ID: 1172873491

View in Genome Browser
Species Human (GRCh38)
Location 20:38150066-38150088
Sequence ACCAGGAGGTTGAGGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 968
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 915}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172873477_1172873491 8 Left 1172873477 20:38150035-38150057 CCCACCCCAGGAGGCCAATACCT 0: 1
1: 0
2: 2
3: 17
4: 165
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873478_1172873491 7 Left 1172873478 20:38150036-38150058 CCACCCCAGGAGGCCAATACCTC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873482_1172873491 -6 Left 1172873482 20:38150049-38150071 CCAATACCTCCTAACACACCAGG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873473_1172873491 21 Left 1172873473 20:38150022-38150044 CCTCAGGGTGAACCCCACCCCAG 0: 1
1: 0
2: 1
3: 52
4: 308
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873481_1172873491 2 Left 1172873481 20:38150041-38150063 CCAGGAGGCCAATACCTCCTAAC 0: 1
1: 0
2: 2
3: 7
4: 80
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873479_1172873491 4 Left 1172873479 20:38150039-38150061 CCCCAGGAGGCCAATACCTCCTA 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873480_1172873491 3 Left 1172873480 20:38150040-38150062 CCCAGGAGGCCAATACCTCCTAA 0: 1
1: 0
2: 2
3: 13
4: 93
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915
1172873476_1172873491 9 Left 1172873476 20:38150034-38150056 CCCCACCCCAGGAGGCCAATACC 0: 1
1: 0
2: 2
3: 18
4: 241
Right 1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG 0: 1
1: 0
2: 2
3: 50
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172873491 Original CRISPR ACCAGGAGGTTGAGGGGCCA GGG Intronic
900179923 1:1306558-1306580 ACCAGGAGGCTCAGGAGCCTTGG - Intronic
900296714 1:1955608-1955630 TCCAGGGGGCTGAGGGGCCCAGG - Intronic
900375785 1:2354032-2354054 CCCAGCACTTTGAGGGGCCAAGG + Intronic
900616916 1:3569596-3569618 TCCAGGAGACTGGGGGGCCACGG + Intronic
900717673 1:4155780-4155802 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
900754462 1:4424183-4424205 ACCAGGAGCTGGAGAGGCCTGGG + Intergenic
901114605 1:6832325-6832347 CCCAGCACTTTGAGGGGCCAAGG - Intronic
901194433 1:7432578-7432600 GCCAGGATGCTGAGGGGCCAGGG + Intronic
901650172 1:10738544-10738566 ACAAGGAGGCTGCAGGGCCATGG + Intronic
901952108 1:12757634-12757656 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
902066960 1:13696440-13696462 CCCAGCACGTTGGGGGGCCAAGG - Intergenic
902629624 1:17696944-17696966 AGGAGGAGGCTGAGGGGCCCCGG + Exonic
902643080 1:17779181-17779203 TCCAGGAGGGAGAGGGTCCATGG - Intronic
902705514 1:18201543-18201565 ACCAGGAGGCTGAGTTGACATGG - Intronic
902907451 1:19568933-19568955 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
903058623 1:20654194-20654216 GCCAGGAGGCTTAGGGGCCGGGG - Intronic
903061841 1:20674177-20674199 CCCAGGACTTTGAGGGGCCGAGG - Intronic
903086295 1:20862661-20862683 TCCAGCACGTTGAGAGGCCAAGG - Intronic
904156610 1:28488537-28488559 CCCAGCAGTTTGGGGGGCCAAGG + Intronic
904470101 1:30730686-30730708 ACAAGGAGATTGAAGGGCCATGG - Intergenic
904727367 1:32559713-32559735 CCCAGGACTTTGAGAGGCCAAGG - Intronic
904854253 1:33484868-33484890 ACCAGCACTTTGAGAGGCCAAGG - Intronic
904914390 1:33959601-33959623 AGCAGGAGGGAGAGGGGGCAGGG - Intronic
905589253 1:39147714-39147736 CCCAGCACTTTGAGGGGCCAAGG - Intronic
905773755 1:40654931-40654953 ACCAGGAGGATGGAGGGCCTGGG - Intronic
905980919 1:42226359-42226381 ACCAGCACTTTGAGAGGCCAAGG + Intronic
905987541 1:42300523-42300545 CCCAGTATGTTGAGAGGCCAAGG + Intronic
906310279 1:44749044-44749066 CCCAGCACTTTGAGGGGCCAAGG + Intronic
906616287 1:47235033-47235055 ACCTGGAGGCTGAGGGGACATGG + Intergenic
906682454 1:47738685-47738707 AACATAAGGTGGAGGGGCCAAGG + Intergenic
906874392 1:49521057-49521079 CCCAGCACTTTGAGGGGCCAAGG - Intronic
906948037 1:50312319-50312341 TACGGGAGGTTTAGGGGCCAAGG - Intergenic
906983387 1:50656079-50656101 CCCAGGACGTTGGGAGGCCAAGG + Intronic
907134277 1:52124441-52124463 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
907319866 1:53595442-53595464 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
907422638 1:54357504-54357526 AGCAGGAGGATGAGGTGGCAAGG - Intronic
908244998 1:62220811-62220833 ACCCGGAGGTGGAGGTGGCAGGG + Intergenic
908688505 1:66751885-66751907 ACCATGAGTTTCAGGGGCCTTGG + Intergenic
909126363 1:71675915-71675937 ACCAGCACTTTGAGAGGCCAAGG - Intronic
909578242 1:77201507-77201529 CCCAGTAGTTTGAGAGGCCAAGG + Intronic
909959733 1:81825093-81825115 ACCAGCAGTTTGGGAGGCCAAGG + Intronic
910584684 1:88866276-88866298 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
910646348 1:89519397-89519419 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
911509651 1:98795661-98795683 AGATGGGGGTTGAGGGGCCAAGG + Intergenic
911854005 1:102854123-102854145 ACCAGGCGGTCGAGGGGACCGGG - Intergenic
912005196 1:104890718-104890740 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
912149198 1:106836296-106836318 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
912652360 1:111450470-111450492 GCCAGTAAGTGGAGGGGCCAGGG - Intronic
913304888 1:117417968-117417990 CCCAGGAGGTTGAGGCTACAGGG + Intronic
915222972 1:154389856-154389878 CCCAGGACTTTGGGGGGCCAAGG + Intergenic
915342494 1:155184231-155184253 GCCAAGAGGTTTGGGGGCCAGGG - Exonic
915435711 1:155904152-155904174 ACCAGTACTTTGCGGGGCCAAGG - Intronic
916274609 1:162980154-162980176 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
916322366 1:163519475-163519497 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
917371176 1:174295767-174295789 CCCAGGACTTTGAGAGGCCAAGG - Intronic
917485833 1:175453821-175453843 ACCAGCACTTTGAGAGGCCAAGG - Intronic
917999504 1:180478875-180478897 ACCAGCACTTTGAGAGGCCAAGG + Intronic
918086279 1:181247889-181247911 AACAGGAGGGTGAGGGGCTGTGG - Intergenic
918194354 1:182207618-182207640 AACAGGAGGGTGCGGGGGCAAGG - Intergenic
918603492 1:186392750-186392772 CCCAGCACTTTGAGGGGCCAAGG + Intronic
918754861 1:188326987-188327009 GCCAGCAGTTTGAGAGGCCAAGG + Intergenic
919687401 1:200497002-200497024 CCCAGGACCTTGAGAGGCCAAGG - Intergenic
919930765 1:202220128-202220150 CCCAGCACGTTGAGAGGCCAAGG - Intronic
920445441 1:206012641-206012663 ACCTGGATGCTGAGGGGACAGGG + Exonic
920649139 1:207823759-207823781 AGCAAGAGGTTGTGGGGCGACGG - Intergenic
921211305 1:212901361-212901383 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
921407597 1:214798473-214798495 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
921685402 1:218083537-218083559 ACCAGCAGTTTGGGAGGCCAAGG + Intergenic
922506817 1:226131232-226131254 ACCAGGAGTTTGGGAGGTCATGG + Intergenic
922534342 1:226368792-226368814 ACCTGGAGGTTGAGGTGGCCAGG + Intronic
922775646 1:228213205-228213227 AGCAGGAGGCAGAGGGGCTAAGG - Intronic
923102084 1:230824722-230824744 TCCAGGCGGTGGACGGGCCAGGG + Intergenic
923134023 1:231101842-231101864 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
923426318 1:233873253-233873275 ACCAGGAGGTGGAGGTTGCAGGG + Intergenic
923589194 1:235303471-235303493 TCCAGCACTTTGAGGGGCCAAGG + Intronic
923736040 1:236608717-236608739 CCCAGCAGGTTGAGAGGCCAAGG + Intergenic
924086766 1:240460339-240460361 ACCAGCACTTTGAGAGGCCAAGG + Intronic
924534654 1:244924600-244924622 CCCAGGAGTTTGAGGCTCCAGGG - Intergenic
924813347 1:247422301-247422323 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1062907926 10:1191248-1191270 TCCAGGAGGGTGGGGGGCCAGGG + Intronic
1062925154 10:1310739-1310761 GACAGGAGATTGAGGCGCCAGGG - Intronic
1062947502 10:1472603-1472625 ACCAGGAGGCTGCTGGGCCATGG - Intronic
1063610605 10:7558645-7558667 TCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1064196207 10:13245814-13245836 CCCAGGAGGTTGAGGCAACAGGG + Intergenic
1065213446 10:23426725-23426747 ACCAGAAATTTGAGGGGCCAAGG - Intergenic
1065797545 10:29321127-29321149 CCCAGGATGTTGAGGGGACAGGG - Intergenic
1066113668 10:32220405-32220427 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1066578485 10:36852765-36852787 ACCAGGAGCTGGAGGAGACAAGG + Intergenic
1066617674 10:37312078-37312100 CCCAGTAGTTTGGGGGGCCAAGG - Intronic
1067280920 10:44872138-44872160 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1067356888 10:45537400-45537422 ACCAGCACTTTGGGGGGCCAAGG + Intronic
1068088780 10:52407493-52407515 CCCAGGAGGCTGAGGTGCGAGGG - Intergenic
1068920772 10:62481475-62481497 CCCAGTAGTTTGAGAGGCCAAGG - Intronic
1068964089 10:62894497-62894519 CCCAGGAGATAGAGTGGCCAAGG - Intronic
1069262155 10:66412347-66412369 GCCACAAGGTTGAGAGGCCAAGG + Intronic
1069444198 10:68457920-68457942 CCCAGCAGGTTGGGAGGCCAAGG + Intronic
1069535889 10:69252737-69252759 CCCAGGAGATTGAGGTTCCAGGG + Intronic
1069548760 10:69347682-69347704 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1069704690 10:70451058-70451080 CCCAAGAGGCTGGGGGGCCATGG - Intergenic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1069815551 10:71191591-71191613 GCCAGGAGGGTGAGGGGCAGGGG + Intergenic
1069841686 10:71343695-71343717 ACCAGCACTTTGCGGGGCCAAGG + Intronic
1069842894 10:71351059-71351081 AGCAGGAGGTTTGGGGGCAAAGG - Intronic
1069929319 10:71871900-71871922 CCCAGGAGGTTGAGGCTACAGGG + Intergenic
