
1165561876 19:36687344-36687366 GGTGTGCAGGGCCGTAGCTCGGG - Intergenic
1166375560 19:42325169-42325191 GTTATACAGGCCCCTGCCTCCGG - Intergenic
1166906942 19:46117954-46117976 AGCATGCAGTGTCCTCCCTCAGG + Intergenic
1167249189 19:48391599-48391621 GGGATCCAGGCCCCGCCCTCGGG - Intergenic
1167483626 19:49747485-49747507 GGAAGGCAGGGCCCTCGCCCTGG - Intronic
1167717831 19:51155268-51155290 GCTAGGCAGTGCCCACCCTCAGG - Intergenic
1167766075 19:51483353-51483375 GCTAGGCAGTGCCCACCCTCAGG + Intronic
925282890 2:2697031-2697053 GGTGTGCAGTGCCCTGCCTCTGG - Intergenic
927194260 2:20537042-20537064 GGGATGCAGAGCCCTCCCTTTGG - Intergenic
927467361 2:23347541-23347563 GGTGTGCAGGCCACACCCTCAGG + Intergenic
929841308 2:45466846-45466868 AGTCTCCTGGGCCCTCCCTCAGG - Intronic
930256364 2:49097574-49097596 GCAATGCACAGCCCTCCCTCAGG - Intronic
930297224 2:49569985-49570007 GGTATGTAGACCTCTCCCTCAGG - Intergenic
930738811 2:54808161-54808183 GGAAGGCAGGGCCCTCTCTGTGG + Intronic
936075851 2:109401444-109401466 AGGAAGAAGGGCCCTCCCTCTGG - Intronic
936500407 2:113062087-113062109 GGCATCCAGGGCCCTGCATCTGG + Intronic
936521457 2:113214414-113214436 GGTCTGCAGTCCCCTTCCTCTGG + Intergenic
937295877 2:120809688-120809710 GGGAAGCAGGGTCCTCCCTGAGG - Intronic
943658446 2:190533644-190533666 GCTGGGCATGGCCCTCCCTCCGG - Intronic
948835441 2:240624025-240624047 GCTCTGCAGGGCCCTGGCTCTGG + Intronic
1171056331 20:21910456-21910478 GGAAGGCAGTGCCCTCACTCAGG - Intergenic
1172872312 20:38143441-38143463 GGTATGCAGGGCCCTCCCTCCGG - Intronic
1174467897 20:50731541-50731563 GGGAAGCAGCTCCCTCCCTCCGG - Exonic
1175569610 20:60008945-60008967 GGGCTGCAGGGCCCTTCCCCAGG + Intronic
1177454878 21:21324505-21324527 GTTATGCACCCCCCTCCCTCTGG + Intronic
1179226184 21:39455472-39455494 GCTATGCACACCCCTCCCTCTGG + Intronic
1179991985 21:44953040-44953062 GGTCCCCAGGGCCCTGCCTCTGG + Intronic
1180973751 22:19832644-19832666 TGTGTGCAGGGCCATCCCTGGGG - Intronic
1181534639 22:23535047-23535069 CGCTTGCAGGGCCGTCCCTCTGG + Intergenic
1181600884 22:23951318-23951340 GCTGAGCAGGGTCCTCCCTCTGG - Intergenic
1181607629 22:23990008-23990030 GCTGAGCAGGGTCCTCCCTCTGG + Intergenic
1182061599 22:27402365-27402387 GGCAGGAAGGTCCCTCCCTCAGG + Intergenic
1183740271 22:39665064-39665086 GGTCTGCAGACCCCTCCCCCGGG - Intronic
1184522521 22:45003543-45003565 GGTGGGCAGGGCCATCCCTGTGG + Intronic
1185393374 22:50574419-50574441 GCCATGCTGGGCCTTCCCTCAGG - Exonic
951490946 3:23270089-23270111 GCTAGGCAGGTCCCTGCCTCTGG + Intronic
958674631 3:97252257-97252279 GGTTCCCAGGGCCCTGCCTCAGG + Intronic
962867295 3:139458300-139458322 CGCCTGCAGGGCCCTTCCTCTGG + Intronic
962957322 3:140278271-140278293 GGTATGCATGGTCCTCACACAGG + Intronic
962976954 3:140454294-140454316 GGTATCCATGGCTCTCACTCAGG + Intronic
964274338 3:154992823-154992845 GGTATTAAGAGCCCTCACTCAGG + Intergenic
968573268 4:1353503-1353525 GGGATGCAGGGGCCTCCCCTGGG + Intronic
968938608 4:3626349-3626371 GGTCAGCAGGGCCCGCCCACTGG - Intergenic
969843708 4:9902581-9902603 TGTCTGCAGGGCCCTGCCTCTGG + Intronic
980467140 4:133201414-133201436 GTTGTGCAGGGCCTTCCCCCAGG - Intronic
984556987 4:181226060-181226082 GTTTTCCAAGGCCCTCCCTCTGG - Intergenic
