ID: 1172875204

View in Genome Browser
Species Human (GRCh38)
Location 20:38160011-38160033
Sequence TGTTAGCAAGAGAACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172875204 Original CRISPR TGTTAGCAAGAGAACTTTGG GGG Intronic
901407097 1:9056621-9056643 AGTTAGAAAGAGAATTTTAGAGG - Intronic
905994138 1:42366359-42366381 TGTTAGCATGTGAATTCTGGGGG - Intergenic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909819177 1:80038229-80038251 TGCTAGCAAAAATACTTTGGAGG - Intergenic
912253008 1:108030554-108030576 TCTTAGAAAGAGAACCTTGAAGG + Intergenic
912455546 1:109794422-109794444 TCTTAGCAACAGGACTTTGAGGG + Intergenic
914394602 1:147253019-147253041 TTTTAGCAAAACAAATTTGGAGG - Intronic
915890756 1:159771565-159771587 TGTTAGGAAAAGAACCTTTGAGG - Intergenic
916964485 1:169921863-169921885 TGCTAGGAAGAGAATCTTGGTGG - Intronic
917993405 1:180408151-180408173 TGTAAGCAACTGAAATTTGGGGG + Intronic
918348254 1:183625873-183625895 TGAAAGAAAGAGAATTTTGGAGG + Intronic
918372212 1:183871862-183871884 TCTTAGCCAGATAACTTTAGAGG - Intronic
918871482 1:189980598-189980620 TGTTTGAAAGACAACTTTGCTGG + Intergenic
918962862 1:191303051-191303073 TGTCAGCAAAAGCACTCTGGTGG + Intergenic
919483401 1:198117129-198117151 TTTTAGCAAGAAATCTTTGTTGG - Intergenic
920765853 1:208833068-208833090 TATTAGCAAGAGAGCCTAGGAGG + Intergenic
921588324 1:216974541-216974563 TTTTACCCTGAGAACTTTGGAGG - Intronic
923135081 1:231110289-231110311 TGTTAGCATATGAATTTTGGAGG - Intergenic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
924543874 1:245007028-245007050 TGTTAGAATGAGAAATTTGGAGG + Intronic
1062992040 10:1828468-1828490 TGGTGGTAAGAAAACTTTGGGGG + Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1067976543 10:51032305-51032327 AGTTGCCAAGAGACCTTTGGGGG - Intronic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1078033628 11:7780315-7780337 TGTTAGCCAGAGAATATGGGTGG - Intergenic
1078722631 11:13898290-13898312 TGTTTCCCAGAGAACTTAGGAGG - Intergenic
1080717073 11:34813610-34813632 TATTTGAAAGAGAACTTTGCTGG - Intergenic
1081666919 11:44922083-44922105 TTTAAGCAAGAGGGCTTTGGAGG - Intronic
1085061338 11:73449822-73449844 TGGTAGACAGAGACCTTTGGAGG + Intronic
1085141377 11:74145810-74145832 TATTAGAAAGAAAAATTTGGGGG - Intronic
1085150391 11:74248097-74248119 TGTTAGCTAGATAACAGTGGAGG + Intronic
1085331113 11:75652120-75652142 TTTTAGCAATAAAATTTTGGTGG + Intronic
1085439509 11:76545829-76545851 TGTTACAAAGATAACTTTTGAGG + Exonic
1087646861 11:100818161-100818183 GGTGAACAAGATAACTTTGGAGG - Intronic
1087676210 11:101164963-101164985 TATTAGAAAGATAACTTTGCTGG + Intergenic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1089804785 11:121075506-121075528 TGTCTGCAAGAAAACTTTGCTGG + Intronic
1090430447 11:126641852-126641874 TGTAAGCAAGGGGACTGTGGTGG - Intronic
1091203365 11:133800078-133800100 TGTGAGCAAGAGGACCATGGAGG + Intergenic
1093416569 12:18927332-18927354 AGTTATCAAGACAACTTTGTGGG - Intergenic
1094168518 12:27466654-27466676 AGTTAGCAAGAGAAGTGAGGAGG + Intergenic
1095835804 12:46637752-46637774 TGTTAGCCAGAGAACACTGGTGG - Intergenic
1096536926 12:52280863-52280885 TGTCAACAAGGGAACTTTGTGGG + Intronic
1097582977 12:61481158-61481180 TGTTGGCTAGAGAACACTGGTGG - Intergenic