1070011447 10:72478883-72478905 CCCAGGACTTTGAGAGGCCAAGG - Intronic
1071178194 10:82952180-82952202 CCCAGCACGTTGAGGGGCCGAGG + Intronic
1071539433 10:86466949-86466971 ACCAGCATTTTGAGAGGCCAAGG - Intronic
1072171645 10:92868888-92868910 CCCAGGAGGTTGAGGCTACAAGG - Intronic
1072229234 10:93399621-93399643 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1072339188 10:94429984-94430006 ACCAGCACTTTGAGAGGCCAAGG - Intronic
1072650264 10:97289776-97289798 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1072652514 10:97306689-97306711 CCCAGGACTTTGGGGGGCCAAGG + Intergenic
1072901103 10:99407680-99407702 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1073002329 10:100294893-100294915 AGCTGGAGGGTGAGGGGCCAGGG + Intronic
1073771944 10:106744353-106744375 ACCAGGACTTTGAGAGGCCGAGG - Intronic
1073955883 10:108870799-108870821 CCCAGCATGTTGAGAGGCCAAGG + Intergenic
1074072591 10:110087280-110087302 CCCAGCAATTTGAGGGGCCAAGG - Intronic
1074360196 10:112819698-112819720 ACCATGAGCTTGAAGGGCCAGGG + Intergenic
1074583689 10:114745617-114745639 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
1074650802 10:115522576-115522598 ACCAGGGATTTGAGGGGCCAGGG - Intronic
1074824856 10:117207277-117207299 CCCAGCAATTTGAGGGGCCAAGG - Intronic
1076245782 10:128946283-128946305 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1076297417 10:129397415-129397437 AGGAGGAGGGTGAGGGGCCAAGG + Intergenic
1076874805 10:133210831-133210853 CCCAAGGGGGTGAGGGGCCAGGG + Intronic
1077047162 11:551728-551750 ACCAGCAGGGAGAAGGGCCAGGG - Exonic
1077228014 11:1446807-1446829 ACCAGGAGGTCCAGGAGCCCGGG + Intronic
1077259303 11:1607305-1607327 GCCAGGAGGTTGCGGGGACCGGG + Intergenic
1077312262 11:1894307-1894329 CCCAGGAGGTTGAGGCTGCAAGG - Intergenic
1077399774 11:2348743-2348765 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1077479973 11:2809389-2809411 ACCAGGAGGCTGCGGGGGCGGGG - Intronic
1078591662 11:12646352-12646374 AACAGGAGGTGGATGGGTCATGG + Intergenic
1079008899 11:16812385-16812407 AAAAGGTGGGTGAGGGGCCATGG - Intronic
1079067742 11:17312307-17312329 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1079196660 11:18333989-18334011 CCCAGAAGTTTGAGAGGCCAAGG + Intronic
1079349408 11:19679963-19679985 GCCAGGAGGGTTGGGGGCCAAGG + Intronic
1080356969 11:31460079-31460101 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1080651836 11:34228867-34228889 TCCAGGAGTTTGGGAGGCCAAGG + Intronic
1081618807 11:44606401-44606423 GCCAGGAGGTTGAGGCTACAGGG + Intronic
1081913351 11:46715195-46715217 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1081939768 11:46930884-46930906 CCCAGGATTTTGAGAGGCCAAGG - Intergenic
1082672557 11:56053320-56053342 CCCAGGACTTTGGGGGGCCAAGG + Intergenic
1082810737 11:57477364-57477386 GTCAGGAGGTTGAGGGGACTAGG - Exonic
1083173640 11:60936639-60936661 CCCAGGAGGGCCAGGGGCCAGGG - Exonic
1083340002 11:61952855-61952877 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1083349317 11:62016028-62016050 TCCAGCACGTTGAGAGGCCAAGG + Intergenic
1083458765 11:62797133-62797155 ACCCCGAGGTTGAGGGGGAATGG - Intronic
1083584833 11:63849156-63849178 TCCAGAAGGTTGAGGGGGCCAGG - Intronic
1083849581 11:65356998-65357020 ACCTGGAGGGTGAGGAGCCAAGG + Exonic
1084076455 11:66781786-66781808 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1084397283 11:68920556-68920578 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1084736970 11:71111649-71111671 GCCAGGAGGTTGAAGGGCCCAGG - Intronic
1084935361 11:72583971-72583993 CCCAGGAGGCTGAGTGGACAGGG + Intronic
1084983457 11:72846428-72846450 CCCAGCACGTTGCGGGGCCAAGG - Intronic
1085422225 11:76372633-76372655 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1087582058 11:100069403-100069425 ATCAGGAATTTGAGAGGCCAAGG - Intronic
1087637755 11:100721722-100721744 TCCAGCACTTTGAGGGGCCAAGG - Intronic
1088306228 11:108410957-108410979 ACCAGCAGTTTGGGAGGCCAAGG - Intronic
1088481962 11:110302857-110302879 ACCAGGAGGTTGAAGCTGCAGGG + Intergenic
1088527840 11:110775822-110775844 CCCAGGAGTTTGGGAGGCCAAGG - Intergenic
1088621864 11:111693081-111693103 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1088766820 11:112990070-112990092 ACCAGGTGGTTTAGTGGGCATGG + Intronic
1088826818 11:113502885-113502907 ACCAGCACGTTGGGAGGCCAAGG + Intergenic
1088883221 11:113987655-113987677 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1088892915 11:114059050-114059072 ACCAGGAGGATGAGAGGGCCGGG + Intergenic
1089819367 11:121209982-121210004 CCCAGCATGTTGAGAGGCCAAGG + Intergenic
1089931553 11:122318345-122318367 TCCAGCATGTTGGGGGGCCAAGG + Intergenic
1090005693 11:123000432-123000454 ACCAGGAGCTTAGGGGCCCATGG - Intergenic
1090265065 11:125348460-125348482 CCAAGGAGGGGGAGGGGCCAGGG + Intronic
1090307009 11:125699846-125699868 ACCAGGAGGCAGAGGGGTCAGGG + Intergenic
1090808018 11:130214911-130214933 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1093018412 12:14177915-14177937 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1094561425 12:31557452-31557474 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1094623767 12:32104224-32104246 TCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1094639186 12:32256962-32256984 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1095493064 12:42756527-42756549 TCCAGGAAGAAGAGGGGCCAAGG + Intergenic
1096085123 12:48860462-48860484 CCCAGGAGGTTGAGGCTGCAAGG - Intronic
1096108210 12:49011461-49011483 ACCAGCACTTTGAGAGGCCAAGG - Intronic
1096290714 12:50340457-50340479 CCCAGTAGCTTGAGAGGCCAAGG + Intronic
1096614391 12:52823602-52823624 AACAGGAGGTAGAGGGTTCAAGG - Intronic
1096715762 12:53490355-53490377 CCCAGAAATTTGAGGGGCCAAGG + Intronic
1096842944 12:54390445-54390467 ACCAGGAGAGGGAGGGGCAATGG - Intronic
1096876734 12:54635261-54635283 AGGAGGAGGTTGAGGGCTCAGGG + Intergenic
1097060254 12:56277877-56277899 CCCAGAACTTTGAGGGGCCAAGG - Intronic
1097880750 12:64684332-64684354 CCCAGGACTTTGAGAGGCCAAGG - Intronic
1098101740 12:67025086-67025108 ACCAGCACTTTGGGGGGCCAAGG + Intergenic
1098257888 12:68636133-68636155 ACCAGGACTTTGGGAGGCCAAGG - Intronic
1098399229 12:70055422-70055444 CCCAGCAGTTTGAGTGGCCAAGG - Intergenic
1098577803 12:72063530-72063552 ACCAGGACATTGAGGGCACAAGG + Intronic
1099059768 12:77892663-77892685 CCCAGCACGTTGAGAGGCCAAGG - Intronic
1099686613 12:85897813-85897835 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1100307237 12:93362013-93362035 ACCAGCACTTTGGGGGGCCAAGG + Intergenic
1100479938 12:94968257-94968279 CCCAGCAGTTTGGGGGGCCAAGG - Intronic
1100629753 12:96375794-96375816 ACCAGCAGTTTGGGAGGCCAAGG - Intronic
1100688422 12:97012001-97012023 GCCTGGAGGTTGAGGACCCAGGG - Intergenic
1101511472 12:105396798-105396820 ATGTAGAGGTTGAGGGGCCAAGG + Intergenic
1101618275 12:106358965-106358987 ACCAGTAGTTTGGGAGGCCAAGG + Intronic
1101676997 12:106926286-106926308 ACCAGGAGGCTGAGGTGGGAGGG - Intergenic
1101984057 12:109431891-109431913 TCCAGGAGGTTGAGGCTTCAGGG - Intronic
1102170641 12:110839846-110839868 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1102359078 12:112268071-112268093 CCCAGCACTTTGAGGGGCCATGG - Intronic
1102376619 12:112426992-112427014 ACCAGTACTTTGAGGGGCCGAGG + Intronic
1102838846 12:116096101-116096123 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1102909597 12:116702668-116702690 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1102975370 12:117203228-117203250 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1103072728 12:117958081-117958103 CCCAGGACTTTGGGGGGCCAAGG - Intronic
1103109280 12:118260929-118260951 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1103315766 12:120053920-120053942 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1103378472 12:120475417-120475439 AGGTGGAGGTTGAGGGGGCAGGG - Intronic
1103610372 12:122120474-122120496 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1103625172 12:122213277-122213299 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1103630463 12:122255877-122255899 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1103750384 12:123154902-123154924 CCCAGCACTTTGAGGGGCCAAGG + Exonic
1103857463 12:123982902-123982924 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1103996177 12:124831655-124831677 GGCAGGGGGTTGAGGGGACAGGG - Intronic
1104110660 12:125701039-125701061 GACTGGAGGATGAGGGGCCATGG + Intergenic
1104431634 12:128721091-128721113 ACCAGGAGGCTGAAGGGTGAGGG - Intergenic
1104699196 12:130888705-130888727 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1104826278 12:131711576-131711598 ACCAGGAGGAGGTGGGGACAGGG - Intronic
1105053081 12:133072345-133072367 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1105202134 13:18190067-18190089 AGCAGGAGGTTGCTGGGCCACGG + Intergenic
1105374142 13:19828221-19828243 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1105381484 13:19891523-19891545 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1105566171 13:21550460-21550482 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1105712540 13:23026444-23026466 AGCAGGAGGGAGAGGGGACAGGG - Intergenic