985661891 5:1161493-1161515 TGTGGGCTGGGCCCTCCCTCTGG + Intergenic
985856840 5:2434994-2435016 GGCATGCAGTCACCTCCCTCAGG + Intergenic
986228906 5:5843529-5843551 GGTATGAAGGCCCAACCCTCTGG - Intergenic
992622783 5:78610242-78610264 GGAATGCAGGGTCCTCATTCAGG + Intronic
994422102 5:99534702-99534724 GGTATGGACGGCCCTCCCATTGG - Intergenic
994460742 5:100065882-100065904 GGTATGGACGGCCCTCCCATTGG + Intergenic
994484890 5:100379308-100379330 GGTATGGACGGCCCTCCCATTGG + Intergenic
997582996 5:135028807-135028829 GGCCTGCAGGGCCCGGCCTCGGG - Exonic
1000410502 5:160932026-160932048 GGGATGCATGGGCCTCCCACTGG + Intergenic
1000411360 5:160937420-160937442 TGTATGCGGTGCCCTACCTCTGG + Intergenic
1000953539 5:167514691-167514713 GGTAGGCAATGCCCTCCCTCTGG - Intronic
1003908032 6:10720323-10720345 GCTGTGCGGGGCCCTCCCTGGGG - Intergenic
1005225897 6:23641478-23641500 GGTATGCAGGGGCCATGCTCTGG - Intergenic
1006949872 6:37812906-37812928 GAAAGGCAGGGCCCTCCCTAGGG - Intergenic
1007658816 6:43469584-43469606 GGTATGCAGGGCCTGCGCTTTGG - Intergenic
1018930889 6:168239623-168239645 GCTCTTCAGGGCCCTGCCTCAGG - Intergenic
1021241050 7:18201532-18201554 CATCTGCAGGGCCCACCCTCAGG + Intronic
1021603834 7:22391350-22391372 GCTATGCAGGGCACTCCCTGGGG + Intergenic
1021785973 7:24152907-24152929 GGTGTGCAGGGACCTTCCTGGGG + Intergenic
1021970443 7:25960622-25960644 TGTCTGCAGGGCCCTCCCTCTGG + Intergenic
1025928809 7:65979560-65979582 GGTTTGCTGGGCCCTTGCTCTGG + Intronic
1034278647 7:149836527-149836549 GGTATCGAGGGCCCTTCCTAGGG - Intergenic
1034974177 7:155438386-155438408 GGCATTCTGGACCCTCCCTCAGG + Intergenic
1035070294 7:156139796-156139818 GGAAAGCAGAGGCCTCCCTCTGG - Intergenic
1035745730 8:1961085-1961107 GGAATGCAGGTACCTGCCTCAGG + Intergenic
1037273673 8:17156346-17156368 GGGATGCGGGGCCCTCGCTCGGG - Exonic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1045684780 8:104701254-104701276 TGTATGCAGGGCCTTGCCTAGGG + Intronic
1045694157 8:104789027-104789049 GGACTGCAGGGCGTTCCCTCTGG - Intronic
1047033753 8:120912735-120912757 GGTATGCAATGTCCTCCTTCTGG + Intergenic
1048200915 8:132373231-132373253 GGTCTCCAGGGCTCTCTCTCTGG - Intronic
1049022979 8:139970517-139970539 TGTATGAAGGGGCCTCTCTCTGG - Intronic
1049373546 8:142278806-142278828 CTTCTGCAGGCCCCTCCCTCTGG - Intronic
1049780742 8:144427734-144427756 GCTAGGCAGGACCCTCCCACGGG - Intronic
1053144631 9:35704174-35704196 ACTAAGCTGGGCCCTCCCTCAGG - Exonic
1061245784 9:129400792-129400814 CGCTTGCAGGGCCGTCCCTCTGG - Intergenic
1061993758 9:134173828-134173850 GGAATGCTGGGCTCTTCCTCTGG - Intergenic
1062451397 9:136617208-136617230 AGTGGGCAAGGCCCTCCCTCAGG - Intergenic
1062460992 9:136662519-136662541 AGGATGCTGGGCCCTCCCCCAGG - Intronic
1185536217 X:863451-863473 GGCATGGAGGGCCCTTTCTCGGG - Intergenic
1187440472 X:19313444-19313466 GTTATGCAGGGCCTTCTCTGGGG - Intergenic
1192758094 X:74066863-74066885 GGTAAGCAGGGCTCTGCCTGAGG - Intergenic
1192886213 X:75337329-75337351 GGAATGCAAGGCCTTCCATCTGG + Intergenic
1195179324 X:102341169-102341191 CCAATGCAGAGCCCTCCCTCTGG - Intergenic
1197550318 X:127885152-127885174 GGTTTGCTGAGCCCTGCCTCTGG + Intergenic