1097914917 12:65010932-65010954 TGTTGGCAATTAAACTTTGGAGG + Intergenic
1098253481 12:68592703-68592725 TGTGTGCAAGAGAAATTTTGGGG - Intergenic
1098441940 12:70528376-70528398 AGTCAGCAAGGGAACTTTGATGG + Intronic
1105808805 13:23975599-23975621 TTTTAGAAAGAGAAGGTTGGAGG - Intergenic
1108996296 13:56738079-56738101 TGTTAGCAATACTACTTAGGTGG - Intergenic
1109306272 13:60645496-60645518 TTCTAGCATGTGAACTTTGGGGG + Intergenic
1109440126 13:62358569-62358591 TGTTAGAAGGAGAATTTTGCTGG - Intergenic
1111988030 13:95085080-95085102 TGTAAGACAGTGAACTTTGGAGG - Intronic
1112946758 13:104937768-104937790 TATTAGCAAGAAAACTATGTAGG + Intergenic
1112958731 13:105094384-105094406 TGTTAGATAGGGAACATTGGAGG - Intergenic
1115015908 14:28613859-28613881 TGTTTACAAAAGAACTTTTGTGG + Intergenic
1115653288 14:35419238-35419260 TGTTAGCAAGAGTGCTAAGGAGG + Intergenic
1115788160 14:36849277-36849299 TGATACGAAGAGGACTTTGGGGG + Intronic
1115967840 14:38912058-38912080 TGTCAGCCAGAGAACACTGGTGG - Intergenic
1116619847 14:47187092-47187114 TGTAAGAAAGAGAAATTAGGTGG + Intronic
1120067027 14:80054511-80054533 TTTTAGGAAGAGGACTTTGTGGG + Intergenic
1121358461 14:93233913-93233935 TGTTTGGAAGAGCAGTTTGGCGG - Intergenic
1121749948 14:96343678-96343700 TGTTACCAAGAGATGTTTTGTGG - Intronic
1124791629 15:32732427-32732449 TTTTAGCAAGAGATATTTTGGGG + Exonic
1125033506 15:35096750-35096772 TGCTAACAAGGGAACTTTGCAGG + Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1125299375 15:38238181-38238203 TGGTGGCATGAGAAGTTTGGAGG + Intergenic
1130842972 15:87719047-87719069 TAAAAGAAAGAGAACTTTGGGGG + Intergenic
1130852162 15:87805376-87805398 AGGGAGCAAGAGAACCTTGGTGG + Intergenic
1131431068 15:92389514-92389536 TATCAGCAAGAGATCTTGGGAGG - Intergenic
1132067889 15:98747607-98747629 TGTGAGCATGAGAACTGTGTCGG + Intronic
1134382134 16:13737695-13737717 TGTTAGCAAGAGCAGTTTCATGG - Intergenic
1134630309 16:15751497-15751519 TGGTAGAAAAAGAACCTTGGAGG - Intronic
1134909137 16:18008398-18008420 TGCTACCCAAAGAACTTTGGAGG - Intergenic
1135109417 16:19679117-19679139 TGTTAGCAAAAGAAGGCTGGGGG + Intronic
1140037595 16:71383059-71383081 TGATAGCCAGAGGAATTTGGAGG - Intronic
1140233435 16:73137407-73137429 TGCTGGCATGAGAACTCTGGGGG - Intronic
1140870019 16:79097688-79097710 TGTTTCCAAAAGATCTTTGGAGG + Intronic
1145984938 17:29039412-29039434 TCTTATCAAGAGAAATCTGGGGG + Intronic
1147026306 17:37587684-37587706 CGTTACCAAGAGCAGTTTGGGGG - Intronic
1150048069 17:61932766-61932788 TCTTAGCAAGGGAACACTGGAGG - Intergenic
1152336040 17:79700677-79700699 TGTTTGCAGGTGAACTTTGGAGG - Intergenic
1155112873 18:22734085-22734107 TATAAGCAAGACAAGTTTGGGGG + Intergenic
1155767373 18:29652630-29652652 TCAGAGCAAGTGAACTTTGGGGG + Intergenic
1155888294 18:31235563-31235585 CTTTAGCAAGAGAACTCTTGGGG + Intergenic
1157329538 18:46693230-46693252 TGTTCCCAAGAGAACTATGCAGG - Intronic
1159654436 18:71014909-71014931 AGGTAGCAAGAGAACTTTGGAGG - Intergenic
1159981557 18:74787298-74787320 TCCCAGCAAGATAACTTTGGTGG - Intronic
1162039619 19:7962387-7962409 AGTTATGAAGAGAACTTTGAGGG + Exonic
1164594170 19:29522873-29522895 TGTCAGCATGATAACTCTGGAGG + Intergenic
1165284694 19:34832281-34832303 TGTTAGAAAGGGAAGTTTTGGGG + Intergenic