1106271919 13:28162726-28162748 CCCAGTACTTTGAGGGGCCAAGG + Intronic
1106609651 13:31266246-31266268 ATCACGAGGTTGGGAGGCCAAGG - Intronic
1107622623 13:42249121-42249143 CCCAGCATGTTGAGAGGCCAAGG + Intronic
1107636378 13:42396223-42396245 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1107916896 13:45161589-45161611 CCCAGCAGGTTGGGAGGCCAAGG + Intronic
1108039662 13:46328103-46328125 CCCAGAACTTTGAGGGGCCAAGG + Intergenic
1108214979 13:48175119-48175141 CCCAGGAGTTTGGGAGGCCAAGG - Intergenic
1108528263 13:51304107-51304129 ATCAGGAGGTTGAGGCTGCAGGG + Intergenic
1109125005 13:58505976-58505998 ACCAGCACTTTGAGAGGCCAGGG + Intergenic
1109166373 13:59040261-59040283 ACCTGGAGTTTGAGGGGATACGG - Intergenic
1110665584 13:78114176-78114198 CCCAGCAGTTTGGGGGGCCAAGG - Intergenic
1111576720 13:90164054-90164076 ACCAGCAGTTTGAGAGGCCAAGG + Intergenic
1111913690 13:94339138-94339160 CCCAGGAGGTTGAGGCTGCACGG - Intronic
1112973983 13:105294416-105294438 TACAGGAGGTTGAGGAGGCATGG - Intergenic
1113915916 13:113874267-113874289 ACCAGGAGGCTGAGGCAGCAGGG - Intergenic
1114029131 14:18560380-18560402 CCCAGAAGTTTGAGAGGCCAAGG + Intergenic
1114064010 14:19044672-19044694 TCCAGGACGTTGAGAGGCTAAGG - Intergenic
1114098249 14:19355324-19355346 TCCAGGACGTTGAGAGGCTAAGG + Intergenic
1114376450 14:22151843-22151865 CCCAGGACTTTGGGGGGCCAAGG - Intergenic
1115268846 14:31528911-31528933 TTCAGGAGGCTGAGGGGACAGGG - Intronic
1115352085 14:32406456-32406478 CCCAGGACTTTGAGAGGCCAAGG - Intronic
1115564961 14:34617387-34617409 ACCAGTACGTTGGGAGGCCAAGG + Intronic
1115823154 14:37234439-37234461 ACCAGCACGTTGAGATGCCAAGG - Intronic
1116328462 14:43565218-43565240 CCCAGCAGACTGAGGGGCCATGG + Intergenic
1117487921 14:56217278-56217300 GCCAGGAGGTGGAGGGGGCAGGG - Intronic
1117568455 14:57021059-57021081 ACTGGGAGGTTGGGGGGCTAGGG - Intergenic
1117630385 14:57684616-57684638 GCCAGGAGGTTGGGGAGCCTGGG + Intronic
1118215740 14:63806963-63806985 CCTAGCAGTTTGAGGGGCCAAGG - Intergenic
1118220041 14:63847192-63847214 ACCAGTACTTTGAGAGGCCAAGG + Intergenic
1118300316 14:64609176-64609198 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1118389543 14:65284543-65284565 ACCAGAAGCTGGAGAGGCCAGGG + Intergenic
1118893439 14:69927428-69927450 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1118983238 14:70732727-70732749 ACCAGGGGGTTGTGGGTACATGG + Exonic
1119193203 14:72698426-72698448 ACCAGCACTTTGAGGGGCCAAGG + Intronic
1119281409 14:73412167-73412189 AACAGCAGTTTGAGAGGCCAAGG - Intronic
1119346878 14:73932872-73932894 CCCAGCACTTTGAGGGGCCAAGG - Exonic
1119436076 14:74598722-74598744 ACCACGTGGCTGAGGGGCTATGG - Intronic
1119494111 14:75063940-75063962 ACAAGGAGGGTGAGCCGCCAGGG - Exonic
1120757733 14:88259705-88259727 CCCAGCAGCTTGGGGGGCCAAGG - Intronic
1121253841 14:92517488-92517510 AACAGGAAGTTAAGGGGCCTTGG - Intronic
1121763355 14:96464295-96464317 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1121918335 14:97856574-97856596 ACCAGCATGTTGGGAGGCCAAGG + Intergenic
1121944136 14:98103027-98103049 ACAAGGAGGTGGATGGGACAAGG + Intergenic
1122186954 14:100006535-100006557 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1122471652 14:101971322-101971344 CCCAGTACTTTGAGGGGCCAAGG - Intronic
1122792070 14:104188178-104188200 ACCAGGGGCTTGAGGGGCGCAGG + Intergenic
1122930046 14:104928943-104928965 ACCAGGATGCGGTGGGGCCAGGG - Intronic
1123053391 14:105558700-105558722 CCCAGGAGGCTGCCGGGCCAGGG + Intergenic
1123077968 14:105679114-105679136 CCCAGGAGGCTGCCGGGCCAGGG + Intergenic
1123686284 15:22799866-22799888 CCCAGGAGGTTGAGGCTTCAGGG + Intronic
1124609746 15:31200370-31200392 GCCAGGAAAGTGAGGGGCCATGG - Intergenic
1124856981 15:33398736-33398758 ACCAGGAGGTTGGGGGGTGATGG + Intronic
1125025576 15:35026036-35026058 CCCAGGACTTTGAGAGGCCAAGG - Intergenic
1125155450 15:36579826-36579848 ACCAGGAGGTGGCGGGAACAAGG - Exonic
1125903417 15:43369815-43369837 ACCAGGAGGTGGCTGGGCCGCGG - Exonic
1126083765 15:44990686-44990708 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1126651019 15:50921238-50921260 TCCAGCACGTTGGGGGGCCAAGG - Intronic
1127503551 15:59577093-59577115 CCCAGTAGTTTGAGAGGCCAAGG - Intergenic
1127821361 15:62658900-62658922 ACCAAGAGCTAGAGGGGCCTTGG + Intronic
1128057507 15:64711339-64711361 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1128138776 15:65284044-65284066 CCTAGGAGGTTGAGGGACAAAGG - Intronic
1128265448 15:66262484-66262506 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1128569247 15:68721453-68721475 CCCAGCACGTTGAGAGGCCAAGG + Intronic
1128912926 15:71532563-71532585 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1129045754 15:72732780-72732802 ATCAGGAGGTAGAGGGAGCAAGG + Intronic
1129312522 15:74722626-74722648 AGCAGGAGGTTGAGGAGGCTGGG + Exonic
1129432830 15:75513514-75513536 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1129798546 15:78396344-78396366 TCCAGCAGTTTGAGGGGCCAAGG - Intergenic
1129938656 15:79473892-79473914 CCCAGCACGTTGAGAGGCCAAGG - Intergenic
1130210572 15:81918262-81918284 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1130403737 15:83580163-83580185 AACAAGAGGTTGAGTGACCAAGG - Intronic
1130441984 15:83963687-83963709 ATCAGGAGGTGCAGGGGTCAGGG - Intronic
1131006527 15:88983064-88983086 ACCAGGAGCTAGAAGGGTCAAGG - Intergenic
1131490752 15:92860612-92860634 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1131846305 15:96493222-96493244 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1131998665 15:98158217-98158239 ACCTGGAGGTAGAGGGGCTCAGG + Intergenic
1132224669 15:100131214-100131236 TCGAGGGGGTTGAGGGGCAAGGG + Intronic
1132262582 15:100439914-100439936 CCCAGCAGGTTGGGGAGCCATGG - Intronic
1132381190 15:101368064-101368086 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1132544041 16:524900-524922 GCCAGCAGGTAGAGGGGCCAGGG - Intergenic
1132885845 16:2181631-2181653 ACCAGGAGGCGGAGGGGCAGGGG + Intronic
1132999136 16:2840452-2840474 ACCAGGAGGCAGTGGGGTCAGGG + Intergenic
1133298170 16:4765784-4765806 ACCAGGAGGTGGCTGGGCCCCGG - Exonic
1133483523 16:6195465-6195487 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1133662421 16:7931623-7931645 CCCAGTACTTTGAGGGGCCAAGG + Intergenic
1133902112 16:9986512-9986534 CCCAGCACCTTGAGGGGCCAAGG + Intronic
1134170301 16:11963127-11963149 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1134217302 16:12326262-12326284 ACCAGCACTTTGTGGGGCCAAGG - Intronic
1135148948 16:19988547-19988569 ACCAGGAGGTTGAGCAGACTGGG + Intergenic
1135150464 16:20000824-20000846 ACCAGGAGCTAGAAGAGCCAAGG - Intergenic
1135344845 16:21680261-21680283 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1135597151 16:23753573-23753595 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1135709025 16:24699465-24699487 GCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1135735745 16:24930848-24930870 ACCAGGAGGTTGGGGGGGTGGGG + Exonic
1136120631 16:28131207-28131229 CCCAGGAGGCTGATGGGCCTTGG - Intronic
1136136192 16:28258361-28258383 CCCAGGAAGTTGGGGGGCCCTGG - Intergenic
1136425034 16:30164291-30164313 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1137348129 16:47684081-47684103 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1137504780 16:49044553-49044575 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1137999563 16:53261447-53261469 CCCAGGAGGTTGAGAGGTCAAGG - Intronic
1138105186 16:54284216-54284238 ACCCCGAGGTTGAGGGGCCAGGG - Intronic
1138679390 16:58674073-58674095 CCCAGGACTTTGAGAGGCCAAGG - Intronic
1138904543 16:61315049-61315071 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1139151181 16:64383320-64383342 CCCAGGAGGTTGAGGCAGCAAGG + Intergenic
1139225228 16:65228113-65228135 CCCAAGAGGTTGATGGGCCCAGG + Intergenic
1139373126 16:66480588-66480610 ACGAGGAGTGTGTGGGGCCAGGG + Exonic
1139569621 16:67803275-67803297 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1139814884 16:69661126-69661148 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1140071854 16:71657326-71657348 TCCAGCACTTTGAGGGGCCAAGG - Intronic
1140092683 16:71850852-71850874 ACCATCAGGGTGAGGGGCGAGGG + Exonic
1140228472 16:73097737-73097759 TCCAGGGGCTGGAGGGGCCACGG - Intergenic
1140316483 16:73902821-73902843 CCCATGAGGCTGAGGGTCCAGGG + Intergenic
1140502807 16:75449401-75449423 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1140655538 16:77135649-77135671 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1140937254 16:79684776-79684798 ACCAGGAGGTCCAGTGTCCAAGG - Intergenic
1141140822 16:81495773-81495795 CCCAGGAGAGTGAGTGGCCATGG - Intronic
1141508681 16:84498342-84498364 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1141586789 16:85039376-85039398 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1141751824 16:85963318-85963340 CCCAGGAGGTCAAGGGGTCAAGG + Intergenic
1141835464 16:86536103-86536125 CCCAGCAGTTTGGGGGGCCATGG - Intronic
1142023488 16:87799439-87799461 ACCAGGAGCTAGAAGGGGCAAGG + Intergenic
1142149175 16:88505233-88505255 AGCAGCAGGCTCAGGGGCCATGG - Intronic
1142367694 16:89658653-89658675 ACCAGGTGGTCGAGGGGCTGGGG + Intronic
1142409626 16:89909259-89909281 TCCAGCAGTTTGAGAGGCCAAGG + Intronic
1142573151 17:888469-888491 CCCAGGACTTTGGGGGGCCAAGG - Intronic
1142672376 17:1493035-1493057 ACCATGAGTTTGAGAGACCAGGG + Intergenic
1142783471 17:2200823-2200845 ACCAGGAGGTTGGGAGGCCGAGG - Intronic
1142830576 17:2546074-2546096 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
1142848493 17:2693318-2693340 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1143134033 17:4700672-4700694 CCCAGGATTTTGGGGGGCCAAGG + Intronic
1143581779 17:7831828-7831850 ACCAGGAGATTGGGGGGCCCAGG - Intronic
1143597666 17:7924994-7925016 CCCAGGACGTTGGGAGGCCAAGG - Intronic
1143619510 17:8073015-8073037 ACCAAAGGGTGGAGGGGCCAGGG - Intronic
1143777687 17:9210079-9210101 TCCCAGAGCTTGAGGGGCCATGG - Intronic
1143798463 17:9357618-9357640 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1144596640 17:16575474-16575496 CCCAGGACTTTGGGGGGCCAAGG - Intergenic
1144704618 17:17359369-17359391 CCCAGCACGTTGAGAGGCCAAGG + Intergenic
1144845183 17:18214005-18214027 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1144850431 17:18241380-18241402 GCCACGAGGGTGAGGGGCCCTGG + Intronic
1145063697 17:19748062-19748084 ACCAGGAGGCAGAGGTCCCAGGG - Intronic
1145068999 17:19787235-19787257 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1145221308 17:21091755-21091777 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1145237676 17:21220568-21220590 CCCAGCACCTTGAGGGGCCAAGG - Intergenic
1146722750 17:35134648-35134670 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1146818072 17:35960758-35960780 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146912079 17:36655225-36655247 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1147537483 17:41330093-41330115 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1147550655 17:41439174-41439196 CCCAGGAGTTTGAGCGCCCAGGG + Intronic
1147635354 17:41960679-41960701 TCCAGGAGGGTGAGGGGTCGGGG - Intronic
1148131333 17:45264230-45264252 GCCTGGAGGGTGAGGGGCCGAGG + Exonic
1149736632 17:59000942-59000964 ACCAGGACTTTGGGAGGCCAAGG + Intronic
1149761163 17:59231574-59231596 ACCAGGACTTTGGGAGGCCAAGG - Intronic
1149889065 17:60369987-60370009 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1149996547 17:61408834-61408856 GCCAGAAGGTGCAGGGGCCAGGG + Exonic
1150619439 17:66798221-66798243 ACCATGAGCTTGATGGGCAATGG - Intronic
1150769802 17:68031307-68031329 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1151118779 17:71768755-71768777 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
1151274289 17:73022342-73022364 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1151694965 17:75710007-75710029 ACCAGGACTTTGGGAGGCCAAGG + Intergenic
1151695985 17:75717797-75717819 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1151715188 17:75827612-75827634 GCCAGGAGGCAGATGGGCCAGGG + Exonic
1151880382 17:76891213-76891235 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1152119659 17:78410720-78410742 CCCAGGACTTTGGGGGGCCAAGG - Intronic
1152184712 17:78847733-78847755 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1152231305 17:79115380-79115402 ACCAGGTGGGCGAGGGGCCTGGG - Intronic
1152373739 17:79906844-79906866 CCCAGCATTTTGAGGGGCCAAGG - Intergenic
1153298886 18:3575440-3575462 ATCAGGAAGTAGAGGGGTCAGGG + Intronic
1153380989 18:4439135-4439157 AGCAGGATGCTGAGAGGCCACGG - Intronic
1153858480 18:9174268-9174290 GCCAGTGGGTTGAGGTGCCATGG + Intronic
1154973595 18:21435382-21435404 ACAAGGAAGTTGGGGGGTCAGGG - Intronic
1154989120 18:21583391-21583413 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1155465206 18:26127205-26127227 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1155541788 18:26876162-26876184 ACCAGGAGTTTGAGCAGCCAGGG - Intergenic
1156093013 18:33494268-33494290 CCCAGGAGGCAGAGGGGCGAAGG - Intergenic
1157070769 18:44405187-44405209 CCCAGCACGTTGAGAGGCCAAGG + Intergenic
1157244221 18:46039366-46039388 ACCAGGAGGATGAGGAGCTGTGG - Intronic
1157575686 18:48741673-48741695 CCCAGCAGGTTGGGAGGCCAAGG - Intronic
1157747167 18:50146158-50146180 CCTAGCAGGTTGATGGGCCAGGG + Intronic
1157839379 18:50941623-50941645 CCCAGCAGTTTGAGAGGCCAGGG - Intronic
1158046009 18:53156232-53156254 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1158316623 18:56218340-56218362 ACCAGGAGGTGGAGGTTGCAGGG - Intergenic
1158536322 18:58311435-58311457 CCCAGGGGGTTGAGGGTGCAAGG - Intronic
1158597695 18:58830500-58830522 TCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1158705984 18:59792496-59792518 AGCAGGAGGTTGAGAGGTCTAGG - Intergenic
1158706870 18:59800571-59800593 GCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1159315058 18:66762097-66762119 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1159381339 18:67663527-67663549 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1159448550 18:68570744-68570766 ACCAGCACGTTGGGAGGCCAAGG + Intergenic
1159814519 18:73056154-73056176 ACAGGGAGGATGAGGTGCCAGGG + Intergenic
1159925226 18:74263070-74263092 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1160556871 18:79731126-79731148 CCCAGGATGAAGAGGGGCCACGG - Intronic
1160587140 18:79919011-79919033 AGCGCGAGGTCGAGGGGCCAAGG + Intronic
1160789033 19:914334-914356 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1160931642 19:1573244-1573266 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1160941924 19:1624145-1624167 ACCAGGACTTTGGGAGGCCAAGG + Intronic
1161021792 19:2014508-2014530 AGCCGGAGGTGGAGGGGCCCAGG + Intronic
1161095153 19:2386018-2386040 ACCAGGAGGTTGAGGCTGCAAGG - Intergenic
1161241471 19:3225717-3225739 ACGCGGAGGTGGTGGGGCCAGGG - Intronic
1161434117 19:4251731-4251753 TCCAGCAGGTTGGGAGGCCAAGG + Intronic
1161971858 19:7586334-7586356 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1161983676 19:7643079-7643101 AGCATGGGGTTGAGGGGCCGAGG - Intronic
1162039950 19:7964582-7964604 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1162069787 19:8146904-8146926 ACAAGGAGGTTGTAGGGCAAAGG + Intronic
1162136272 19:8557370-8557392 CCCAGGAGGTTGAGGCTGCATGG - Intronic
1162893785 19:13752355-13752377 ACCAGCAGTTTGGGAGGCCAAGG + Intronic
1163054240 19:14706368-14706390 GCCAGGAGGTTGAGGGGTGGAGG - Intronic
1163180909 19:15600908-15600930 CCCAGGAGGTTGAGGTTGCAGGG + Intergenic
1163397500 19:17072588-17072610 CCCAGCAGTTTGAGGCGCCAAGG - Intronic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1163595193 19:18217238-18217260 GCCAGGAGGTTGAGGCTGCAGGG - Intronic
1164235001 19:23324032-23324054 ACAAGGAGGAGGAGGGGACAAGG - Intronic
1164549126 19:29193563-29193585 ACCAGGAGGCAGAGGGCCAAAGG - Intergenic
1164915081 19:32045831-32045853 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1165032689 19:33009703-33009725 CCCAGCAGGTTGGGAGGCCAAGG - Intronic
1165402980 19:35613507-35613529 CCCAGGAGGTTGAGGCTGCAAGG + Intronic
1165783197 19:38445736-38445758 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1165836722 19:38761918-38761940 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1166586931 19:43957421-43957443 ACCAGCACTTTGAGAGGCCAAGG - Intronic
1166661815 19:44652266-44652288 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1166771841 19:45288150-45288172 CCCAGGAGGTTGAGGCTACAGGG + Intronic
1166814639 19:45535974-45535996 CCCAGTACGTTGAGAGGCCAAGG + Intronic
1167153161 19:47721732-47721754 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1167224750 19:48230358-48230380 ACGAGGAACTGGAGGGGCCAAGG + Intronic
1167476144 19:49702365-49702387 GCCAGCAGGTTGCGAGGCCAAGG + Intronic
1167697151 19:51021916-51021938 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1167745428 19:51348163-51348185 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1168191165 19:54739687-54739709 GCCAAGGGGTTGAGAGGCCAGGG - Intronic
1168203871 19:54835259-54835281 GCCAAGGGGTTGAGAGGCCAGGG - Intronic
1168333859 19:55585911-55585933 AGCCGGAGGTCGAGGGGCCCAGG - Intergenic
1168650128 19:58087280-58087302 AGCAGGTGGGTGAGGGGCCTTGG - Intronic
1168668845 19:58226162-58226184 ACCAAGAGGTTGAGGCTGCAGGG - Intergenic
925004190 2:428576-428598 ACCAGGAGACTGAGGGGCTGGGG + Intergenic
925148609 2:1599794-1599816 AGCAGGAAGAGGAGGGGCCAGGG - Intergenic
925177372 2:1795026-1795048 TGCAGGAGATTCAGGGGCCACGG - Intronic
925362261 2:3287910-3287932 CCCAGGCGGTGGAGGGGCCAAGG + Intronic
925943849 2:8842850-8842872 AGCAGGAGGTTCAGGTGGCATGG - Intergenic
926389283 2:12370939-12370961 AACAGTAGGTAGAGGGGGCAGGG + Intergenic
927549534 2:23985743-23985765 CCCAGCACTTTGAGGGGCCAAGG + Intronic
927900147 2:26813075-26813097 CCCAGGAAGTTGAGCAGCCAAGG - Intergenic
928491876 2:31792900-31792922 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
928534883 2:32230413-32230435 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
928655611 2:33447673-33447695 CCCAGGACTTTGAGAGGCCAAGG - Intronic
928997934 2:37315590-37315612 AACAGGAGGTAGAGGGCACAAGG - Intronic
929052546 2:37850213-37850235 AATGGGAGGTTGAGGGGTCAGGG + Intergenic
929138121 2:38643831-38643853 ACCAAGAGGTTCCAGGGCCAAGG - Intergenic
929495015 2:42433442-42433464 ACCAGTTGGCTGAAGGGCCAGGG + Intergenic
930965841 2:57325611-57325633 ACCAGGAAATTGAAGGGCGAAGG - Intergenic