1167024922 19:46908773-46908795 TGGAAGCATGAGAACTGTGGCGG + Intergenic
1167033848 19:46981449-46981471 TGCTAGAAAGGAAACTTTGGAGG + Intronic
926787060 2:16528463-16528485 TGGTAGCAAGAGAAGTTCCGGGG - Intergenic
927059637 2:19404277-19404299 TGTTAGAAACAGATATTTGGTGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935745071 2:106183189-106183211 TATCAGCAACAGAACATTGGTGG - Intronic
935997106 2:108786627-108786649 TGCTAGCACGAGAAACTTGGAGG + Intergenic
936233357 2:110723771-110723793 TGTTACCAATAGAACTTTGGAGG - Intergenic
936702879 2:115034925-115034947 TTTTAGCAAGATAACTCTGTAGG - Intronic
939186109 2:138862659-138862681 TGCTAGGAAGAGAACTATAGTGG - Intergenic
940212602 2:151271036-151271058 TTTTAGAAAGAGAACTCTGGTGG + Intronic
940255321 2:151722469-151722491 TGATAGCAAGAGCTCTTTGTGGG + Intronic
940484598 2:154281567-154281589 TGTTGGCATGAGTATTTTGGGGG + Intronic
942930844 2:181490572-181490594 TATTAGGAAGGGAAATTTGGGGG + Intronic
943850291 2:192711933-192711955 TGTTAACAAAATAATTTTGGTGG + Intergenic
945045702 2:205779996-205780018 TGTCATCAAGAGAAATTTCGTGG - Intronic
947609239 2:231513096-231513118 TGTTTGCAATAGCACTTTTGAGG + Intergenic
948030004 2:234809654-234809676 TGTGAGAAAGAGAAAGTTGGGGG - Intergenic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
948900589 2:240954961-240954983 TGTTTGCAAGCAATCTTTGGAGG - Intronic
1170005677 20:11666568-11666590 TGTAAGCAAGAGAATTTGGCTGG + Intergenic
1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG + Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1172964272 20:38822934-38822956 TGTTAGCAATACCACTTTCGTGG + Intronic
1175240398 20:57543371-57543393 TATTAGCATGAAAACCTTGGGGG + Intergenic
1175774949 20:61647255-61647277 TGTCTGCAAGGGGACTTTGGTGG - Intronic
1181467448 22:23117835-23117857 TGTCACCAGGAGAACCTTGGTGG + Intronic
1182715157 22:32352473-32352495 TGTTATTAACAGAAGTTTGGGGG - Intergenic
1184316198 22:43691889-43691911 TGCTAACAGGAGAACTGTGGGGG + Intronic
1184874339 22:47263653-47263675 GGTTAGCCAGGGGACTTTGGTGG + Intergenic
949182212 3:1145925-1145947 TTTTAGGAAGAAAATTTTGGTGG + Intronic
949284437 3:2384351-2384373 TGGTAAGATGAGAACTTTGGTGG - Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
950729222 3:14942255-14942277 TGCTAGCCAGGCAACTTTGGAGG + Intergenic
952348081 3:32507379-32507401 TGGCACCAAGAGAACCTTGGAGG + Intergenic
952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG + Intronic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
957787773 3:84904164-84904186 TGTTAATAATAGAAGTTTGGAGG - Intergenic
958590648 3:96154529-96154551 TGTCAGCCAAAGAACATTGGTGG - Intergenic
958664768 3:97122559-97122581 TGATACCAAGAGAACTTTATTGG - Intronic
959051838 3:101531732-101531754 TGTTTACAAGGAAACTTTGGTGG + Intergenic
959794695 3:110411758-110411780 TTTAAGCAAGAGAAGTTTGTAGG - Intergenic
959878404 3:111413986-111414008 TTTTAGTAACAGAACTTTAGAGG - Intronic
962338692 3:134562650-134562672 GGTTAGGAAGAGAACTACGGTGG - Exonic
962586486 3:136847405-136847427 TGCAACCAAGAGAATTTTGGTGG + Intronic
963056965 3:141193835-141193857 TGTTGGCCAGAGAACACTGGTGG - Intergenic
963396084 3:144736197-144736219 TGTTGCTTAGAGAACTTTGGTGG + Intergenic
965124520 3:164608333-164608355 TTTTAGCAAAAGAAGTTTGCTGG - Intergenic