931330961 2:61282712-61282734 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
931733515 2:65174209-65174231 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
931741866 2:65252889-65252911 CCCAGGAGGTTGAGGAAACAGGG + Intronic
931741884 2:65253187-65253209 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
931858196 2:66326291-66326313 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
932327178 2:70871111-70871133 ACCAGGAGGATCAGGAGCCAGGG - Intergenic
932550376 2:72763828-72763850 CCCAGCAGCTTGAGAGGCCAAGG + Intronic
932650832 2:73554453-73554475 CCCAGCAGTTTGGGGGGCCAAGG + Intronic
933475560 2:82785490-82785512 ACCAACAGTTTGAGAGGCCAAGG - Intergenic
934615907 2:95770799-95770821 ACCAGCAGTTTGAGAGGCCGAGG - Intergenic
934899415 2:98145983-98146005 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
935008096 2:99101416-99101438 CCCAGCACTTTGAGGGGCCAAGG - Intronic
935208392 2:100917274-100917296 CCCAGCAGGTTGAGAGGCCAAGG + Intronic
935513052 2:104000191-104000213 CCCAGGATTTTGAGAGGCCAAGG + Intergenic
935854993 2:107264036-107264058 AACAGGGGGTGGAGAGGCCAGGG - Intergenic
936448917 2:112618858-112618880 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
936680038 2:114759619-114759641 ACCAGAAGGTTGTGGGGACAAGG + Intronic
937315516 2:120929816-120929838 ACCTGCAGGTGGAGGGGCCCTGG - Intronic
937372071 2:121305610-121305632 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
938049308 2:128152749-128152771 AAAAGGAGGTTGAGGGGGGAGGG - Intronic
938438681 2:131304963-131304985 CCCAGGACTTTGAGAGGCCAAGG - Intronic
939490371 2:142869091-142869113 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
939540684 2:143490341-143490363 ACCAGTAGGTTGAGGAGGCTGGG + Intronic
939686676 2:145208844-145208866 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
939968015 2:148629760-148629782 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
940482748 2:154255799-154255821 CCCAGCACGTTGAGAGGCCAAGG + Intronic
940685148 2:156839445-156839467 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
941094044 2:161215101-161215123 GCCAGGATGCTCAGGGGCCATGG + Intronic
941852356 2:170196438-170196460 CCCAGGAGGTTGAGGCTACAGGG + Intronic
941965650 2:171297832-171297854 TCCAGGAGGTTGGAGAGCCATGG + Intergenic
942160481 2:173180598-173180620 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
942177500 2:173348277-173348299 CCCAGCACTTTGAGGGGCCAGGG + Intergenic
942303727 2:174586496-174586518 CCCAGGTGGGTGAGGGGGCAGGG + Intronic
942554340 2:177156310-177156332 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
942562523 2:177235577-177235599 CCCAGGAGTTTGGGAGGCCAAGG + Intronic
944065627 2:195616553-195616575 CCCAGCACTTTGAGGGGCCAAGG - Intronic
944243791 2:197511588-197511610 ACCAGCATTTTGAGAGGCCAAGG + Intronic
944362070 2:198869027-198869049 ACCAGCAGTTTGAGAGGCCAAGG - Intergenic
944640581 2:201720636-201720658 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
944792346 2:203143959-203143981 CCCAGGACGTTGGGAGGCCAAGG + Intronic
944841284 2:203626174-203626196 CCCAGAACTTTGAGGGGCCAAGG + Intergenic
945079697 2:206076107-206076129 ACCAGAAGGTTGGGAGGCCACGG + Intronic
945174625 2:207030059-207030081 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
945242694 2:207690821-207690843 CCCAGCATGTTGAGAGGCCAAGG + Intergenic
945441566 2:209886011-209886033 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
945525541 2:210884230-210884252 TCCAGCACTTTGAGGGGCCAAGG + Intergenic
945549445 2:211201412-211201434 ACCAGAATTTTGAGAGGCCAAGG + Intergenic
946859899 2:223990725-223990747 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
946929809 2:224660509-224660531 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
947113837 2:226748175-226748197 ACCAGCACTTTGAGAGGCCAAGG + Intronic
947382743 2:229560858-229560880 ACCAGGAGGTAAAGGGGCCGGGG + Intronic
947604367 2:231474816-231474838 CCCAGGACTTTGAGAGGCCAAGG + Intronic
948826877 2:240577260-240577282 ACCAGGACGCTGAAGGCCCAGGG - Intronic
948870231 2:240794120-240794142 TCCTGGAGGTTGAGGGGCCAGGG - Intronic
948947817 2:241230068-241230090 GCCAGGAGCTTCAGGGGACAAGG - Intronic
1168795090 20:606048-606070 ACCTGGGGGTGGAGGGGGCAGGG - Intronic
1168845530 20:941847-941869 CCCAGCATGTTGAGCGGCCAAGG + Intergenic
1169377601 20:5078863-5078885 GCCAGGAGGTTGAGGCTGCAGGG - Intronic
1169390300 20:5185347-5185369 CCCAGGAGGTTGAGGCTTCAAGG + Intronic
1169552164 20:6712357-6712379 ACCAGGAAGGAGAGAGGCCAGGG + Intergenic
1170631044 20:18065782-18065804 ACCAGCACGTTGGGAGGCCAAGG + Intergenic
1171198876 20:23225208-23225230 ACAAGGAGGGAGGGGGGCCAAGG + Intergenic
1171432413 20:25091378-25091400 ACCAGGAGTGTGCGGGGCCCTGG - Intergenic
1172078147 20:32315453-32315475 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1172168823 20:32916507-32916529 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1172321303 20:33997189-33997211 CCCAGGAGGTTGAGGTTGCAGGG - Intronic
1172458714 20:35098829-35098851 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1172478597 20:35257190-35257212 ACCAGGAGGTGGTTTGGCCAAGG + Intronic
1172545913 20:35761412-35761434 TCCAGCATGTTGGGGGGCCAAGG + Intergenic
1172624233 20:36338060-36338082 ACCATGAGGTTCAGGGGCACAGG - Intronic
1172636723 20:36415013-36415035 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1172677397 20:36683361-36683383 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1172727671 20:37058653-37058675 CCCAGGACTTTGAGAGGCCAGGG - Intronic
1172773710 20:37395653-37395675 GCAAGGAGGTTGGGGGGACATGG + Intronic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1172977988 20:38920613-38920635 ACCAGAAAGTAGAGGGCCCATGG + Exonic
1173276755 20:41591438-41591460 GCCAGGAGATTGGGAGGCCAAGG + Intronic
1173465120 20:43274506-43274528 CCGAGGATCTTGAGGGGCCATGG + Intergenic
1174017111 20:47497860-47497882 CCCAGCATGTTGAGAGGCCAAGG + Intergenic
1174045462 20:47729747-47729769 GCCAGGAGGCAGAGGGGCCAGGG + Intronic
1174167132 20:48592976-48592998 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1174334008 20:49844722-49844744 CCCAGGAGGTTGAGGCTACAGGG + Intronic
1174532446 20:51224821-51224843 ACCAGGAGCTGGAAGGGGCAAGG + Intergenic
1174633810 20:51981402-51981424 ACCAGCATTTTGAGAGGCCAAGG + Intergenic
1174638749 20:52024736-52024758 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1174640058 20:52036096-52036118 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1174655544 20:52169385-52169407 AGCAGAAGGTTGGGAGGCCATGG - Intronic
1175490154 20:59374872-59374894 ACCTGGAGGAGGAGGGGACAAGG - Intergenic
1175722398 20:61295031-61295053 ACCAGGATATTGAGGGTGCAAGG - Intronic
1175812153 20:61864194-61864216 CCCAGGAGCTGGAAGGGCCAGGG + Intronic
1175867585 20:62188601-62188623 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1176048330 20:63103854-63103876 CCCAGGAGTGTGAGGGGCCTGGG - Intergenic
1176160851 20:63647364-63647386 CCCAGAACTTTGAGGGGCCAAGG + Intronic
1176296642 21:5076667-5076689 ACCAGGAGGAGGAGGGGCGCTGG + Intergenic
1176446044 21:6821314-6821336 TCCAGGATGTTGAGAGGCCGAGG - Intergenic
1176715817 21:10347941-10347963 AGCAGGAGGCTGCTGGGCCACGG - Intergenic
1176824210 21:13686347-13686369 TCCAGGATGTTGAGAGGCCGAGG - Intergenic
1177704077 21:24677689-24677711 ACCAGCAATTTGAGAGGCCAAGG + Intergenic
1178055669 21:28796002-28796024 AACAGGAGGTAGAGGGCACAAGG - Intergenic
1178079430 21:29047797-29047819 AATAGGATGTGGAGGGGCCATGG + Intronic
1178840301 21:36133190-36133212 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1178933765 21:36842872-36842894 ACCAGCAGGATGAGGGGCCCCGG + Intronic
1179583246 21:42358360-42358382 ACCAGGAGGTGGAGGGAGCCTGG + Intergenic
1179659914 21:42867813-42867835 CCCAGCATTTTGAGGGGCCAAGG - Intronic
1179860407 21:44185454-44185476 ACCAGGAGGAGGAGGGGCGCTGG - Intergenic
1180194901 21:46187551-46187573 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1180227109 21:46400768-46400790 ACCAGCACTTTGAGAGGCCAAGG - Intronic
1180453248 22:15487443-15487465 CCCAGAAGTTTGAGAGGCCAAGG + Intergenic
1180482502 22:15767306-15767328 TCCAGGACGTTGAGAGGCTAAGG - Intergenic
1180986366 22:19906377-19906399 CCCAGCACTTTGAGGGGCCAGGG + Intronic
1181146052 22:20847985-20848007 CCCAGAACTTTGAGGGGCCAGGG + Intronic
1181358948 22:22320333-22320355 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1181830456 22:25556413-25556435 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1182481089 22:30609251-30609273 ACCAGCAGTTTGGGAGGCCAAGG - Intronic
1182694312 22:32186247-32186269 AAGAGGAGGAGGAGGGGCCAAGG - Intergenic
1182791326 22:32955448-32955470 ACCTGGGGGATGAGGGGCCCAGG + Intronic
1183502720 22:38190551-38190573 ACCAGGACTTTGGGAGGCCAAGG - Intronic
1183741317 22:39670162-39670184 ACCAGGAGGCTGAAGAGGCACGG + Exonic
1183902031 22:41013082-41013104 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1183942234 22:41302247-41302269 ACCCGGAGTTGGAGGGGCCGCGG + Intronic
1184127212 22:42496053-42496075 CCCAGTACTTTGAGGGGCCAAGG + Intergenic
1184434812 22:44464699-44464721 ACCAGCAGTTTGAGAGGCCAAGG - Intergenic
1184548366 22:45189399-45189421 CCCAGGAGGTGGAGGCTCCAGGG + Intergenic