965170293 3:165254215-165254237 TGTTAGCAATAAAAATTTGGGGG - Intergenic
965664801 3:171081836-171081858 TATAAGCAAGAGAATTTTTGAGG + Intronic
967352571 3:188530212-188530234 TGTTAGAAAGAGAAATTTACAGG + Intronic
967556158 3:190861660-190861682 TAATGGCAAGATAACTTTGGAGG - Intronic
967698412 3:192562835-192562857 TGTTTGCAAGAGAAGCTTAGTGG - Intronic
973154202 4:46928671-46928693 TGTTGGCAACAGAACTGAGGTGG - Exonic
973949083 4:55992582-55992604 TTTTAGGAAGCTAACTTTGGTGG + Intronic
975264464 4:72345688-72345710 TGTTAGAATTAGAACTTTTGGGG - Intronic
975415981 4:74105010-74105032 TTTTAGCAAAATAACTTTTGTGG + Intergenic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
977602679 4:98951069-98951091 TTTTAGCAAGGGAGGTTTGGAGG - Intergenic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
979349753 4:119629357-119629379 TGCTAGCAAGAGAGATTTGCAGG + Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980274921 4:130637908-130637930 TGCCAGGAAGAGAAATTTGGAGG + Intergenic
983494163 4:168424649-168424671 TGTGAGCAGGAGAAGTTGGGAGG + Intronic
986953713 5:13124066-13124088 TGTAAGCAAGAGTAATTTTGTGG - Intergenic
987681330 5:21139801-21139823 GATTAGTAAAAGAACTTTGGTGG + Intergenic
988128391 5:27073080-27073102 TGTTAGCTAGAGACCTTGGTGGG - Intronic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
988923856 5:35969490-35969512 TGTTATCAGGTGTACTTTGGTGG - Intronic
989810412 5:45666008-45666030 TGTCAAGAAGAGAACTTGGGGGG - Intronic
991973603 5:72164392-72164414 TTTTAGCATCAGAATTTTGGGGG + Intronic
992140459 5:73791463-73791485 TGTTAACAAGACAACACTGGTGG + Intronic
992881771 5:81117547-81117569 TTTTAACATGGGAACTTTGGGGG + Intronic
994156149 5:96506423-96506445 TATTAGCAAGAGGAAGTTGGAGG + Intergenic
995624686 5:114063503-114063525 TGTTAGAAATGGAAATTTGGAGG - Intergenic
997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG + Intergenic
997563801 5:134871824-134871846 AGATAGCAAGACAAATTTGGCGG + Intergenic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
999834351 5:155353004-155353026 TGCTAGCAAAAGTGCTTTGGTGG - Intergenic
1000803818 5:165762744-165762766 TGTCAGCATGAGTACTTTTGTGG - Intergenic
1003480865 6:6531738-6531760 TTTTAGCCAGAGAACTTGGTTGG + Intergenic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1007959366 6:45945011-45945033 TGTAAGCAAAAGATCTCTGGAGG + Intronic
1008559599 6:52710882-52710904 TGTTGGCAAGAGTTCTTTGCAGG - Intergenic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1011675465 6:89728990-89729012 TGTTGGCAAGACAAGTTTGGTGG - Exonic
1012616369 6:101283797-101283819 TGTCAGCTAGAGAACACTGGTGG - Intergenic
1015566826 6:134581430-134581452 TCTTAGCAAGAGGAATTTAGTGG + Intergenic
1015611724 6:135028813-135028835 TGCTAGCAAGAGATTTTTGAAGG - Intronic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1021778114 7:24073677-24073699 TTTTAGCAAAAGTGCTTTGGAGG + Intergenic
1022589641 7:31649530-31649552 TGTTAACAAGAATACTTTAGAGG - Intronic
1023785614 7:43705228-43705250 TGCCAGCAAAAGAACTCTGGTGG + Intronic
1026963425 7:74424337-74424359 TATGAGCAGGTGAACTTTGGGGG + Intergenic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1029048447 7:97657151-97657173 TGTTAGAAAGAGGACTTTTATGG + Intergenic