1184701519 22:46176958-46176980 CCCAGGACTTTGGGGGGCCAAGG + Intronic
1184852950 22:47131208-47131230 ACCATGAGATTGAGAGGGCATGG + Intronic
1184973039 22:48041083-48041105 CCCAGCACATTGAGGGGCCAAGG - Intergenic
1185101166 22:48841665-48841687 AGAAGGAAGTTGAGGGGCCCTGG - Intronic
1185381946 22:50513306-50513328 CCCAGCAGTTTGGGGGGCCAAGG + Intronic
949372268 3:3348250-3348272 CCCAGGAGGTTGAGGCCGCAGGG - Intergenic
950634152 3:14303319-14303341 TGCAGGTGGTTGAGGAGCCAGGG - Intergenic
950712259 3:14820759-14820781 ACCAGGAGCCTGAGGGGTCAGGG + Exonic
951026318 3:17834338-17834360 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
951216919 3:20033709-20033731 TCCAGCACTTTGAGGGGCCAAGG - Intergenic
951261597 3:20516315-20516337 ACCAGGATTTTGGGGGGCTAGGG - Intergenic
951881330 3:27483935-27483957 GCCGGGAGGTGGAGGGGCGACGG + Intronic
951954532 3:28240467-28240489 AGCTGTAGGTTGAGGTGCCAAGG - Intergenic
952676039 3:36031122-36031144 ACCAGATGGTTGAGGGCCCTGGG - Intergenic
952736812 3:36699004-36699026 ACCAGCATTTTGAGAGGCCAAGG + Intergenic
952753438 3:36844475-36844497 CCCAGCACTTTGAGGGGCCAAGG - Intronic
952788587 3:37179551-37179573 TCCAGCACTTTGAGGGGCCAAGG + Intronic
952974599 3:38683017-38683039 ACCAGGAGGTGCTGGAGCCAGGG + Intergenic
953184681 3:40626877-40626899 ACCAGATGCTTGAGGGGCCTTGG + Intergenic
953267226 3:41402898-41402920 CCCAGCACTTTGAGGGGCCAAGG + Intronic
953320448 3:41966579-41966601 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
953919542 3:46942601-46942623 CCCCGGAGGTTGTGTGGCCAAGG - Intronic
953955274 3:47227153-47227175 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
953995932 3:47520021-47520043 CCCAGCAGGTTGGGAGGCCAAGG + Intergenic
954023848 3:47766313-47766335 CCCAGGACTTTGGGGGGCCAAGG + Intronic
954179694 3:48872077-48872099 CCCAGGACTTTGAGAGGCCAAGG - Intronic
954225970 3:49181398-49181420 CCCAGGACTTTGAGAGGCCAAGG + Intronic
954253937 3:49390512-49390534 ACCAGCACTTTGAGAGGCCAAGG - Intronic
954270409 3:49503579-49503601 CCCAGAAGTTTGAGAGGCCAAGG + Intronic
954339755 3:49943702-49943724 ACCAGTACCTTGAGAGGCCAAGG - Intronic
954371730 3:50172508-50172530 TCCTGGAGTTGGAGGGGCCAAGG + Intronic
954426462 3:50445936-50445958 ACCTGGAGCTGGAGGTGCCATGG - Intronic
954453653 3:50585419-50585441 ACCAGGAGGTTGAGAACCCCAGG - Intergenic
954511649 3:51130956-51130978 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
954777570 3:53033817-53033839 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
954951487 3:54478380-54478402 TCCAGCAGTTTGAGAGGCCAAGG + Intronic
955377301 3:58408770-58408792 CCCAGGACTTTGAGAGGCCAAGG - Intronic
955965794 3:64388078-64388100 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
956091070 3:65667645-65667667 CCCAGGAGGTTGAGGCTGCACGG - Intronic
956124423 3:65997906-65997928 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
956163036 3:66374632-66374654 CCCAGGATTTTGGGGGGCCAAGG + Intronic
957615775 3:82524863-82524885 ACCAGGAAGTGCAGGGGCTAGGG - Intergenic
957830983 3:85518640-85518662 ACCAGGAGTTGGAAGGGGCAAGG - Intronic
958436039 3:94096748-94096770 ACCAGCAGTTTGGGAGGCCAAGG - Intronic
958653984 3:96977906-96977928 CCCAGAAGTTTGAGAGGCCAAGG + Intronic
959723193 3:109515241-109515263 CCCAGCAGTTTGAGGGGTCAAGG + Intergenic
960922202 3:122758654-122758676 ACCAGAACTTTGAGAGGCCAAGG + Intronic
961108533 3:124263253-124263275 ATCAGGATGTTGAGGGACGATGG - Intronic
961333754 3:126158065-126158087 ACCAGGAGGCGCAGGGGCCAGGG - Intronic
961347406 3:126273095-126273117 ACCAGCACATTGAGAGGCCAAGG - Intergenic
961412254 3:126730856-126730878 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
961442220 3:126959888-126959910 CGCAGCAGGTTGAGGGGGCAGGG + Intronic
961450784 3:127001428-127001450 ACCAGGGGCAAGAGGGGCCAGGG + Intronic
962239888 3:133743459-133743481 ACCAGGACATGCAGGGGCCAAGG - Intergenic
963804690 3:149711213-149711235 CCCAGCAGGTTGGGAGGCCAAGG + Intronic
963938501 3:151078081-151078103 ACCAGGTGGCTGAGGTTCCAGGG + Intergenic
964351941 3:155811759-155811781 ACCAGCAGTTTGGGAGGCCAAGG + Intergenic
964570199 3:158102645-158102667 GCCAGGAGGTCGAGGGCCCAGGG - Intronic
964879823 3:161410980-161411002 AAGAGGAGGTATAGGGGCCAAGG + Intergenic
965038870 3:163479967-163479989 CCCAGCATGTTGAGAGGCCAAGG - Intergenic
965706740 3:171516175-171516197 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
965771616 3:172187868-172187890 CCCAGGACTTTGGGGGGCCAAGG - Intronic
967360362 3:188623506-188623528 CCCAGGACTTTGGGGGGCCAAGG - Intronic
968127452 3:196170188-196170210 AGCAGAAGGTTCAGAGGCCAGGG + Intergenic
968420438 4:479530-479552 AACAGGACGTTCAGGGACCAGGG + Intronic
968429576 4:548645-548667 ACCAGGAGGCTGAGGCTTCAGGG - Intergenic
968777254 4:2550294-2550316 ACCAGCACTTTGAGAGGCCAAGG - Intronic
969153900 4:5193271-5193293 GCAAGGAGGATGAGGGGCGAGGG - Intronic
969219744 4:5751965-5751987 AACAGGAGGGTTTGGGGCCATGG + Intronic
969358358 4:6645124-6645146 ACCAGGACTTTGGGAGGCCAAGG - Intergenic
969497610 4:7535020-7535042 AGCAGGAGGAGGAGGGCCCACGG - Intronic
970266977 4:14298897-14298919 ACCAGCATTTTGAGAGGCCAAGG + Intergenic
970468216 4:16349190-16349212 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
970692166 4:18632281-18632303 ACCAGCACGTTGGGAGGCCAAGG + Intergenic
972820422 4:42695443-42695465 CCCAGCACGTTGAGAGGCCAAGG - Intergenic
972923007 4:43966923-43966945 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
972935756 4:44132762-44132784 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
973334582 4:48943013-48943035 TCCAGCAGTTTGAGAGGCCAAGG - Intergenic
973992256 4:56421412-56421434 ACCAGGGGGTGAGGGGGCCATGG - Intronic
974446767 4:61994400-61994422 CCCAGGACTTTGAGAGGCCACGG - Intronic
974488431 4:62533331-62533353 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
974567695 4:63599335-63599357 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
974910118 4:68107686-68107708 CCCAGCACTTTGAGGGGCCAAGG + Intronic
975646707 4:76553235-76553257 ACCAGGAGGTGGAGGTGCAGTGG - Intronic
975928157 4:79484972-79484994 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
976594277 4:86880102-86880124 CCCAGAAGGTTGGGAGGCCAAGG - Intronic
976634869 4:87277514-87277536 CCCAGCAGTTTGGGGGGCCAAGG - Intergenic
976650193 4:87425643-87425665 ACCAGCACTTTGAGAGGCCAAGG - Intronic
977368373 4:96102080-96102102 ACCAGGGGAGGGAGGGGCCAGGG + Intergenic
978427868 4:108601151-108601173 CCCAGGACTTTGAGAGGCCAAGG - Intergenic
978522871 4:109634947-109634969 ATCAGGGGGTTGGGGGGCTAGGG - Intronic
978945498 4:114490976-114490998 GACATGAGTTTGAGGGGCCAGGG + Intergenic
979632634 4:122921353-122921375 CCCAGCACTTTGAGGGGCCAAGG + Intronic
979665956 4:123311375-123311397 CCCAGGACTTTGAGAGGCCAAGG + Intronic
980049621 4:128026036-128026058 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
980804481 4:137794148-137794170 ACCAGCACTTTGAGGGGCCAAGG + Intergenic
980897889 4:138877135-138877157 ACCAGGAGCTAGAAGGGGCAAGG + Intergenic
981086873 4:140692767-140692789 CCCAGCACTTTGAGGGGCCAAGG + Intronic
981144032 4:141304268-141304290 CCCAGCAGTTTGGGGGGCCAAGG - Intergenic
982288935 4:153760532-153760554 CCCTGGAGGTAGAGGGGCAAAGG - Intergenic
983047417 4:163004180-163004202 AACAGGAGGTACAGGGGTCAGGG + Intergenic
983163971 4:164452006-164452028 ACCAGAAGGCTGCAGGGCCATGG + Intergenic
984525990 4:180860196-180860218 ATCAGGAGGTGCAGGGGTCAGGG + Intergenic
984647423 4:182234480-182234502 CCCAGCACTTTGAGGGGCCAAGG + Intronic
984761402 4:183365883-183365905 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
985044816 4:185929782-185929804 CCCAGCACTTTGAGGGGCCAAGG - Intronic
985235463 4:187868669-187868691 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
986069207 5:4265618-4265640 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
986210348 5:5665695-5665717 TGCAGGAGGTGGAGGGACCAAGG + Intergenic
986222023 5:5776501-5776523 CCCAGGAGGATGAGGACCCAGGG + Intergenic
986361305 5:6980865-6980887 ATTAGTAGGTTGAGGGGGCAAGG - Intergenic
986444718 5:7811250-7811272 CCCAGCATTTTGAGGGGCCAAGG + Intronic
988464448 5:31475065-31475087 CCCAGCACTTTGAGGGGCCAAGG + Intronic
988518849 5:31928317-31928339 ACCAGCACCTTGAGAGGCCAAGG - Intronic
988869576 5:35373971-35373993 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
989054631 5:37355255-37355277 ACCAGGACTTTGAGAGGCCAAGG + Intronic
989141370 5:38204755-38204777 AGCAGGAGAAAGAGGGGCCAGGG - Intergenic
989411044 5:41120680-41120702 TCCATGAGGCTGTGGGGCCAAGG + Intergenic
990058275 5:51613314-51613336 ATCATGAGGTTTAGGGGCAAGGG - Intergenic
990418030 5:55605434-55605456 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
991158793 5:63470297-63470319 CCCAGCAGGTTGGGAGGCCAAGG + Intergenic
991687296 5:69193381-69193403 CCCAGCACTTTGAGGGGCCAAGG + Intronic
992305901 5:75437034-75437056 CCCAGGACTTTGAGAGGCCAAGG - Intronic
992554368 5:77888944-77888966 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
993849027 5:92982896-92982918 ACAGGCAGGTTCAGGGGCCAAGG - Intergenic
994149521 5:96432287-96432309 ACCAGGAGGTTGGGAGGCCGCGG - Intronic
994373599 5:98993948-98993970 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
995273329 5:110248402-110248424 ACCATCAGGTGTAGGGGCCAGGG + Intergenic
995393987 5:111667772-111667794 CCCAGGAGGCTGAGGTGCGAGGG + Intronic
995482322 5:112605620-112605642 CCCAGCAGTTTGCGGGGCCAAGG + Intergenic
995503420 5:112833429-112833451 CCCAGCACTTTGAGGGGCCAAGG - Intronic
995792786 5:115910011-115910033 ACCAACACTTTGAGGGGCCAAGG + Intronic
996058491 5:119006568-119006590 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
996254049 5:121376037-121376059 CCCAGGACTTTGAGAGGCCATGG - Intergenic
996811653 5:127522464-127522486 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
997156695 5:131568567-131568589 ACCAGTGGTTTGAGAGGCCAAGG - Intronic
998057962 5:139095510-139095532 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
998546414 5:143031706-143031728 AGGAGGAGGTTGGTGGGCCAGGG - Intronic
998841198 5:146256104-146256126 ACCAGCACTTTGAGAGGCCAAGG - Intronic
999223865 5:150003711-150003733 ACCAACAGTTTGAGAGGCCAAGG + Intronic
999398142 5:151243886-151243908 AGCAGGAGGTGGCAGGGCCAGGG + Intronic
999415266 5:151389563-151389585 ACCAGGGTGTTGAGGGGTCGGGG - Intergenic
999579652 5:153022660-153022682 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
999876996 5:155818594-155818616 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1000770432 5:165346807-165346829 CCCAGCACCTTGAGGGGCCAAGG + Intergenic
1000836505 5:166161229-166161251 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1001746472 5:174096453-174096475 ACCTGGAGCTTGGAGGGCCAGGG + Intronic
1001929807 5:175664886-175664908 CCCAGCACGTTGAGAGGCCACGG - Intronic
1002439985 5:179259220-179259242 CCCAGGAGGAAAAGGGGCCAGGG - Intronic
1002877774 6:1226589-1226611 CCCAGGCAGATGAGGGGCCAGGG + Intergenic
1003631438 6:7791130-7791152 ACCAGAGGGTGGAGGGGGCATGG + Intronic
1003874131 6:10422040-10422062 AGCAGGTGTTTGAGGAGCCAGGG - Intergenic
1004121321 6:12825026-12825048 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1005288826 6:24358231-24358253 AGCAGGAGATTGAGGGGTAAAGG - Exonic
1005365931 6:25077084-25077106 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1006290394 6:33130957-33130979 GCCAGGAGGTAGAGGGGTCTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006435220 6:34022614-34022636 AACAGGAGGACGAGGGGCCGGGG - Exonic
1007004007 6:38342769-38342791 ACCAGTAGGGTGACTGGCCAAGG + Intronic
1007201835 6:40116106-40116128 ATCAGGAGGTTGTGGGGCCCTGG + Intergenic
1007301807 6:40873302-40873324 ACCAGGAGCTGGAGGAGACAAGG - Intergenic
1007601268 6:43083179-43083201 AGCAGGAGGTTGAGGGACACAGG - Intronic
1007677453 6:43608602-43608624 CCCAGGAGGTTGAGGCTACAAGG - Intronic
1007797660 6:44363393-44363415 ACCAGCACTTTGAGAGGCCAAGG - Intronic
1008601147 6:53096652-53096674 CCCAGGACTTTGGGGGGCCAAGG + Intronic
1008926961 6:56897405-56897427 ACCAGGAGGTGGAGGTTGCAGGG - Intronic
1010045093 6:71432446-71432468 CCCAGCACGTTGAGAGGCCAAGG - Intergenic
1010403759 6:75478940-75478962 ATCATGAGGGTGAGGGACCAAGG - Intronic
1011587488 6:88942444-88942466 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1011606453 6:89110863-89110885 ACCAGCAGTTTGGGAGGCCAAGG + Intronic
1012393629 6:98770929-98770951 CCCAGGAGGTTGAGGCTGCATGG + Intergenic
1012446561 6:99313040-99313062 CCCAGCACGTTGTGGGGCCAAGG + Intronic
1012549185 6:100452287-100452309 ACCAGGTGGTATAGGTGCCATGG - Intronic
1013523908 6:110957326-110957348 CCCAGGAGTTTGAGGGTACAGGG + Intergenic
1013606252 6:111751695-111751717 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1013787871 6:113802536-113802558 CCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1014034311 6:116747320-116747342 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1014203225 6:118626947-118626969 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1014901464 6:126970631-126970653 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
1015348882 6:132193634-132193656 CCCAGGACTTTGTGGGGCCAAGG + Intergenic
1016026711 6:139294737-139294759 ACCAGCACGTTGGGAGGCCAAGG + Intergenic
1016515839 6:144892523-144892545 ATGAGGAAGTTGAGGGCCCAAGG - Intergenic
1017082181 6:150680589-150680611 ACCAGGATTCTAAGGGGCCATGG + Intronic
1018074145 6:160195554-160195576 ACCAGGACTTTGGGAGGCCAAGG - Intronic
1018379159 6:163241790-163241812 ACCAGGTGAATGAGAGGCCATGG + Intronic
1018632749 6:165834922-165834944 ACCAGCAGGGTTAGGAGCCAGGG + Intronic
1018772274 6:166981815-166981837 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1019187287 6:170228180-170228202 AGCAGGAGAGTGAGGAGCCAAGG + Intergenic
1019362953 7:614999-615021 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1019783132 7:2956411-2956433 GCCAGGAGGTTGAGGCTGCAGGG + Intronic
1020167592 7:5820292-5820314 CCCAGGACTTTGAGAGGCCAAGG - Intergenic
1020192096 7:6008497-6008519 TCCAGCACTTTGAGGGGCCAAGG + Intronic
1020228919 7:6301921-6301943 CCCAGGAGATTGAGGGCGCAGGG + Intergenic
1020330638 7:7013623-7013645 CCCAGGAGGTCGAGGGGTCGGGG - Intergenic
1020946177 7:14610685-14610707 ACTAGTAGGTTCAGGTGCCAGGG - Intronic
1021199098 7:17707445-17707467 CCCAGCATGTTGAGAGGCCAAGG - Intergenic
1021981419 7:26059222-26059244 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1022485450 7:30774069-30774091 ACCACAAGGGTGAGTGGCCATGG - Intronic
1022657930 7:32337841-32337863 AGCAGGAGCATGAGGAGCCACGG + Intergenic
1023077069 7:36494919-36494941 TCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1023959066 7:44911966-44911988 CCAAGGAGGTTCAGGGGTCAGGG + Intergenic
1024008863 7:45251115-45251137 ACCAGCAGTTTGGGAGGCCAAGG + Intergenic
1024182085 7:46906728-46906750 CCCAGGAGGTGGAGGTGGCAGGG + Intergenic
1024712495 7:52032520-52032542 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1025100336 7:56129439-56129461 ACCAGGAGGTGGAGGAGTGAGGG + Intergenic
1025741602 7:64202022-64202044 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1026020528 7:66701421-66701443 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1026196523 7:68178209-68178231 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1026347535 7:69487475-69487497 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1026879747 7:73900938-73900960 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG + Intergenic
1027859378 7:83556507-83556529 ACCTAGACATTGAGGGGCCAGGG + Intronic
1027872143 7:83720789-83720811 ACCAGCACTTTGGGGGGCCAAGG + Intergenic
1028149471 7:87355348-87355370 ACCAGCACGTTGGGAGGCCAAGG - Intronic
1028794274 7:94886269-94886291 CCCAGGAGGTTGAGGCTTCAGGG + Intergenic
1029167590 7:98604415-98604437 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1029553174 7:101249283-101249305 CCCAGGACTTTGAGAGGCCAAGG - Intronic
1029859353 7:103552748-103552770 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1030257627 7:107528788-107528810 ACCTGGAGGTTCAGGGACCCTGG - Intronic
1031508659 7:122620980-122621002 CCCAGGAGGTTGAGGGTACATGG - Intronic
1031712409 7:125065609-125065631 ACCAGGAGGGGGAGAGGCAATGG - Intergenic
1032031299 7:128486041-128486063 CCCAGCAGTTTGAGAGGCCAAGG + Intronic
1032235183 7:130115463-130115485 CCCAGGATGTTGGGAGGCCAAGG + Intronic
1032346583 7:131121951-131121973 ACCAGGAGACTACGGGGCCAAGG + Intronic
1032533767 7:132643698-132643720 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1032626136 7:133592995-133593017 CCCAGGATGTTGGGAGGCCAAGG - Intronic
1032633329 7:133678684-133678706 CCCAGGAGGTTGAGGATACAGGG - Intronic
1032655888 7:133929179-133929201 ACCAGCACGTTGGGAGGCCAAGG - Intronic
1032790017 7:135235690-135235712 CCCAGCATGTTGGGGGGCCAAGG - Intronic
1033061969 7:138118450-138118472 ACCAGCAATTTGAGAGGCCAAGG + Intergenic
1033442771 7:141395363-141395385 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1033786256 7:144734595-144734617 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1033856667 7:145570118-145570140 ACCAGGGTGTTCAAGGGCCATGG + Intergenic
1034290130 7:149924123-149924145 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1034359393 7:150480778-150480800 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1034595388 7:152185005-152185027 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1034660939 7:152768724-152768746 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1034703970 7:153123791-153123813 ACCAGGAGGTGGAGGTTGCAGGG - Intergenic
1036049775 8:5183554-5183576 CCCAGGAGTTTGAGAGGCCAAGG - Intergenic
1036559679 8:9890945-9890967 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1036722167 8:11186450-11186472 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1037118622 8:15256164-15256186 CCCAGGAGGTTGAGGATACAGGG + Intergenic
1037308577 8:17530820-17530842 ACCAGCACTTTGGGGGGCCAAGG - Intronic
1037583596 8:20261451-20261473 ACCAGGACGGGGAGGGGCCCGGG + Intronic
1037679190 8:21079974-21079996 ACCAGCAGTTTGGGAGGCCAAGG + Intergenic
1037953536 8:23035390-23035412 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1038049531 8:23795833-23795855 CCCAGCATGTTGAGAGGCCAAGG + Intergenic
1038213637 8:25542024-25542046 CCCAGGAGTTTGAGGATCCAGGG - Intergenic
1038218545 8:25585671-25585693 CTCAGGGGCTTGAGGGGCCAGGG - Intergenic
1038630633 8:29239911-29239933 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1039315177 8:36363905-36363927 CCCAGCATGTTGAGAGGCCAAGG + Intergenic
1039480453 8:37869339-37869361 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1039867219 8:41516092-41516114 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1039938085 8:42065395-42065417 CCCAGAACTTTGAGGGGCCAAGG - Intergenic
1040067858 8:43162933-43162955 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1041721662 8:60981735-60981757 AACAGCAGCTTGAGCGGCCAGGG + Intergenic
1041918682 8:63160554-63160576 CCCAGCACGTTGAGAGGCCAAGG - Intergenic
1042051339 8:64711441-64711463 ACAAAGAGGGTGAGGTGCCAAGG + Intronic
1042126800 8:65546137-65546159 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
1042371488 8:67996442-67996464 AGCAGCACTTTGAGGGGCCAAGG - Intronic
1042827776 8:72995735-72995757 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1043075463 8:75693336-75693358 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1043441505 8:80280618-80280640 ACCAGCAGGTTGGGAGGCCAAGG - Intergenic
1044488922 8:92788934-92788956 TCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1044563989 8:93643449-93643471 CCCAGCATGTTGGGGGGCCAAGG - Intergenic
1044693668 8:94902166-94902188 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1044931527 8:97256681-97256703 GCCAGGAGTTAGAGGGGGCAGGG + Intergenic
1045865979 8:106866058-106866080 CCCAGCACGTTGAGAGGCCAAGG + Intergenic
1046706015 8:117452492-117452514 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1047000747 8:120570101-120570123 ACCAGGGGGTTGAAGTCCCAGGG + Intronic
1047921346 8:129637848-129637870 ACCAGGAGATTGTGGGCCTAGGG + Intergenic
1047980229 8:130173513-130173535 ACCAGCACTTTGGGGGGCCAAGG + Intronic
1048018052 8:130514865-130514887 ACCAGAAGCTTGAAGGGGCAAGG - Intergenic
1048275536 8:133062999-133063021 ACAAGGAGGCTGAGGAACCAAGG - Intronic
1049021103 8:139958188-139958210 ACCTGGAAGCTCAGGGGCCAAGG - Intronic
1049027198 8:140001237-140001259 ACCAGGGGGGTGAGGGGCTGCGG + Intronic
1049841113 8:144772788-144772810 ACCAGCATTTTGAGAGGCCAAGG - Intergenic
1050295587 9:4201883-4201905 TCCAGGAGTTTGAGAGGCCGAGG + Intronic
1050392488 9:5159922-5159944 CCCAGCAGGTTGGGAGGCCAGGG + Intronic
1050571376 9:6942939-6942961 ACCAGGAGGTTGGGGCTACAAGG - Intronic
1051086438 9:13354748-13354770 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1052023117 9:23546966-23546988 CCCAGGATTTTGAGAGGCCAAGG + Intergenic
1052763336 9:32614976-32614998 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
1053315765 9:37050307-37050329 ACCGGGTGGTTGAGGGGCAGAGG - Intergenic
1053705931 9:40752645-40752667 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
1054416008 9:64876249-64876271 CCCAGGACTTTGAGAGGCCAAGG + Intergenic
1055046731 9:71934091-71934113 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1056127205 9:83546104-83546126 GCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1056236571 9:84600581-84600603 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1056467352 9:86870784-86870806 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1056515727 9:87347452-87347474 CCCAGGAGGTTGAGGTGGGAGGG + Intergenic
1056743942 9:89283669-89283691 ACCAGCAGTTTGGGAGGCCAAGG + Intergenic
1056882515 9:90410770-90410792 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1057063158 9:92023803-92023825 ACCAGAAGGTAGAGGAGGCAAGG - Intergenic
1057338227 9:94174443-94174465 ACCTGGAGGTTGAGGGGGTGAGG + Intergenic
1058103757 9:100946564-100946586 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1058494609 9:105542704-105542726 CCCAGGATTTTGGGGGGCCAAGG - Intronic
1058508357 9:105689469-105689491 CCCAGGACTTTGAGAGGCCAAGG - Intergenic
1058841218 9:108911408-108911430 ACCTGGAGTTTCAGGTGCCAGGG + Intronic
1058981351 9:110173580-110173602 ACCAGGAAGAGGAGGGGCCGAGG - Intergenic
1059452327 9:114378139-114378161 AGGGGGAGCTTGAGGGGCCATGG - Intronic
1059677819 9:116556415-116556437 ACCAGGAGTTTGAGCAGCCTGGG + Intronic
1060163325 9:121387373-121387395 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1060423592 9:123486760-123486782 CCCAGAAGGTTGGGGGACCATGG - Intronic
1060513778 9:124252994-124253016 CCCAGCACGTTGAGAGGCCAGGG - Intergenic
1060618172 9:125038004-125038026 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1060869825 9:127030601-127030623 AGCAGGAGCTGGAGGGGACAGGG + Intronic
1060885563 9:127149711-127149733 GCCAGGAGGTTGAAGGAGCAGGG + Intronic
1060899727 9:127246553-127246575 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1061004334 9:127920027-127920049 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
1061178712 9:129011913-129011935 AGCAGGAGGTGGAGGGGCCCTGG + Intronic
1061245818 9:129400900-129400922 ACCGGGAGGCTGAGGGACCCAGG - Intergenic
1061522083 9:131124701-131124723 CCCAGGAGGTTGAGGCTACAGGG - Intergenic
1061524174 9:131144527-131144549 AAGAGAAGGTTGATGGGCCAGGG - Exonic
1061558021 9:131383992-131384014 CCCAGGAGGCAGAGGGTCCAAGG - Intergenic
1061747386 9:132750367-132750389 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1061952786 9:133945604-133945626 ACCAGGAAGGTCAGGGGCCCGGG + Intronic
1062037527 9:134389388-134389410 CCCAGGGGGTTAGGGGGCCAGGG + Intronic
1062043716 9:134415667-134415689 ACCAGGAGGAGAAGGGGCCTGGG + Intronic
1062639960 9:137514114-137514136 ACCCGGATGTTGAGGTGCCCGGG + Intronic
1062640038 9:137514359-137514381 ACCCGGATGTTGAGGTGCCTGGG + Intronic
1062640094 9:137514544-137514566 ACCCGGATGTTGAGGTGCCCGGG + Intronic
1062640129 9:137514642-137514664 ACCCGGATGTTGAGGTGCCTGGG + Intronic
1062640188 9:137514838-137514860 ACCTGGATGTTGAGGTGCCTGGG + Intronic
1203523149 Un_GL000213v1:63211-63233 TCCAGGATGTTGAGAGGCCGAGG + Intergenic
1185939862 X:4304452-4304474 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1186100038 X:6146037-6146059 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1186195683 X:7108530-7108552 ATCAGGAGGTGGAGAAGCCAGGG - Intronic
1186359456 X:8824627-8824649 TCCAGGAAGTCAAGGGGCCAGGG - Intergenic
1186966275 X:14789363-14789385 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1187085123 X:16034660-16034682 CCCAGGAGGTTGAGGCTACAGGG - Intergenic
1187198466 X:17110936-17110958 CCCAGGAGGTTGAGGTTGCAGGG + Intronic
1189224541 X:39401694-39401716 ACTATGAGGTAGAGGAGCCAAGG + Intergenic
1189298387 X:39935196-39935218 CCCAGGACTTTGAGAGGCCAAGG - Intergenic
1189365499 X:40384807-40384829 ACCAGGAGCTGGAGGAGGCAAGG - Intergenic
1189471312 X:41316302-41316324 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1189476790 X:41362337-41362359 CCCAGCACTTTGAGGGGCCAAGG - Intronic
1189507096 X:41623000-41623022 ACCAGGAGGGTAGGGAGCCAGGG - Intronic
1190280816 X:48928574-48928596 ACCAGCACTTTGAGAGGCCAAGG + Intronic
1190371113 X:49741790-49741812 ACCAGGAGGTTGATGCTGCAGGG - Intergenic
1190714344 X:53091309-53091331 ACCAGGAGGATGAAGAGTCATGG + Intergenic
1190770754 X:53512235-53512257 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1192064218 X:67864198-67864220 ACCAGGAGGCACAGGGGTCAGGG + Intergenic
1192192073 X:68996950-68996972 ACCAGCAGTTTGGGAGGCCAAGG + Intergenic
1194276936 X:91896824-91896846 ACCAGGAGATTGGGGAGCCATGG - Intronic
1194404470 X:93477725-93477747 GCCAGCAGTTTGAGAGGCCAAGG + Intergenic
1195051898 X:101104608-101104630 CCCAGCACTTTGAGGGGCCAAGG + Intronic
1195255540 X:103086060-103086082 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1195261661 X:103138030-103138052 CCCAGCACGTTGAGAGGCCAAGG - Intergenic
1195429954 X:104777830-104777852 ACCAGTAAGTTGGGAGGCCAAGG - Intronic
1196082465 X:111648317-111648339 CCCAGGACTTTGAGAGGCCAAGG - Intergenic
1196167627 X:112552712-112552734 CCCACGAGGTTGAGTAGCCAGGG - Intergenic
1196819052 X:119688456-119688478 CCCAGGACTTTGAGAGGCCAAGG + Intronic
1197341925 X:125285551-125285573 CCCAGCAGTTTGAGAGGCCAAGG - Intergenic
1197714475 X:129696559-129696581 ACCAGGAGCTGGAAGGGGCAAGG - Intergenic
1197799886 X:130338178-130338200 CCCAGCACTTTGAGGGGCCAAGG + Intergenic
1198101888 X:133429238-133429260 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1198257836 X:134940410-134940432 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1198525024 X:137492271-137492293 ACCAGCACTTTGAGAGGCCAAGG - Intergenic
1199142581 X:144331156-144331178 ACCAGCAGGTTGTGGGGCTCTGG + Intergenic
1199346311 X:146745459-146745481 ACCAGGAGGCTGAGGCTGCAAGG + Intergenic
1199433468 X:147786483-147786505 ACCAGCACTTTGGGGGGCCAAGG - Intergenic
1199982920 X:152930716-152930738 ACCAGGAAGGTGTGTGGCCAGGG + Intronic
1200209254 X:154339131-154339153 ACCAGCACTTTGAGAGGCCAAGG + Intergenic
1200221622 X:154392998-154393020 ACCAGCACTTTGAGAGGCCAAGG - Intronic
1200256970 X:154587766-154587788 CCCAGGAGGTGGAGGGTGCAGGG + Intergenic
1200260799 X:154616636-154616658 CCCAGGAGGTGGAGGGTGCAGGG - Intergenic
1200594283 Y:5118923-5118945 ACCAGGAGATTGGGGAGCCATGG - Intronic
1200616593 Y:5387274-5387296 CCCAGCAGTTTGAGAGGCCAAGG - Intronic
1200792501 Y:7312292-7312314 CCCAGCACTTTGAGGGGCCAAGG - Intergenic
1200948318 Y:8867637-8867659 ACCAGGTGCTTGAGGGAACAGGG - Intergenic
1201298724 Y:12487916-12487938 ACCAGGATTTTGAGAGACCAAGG + Intergenic
1201674915 Y:16570526-16570548 ACCAGCAGTTTGGGGGGCCGAGG + Intergenic