1032354234 7:131195007-131195029 TTTTTGCGAGATAACTTTGGAGG - Intronic
1032978661 7:137255250-137255272 TGGAAGCAAAAGAACTTTGAAGG + Intronic
1033116214 7:138627980-138628002 TGTTGGCAAGAGAGGTCTGGAGG - Intronic
1033516439 7:142111291-142111313 TTATACCAAGAGAACTCTGGAGG + Intergenic
1033965690 7:146972691-146972713 AGTTATAAAGAGAAGTTTGGAGG + Intronic
1034928443 7:155141634-155141656 TGTTAGCAATAGCACTTTGAAGG + Intergenic
1036625954 8:10471704-10471726 TGTTAACACAAGAACTGTGGGGG - Intergenic
1038541946 8:28397225-28397247 GGTGATCAAGTGAACTTTGGGGG - Intronic
1038589864 8:28826919-28826941 TGTCAGCAAAAGGACTTTGTGGG - Intronic
1040554138 8:48464309-48464331 TGTAAGTAAGAGAACATTGAAGG - Intergenic
1043310188 8:78849494-78849516 TTCTAACAAGTGAACTTTGGGGG - Intergenic
1043627602 8:82282133-82282155 TTTCAGCACAAGAACTTTGGGGG + Intergenic
1044125796 8:88457049-88457071 TGTTGGCTAGAGAGCTTGGGTGG - Intergenic
1044303019 8:90607330-90607352 TGTAAGCATGAGCAATTTGGAGG - Intergenic
1045257254 8:100536813-100536835 TGTTAAAAGCAGAACTTTGGGGG + Intronic
1048044411 8:130759594-130759616 TGTTGGCCAGAGAGCTTTGAAGG + Intergenic
1048054602 8:130851553-130851575 TGTTTGAAAGACAACTGTGGTGG + Intronic
1049445803 8:142630942-142630964 TGTTTGCAGGTGAACTTTGCCGG + Intergenic
1050043162 9:1516574-1516596 TGATAGCAAGATAAATATGGAGG + Intergenic
1051008625 9:12381678-12381700 TTTTAGCAAGAGTACTTTATAGG + Intergenic
1053382787 9:37662347-37662369 TTTTAGCACATGAACTTTGGGGG + Intronic
1055208578 9:73762564-73762586 TGTTAGCTGGAGAACACTGGCGG - Intergenic
1055224886 9:73984197-73984219 TGTTGGCCAGAGAACACTGGTGG - Intergenic
1055383875 9:75740054-75740076 AGTTAGCAAGGCAACTTGGGAGG + Intergenic
1055549339 9:77416462-77416484 TGGTATCAAGAGAACTTTGGTGG + Exonic
1056112634 9:83410823-83410845 TTTTAGAAAGAGAATTTAGGAGG - Intronic
1056907563 9:90666506-90666528 TGTTGGCCAGAGAACACTGGTGG + Intergenic
1059134897 9:111795422-111795444 TGGTAGCAGAAGAACTTTTGAGG + Intergenic
1059934686 9:119297908-119297930 TGTCAGCAAGAGAAAAATGGAGG - Intronic
1059942973 9:119375994-119376016 TGTTAGAAAGAGGAGTTAGGAGG - Intergenic
1060905212 9:127298795-127298817 TGTTAGCAAGTCGACTCTGGAGG - Intronic
1061876882 9:133548501-133548523 TGTGTGCAAGAGAGCTTGGGGGG + Intronic
1189616559 X:42789837-42789859 TGTTAACAGGAGAACCTAGGGGG + Intergenic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1192920726 X:75703126-75703148 TGTCAGCAAGAGAACATTGAAGG - Intergenic
1193712332 X:84894580-84894602 TGTTGGCCAGAAAACATTGGTGG + Intergenic
1193979904 X:88169216-88169238 TGCCAGCAAAAGAACTATGGTGG + Intergenic
1194067837 X:89284227-89284249 TGTCAGCCAGAGAACACTGGGGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1196726420 X:118900003-118900025 CTTTAGCAAGAGACATTTGGGGG - Intergenic
1196983411 X:121240619-121240641 TGATTGCATGAGAACTCTGGTGG - Intergenic
1197122152 X:122905918-122905940 TGTTTGCCAGAGAACACTGGTGG - Intergenic
1197377921 X:125705191-125705213 TGTAGGCAAGTGAACTCTGGTGG + Intergenic
1197700151 X:129593618-129593640 TGTTAGGGAGAGAACCTTAGTGG + Intergenic
1198443495 X:136688082-136688104 AGATAGCAAGAGAATTTTGGGGG + Intronic
1200721981 Y:6618387-6618409 TGTCAGCCAGAGAACACTGGCGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic