ID: 1172876338

View in Genome Browser
Species Human (GRCh38)
Location 20:38166530-38166552
Sequence CCGTGGGCCTCTGTCTCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172876338_1172876349 19 Left 1172876338 20:38166530-38166552 CCCGGAGAGACAGAGGCCCACGG 0: 1
1: 0
2: 0
3: 30
4: 265
Right 1172876349 20:38166572-38166594 CCAAAACAAGCTCTACATTCCGG 0: 1
1: 0
2: 2
3: 3
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172876338 Original CRISPR CCGTGGGCCTCTGTCTCTCC GGG (reversed) Intronic
900333798 1:2150724-2150746 GCGTGGTCCTCTGAGTCTCCCGG + Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900645839 1:3708351-3708373 CCGTGGGCCAGTCTGTCTCCAGG - Intronic
900906799 1:5565017-5565039 CTGTGGGCCTCAGTCTCACCGGG - Intergenic
901128925 1:6950060-6950082 CTGTGGGCCTTTCTCTCTGCTGG + Intronic
903970150 1:27113587-27113609 CTTTGGGCCTGTGTCTCCCCTGG + Intronic
904500363 1:30909296-30909318 CTCTGGGCCTCGGTCTCCCCAGG + Intergenic
905291853 1:36927152-36927174 ACGAGGGTCTCTGTCTCCCCTGG - Intronic
906720201 1:47998487-47998509 CCTTGTGCTTCTGTCTCTCCTGG - Intergenic
908810186 1:67974250-67974272 CCCTGGATCTCTCTCTCTCCTGG + Intergenic
910499042 1:87867738-87867760 CCGTGTGCCTGTGACTTTCCTGG + Intergenic
913085483 1:115432729-115432751 CGGTGAGCCTCTGTGCCTCCTGG - Intergenic
913109094 1:115641986-115642008 CGGCGGGGCTCTGCCTCTCCAGG + Exonic
914349798 1:146831260-146831282 CCCTGGCCCTCTGTCCCTCCAGG + Intergenic
915111413 1:153566562-153566584 CCTTGGCCCTTTGTCTATCCCGG + Intronic
917189548 1:172400244-172400266 CAGTTGGCCTCTCCCTCTCCTGG + Intronic
919735548 1:200948070-200948092 CCGTGGGTTTCTGACTCTGCAGG + Intergenic
920211689 1:204333117-204333139 CTGGGGGCCTCTGGCTCTCCTGG - Intronic
920786775 1:209050031-209050053 CCTTGGCTCCCTGTCTCTCCTGG - Intergenic
921055427 1:211539107-211539129 GCTTAGCCCTCTGTCTCTCCTGG - Intergenic
1062995622 10:1863584-1863606 CCGTCTTCCTCTGTCTCTTCAGG + Intergenic
1065129324 10:22604710-22604732 CCGGCCGCCTCTGTCACTCCTGG - Intronic
1068385229 10:56317692-56317714 CCCTGGGCCTCTGTCATTGCTGG + Intergenic
1069923334 10:71831058-71831080 CTCTGGGCCACTGCCTCTCCTGG + Intronic
1070556307 10:77530244-77530266 CCTTGTCCCTCTGTCTATCCTGG - Intronic
1071514899 10:86290934-86290956 CCCTGGGCCGCTTCCTCTCCAGG - Intronic
1072158706 10:92746889-92746911 CAGTGAGCCTCTTGCTCTCCTGG + Intergenic
1072745826 10:97938523-97938545 CGCTGGGCCTCTGTGTCTTCAGG + Intronic
1074061228 10:109967665-109967687 CCGAGGGCCTCTTTTTCTCCAGG + Intergenic
1074137209 10:110638069-110638091 CCTTCAGCCACTGTCTCTCCTGG + Intergenic
1075494463 10:122907870-122907892 ACCTGTGCCTCTGTCTCCCCTGG + Intergenic
1075715689 10:124553927-124553949 CAGGGGGGCTCTGTCCCTCCTGG - Intronic
1076268842 10:129132882-129132904 CCCTGGGTCTCAGTTTCTCCTGG + Intergenic
1076387025 10:130064774-130064796 CCGTGAGCCTCTCTTACTCCCGG - Intergenic
1076412776 10:130263866-130263888 CCATGGGCCTCAGTCTCCCAAGG - Intergenic
1076616710 10:131759850-131759872 CCGTGGGCATCTGCCTTCCCTGG + Intergenic
1076618836 10:131774098-131774120 CCCATGGCCTCTGTTTCTCCAGG + Intergenic
1076829641 10:132987859-132987881 CCCAGGGCCACTGCCTCTCCAGG - Intergenic
1076943342 10:133625275-133625297 CCGGGGGCCTCTGTGTGCCCAGG - Exonic
1077135093 11:994473-994495 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135106 11:994513-994535 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135123 11:994554-994576 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135150 11:994636-994658 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135167 11:994677-994699 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135181 11:994718-994740 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135211 11:994800-994822 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135241 11:994882-994904 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077135270 11:994964-994986 CCGGGGGCCACTGTCCCTGCTGG + Intronic
1077177808 11:1198528-1198550 CCGGGGGACTTTGCCTCTCCTGG + Intronic
1077325754 11:1963339-1963361 CTGTGGACCCCTGTCTCTGCGGG - Intronic
1077419036 11:2440955-2440977 CTGTGGGCCTCTGACCCTGCTGG + Intergenic
1077435099 11:2535151-2535173 CCGAGAGCCTCTGTCTCCCTGGG - Intronic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1080091889 11:28358228-28358250 CTGTGGTTCTCAGTCTCTCCAGG - Intergenic
1080925556 11:36752542-36752564 CTGTGGTCCTATGTCTCTGCTGG + Intergenic
1081607804 11:44538096-44538118 CCCTGGACCACTGGCTCTCCTGG + Intergenic
1083400277 11:62418681-62418703 ACTTGGGCCTCAGTTTCTCCAGG + Intronic
1084266712 11:68008770-68008792 CCCTGGGCCTCCGTAGCTCCCGG - Intronic
1084601821 11:70150183-70150205 CCGTGAGCATCTGCCTCCCCGGG + Intronic
1084679212 11:70656322-70656344 ACATGGGCCTCTGTCACTCCTGG + Intronic
1084736221 11:71107320-71107342 CCGTGGGTCTCTGCCTTTGCTGG + Intronic
1084948764 11:72653264-72653286 CTCTGGGCCTCTGTCTCTCAGGG - Intronic
1085050550 11:73377860-73377882 CCCTGGGCCGCTGTGTCCCCAGG - Intronic
1087174138 11:95080651-95080673 CCCTGCTACTCTGTCTCTCCAGG - Intergenic
1089252917 11:117178383-117178405 CCCTGGGCCACTTTTTCTCCGGG - Intergenic
1089769535 11:120793427-120793449 CCCTGGGACTCTGCCTCACCAGG - Intronic
1202808734 11_KI270721v1_random:18518-18540 CTGTGGACCCCTGTCTCTGCGGG - Intergenic
1094252382 12:28378897-28378919 CTGTGTGCCTCTGTGTTTCCTGG + Intronic
1094474898 12:30833411-30833433 CCCAGGACCTCTGCCTCTCCAGG - Intergenic
1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG + Intergenic
1096009780 12:48203082-48203104 CCTCGGCCATCTGTCTCTCCTGG - Exonic
1097450627 12:59733547-59733569 CTTTGGGGCTCTGTGTCTCCTGG - Intronic
1098476257 12:70907703-70907725 CCTTGGGCCTCAGACTCTGCTGG + Intronic
1100379325 12:94047038-94047060 CTGCAGGCCTCTGTTTCTCCAGG - Intergenic
1102044845 12:109823256-109823278 CACTGGGGCTCTGTCTGTCCTGG - Intronic
1102254444 12:111407435-111407457 CAGTGGGCCTGTGGGTCTCCAGG + Intronic
1103924115 12:124414266-124414288 CCCTGTGCCTCTGTCTCATCTGG + Intronic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG + Intronic
1104837313 12:131799966-131799988 CCGTGGGCATGTGTCCCTGCCGG + Intergenic
1104842111 12:131830266-131830288 ACCTGCGCCTCGGTCTCTCCTGG + Intronic
1105604111 13:21912605-21912627 ACAAGGGCCTCTGTCTCCCCAGG - Intergenic
1108454250 13:50597257-50597279 GTGTGGGCCTGTGTCTCTCTTGG + Intronic
1113744278 13:112732000-112732022 CTGCGGGCCACTGTCTCACCTGG - Intronic
1118468901 14:66056773-66056795 CCGGGGTCCTCTGGCTCTCATGG + Intergenic
1118808884 14:69259905-69259927 CCGCGGGCGTCTGTCTCGCCGGG + Intronic
1119427509 14:74545456-74545478 CCAGGGCCCTCTGTATCTCCAGG - Intronic
1119765023 14:77182496-77182518 CCCTGGGCCTCAGTTTCCCCAGG - Intronic
1119975437 14:79019660-79019682 CCATGGGCCTCTGTGTCACTAGG - Intronic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1121699825 14:95944206-95944228 CTCTGGGCCTCAGTTTCTCCAGG - Intergenic
1121834423 14:97079165-97079187 CTGGGGGCCTCAGTTTCTCCAGG - Intergenic
1122267195 14:100552199-100552221 CCCTGGGCCTCAGTTTCCCCTGG - Intronic
1122938213 14:104969713-104969735 CCCTGTGCCTCAGTTTCTCCAGG - Intronic
1122992037 14:105241057-105241079 CCGTTGGCCTCTGCGTGTCCTGG - Intronic
1123919044 15:25057680-25057702 CCGTGGCCCTCGGTCACTTCTGG + Intergenic
1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG + Intergenic
1126692340 15:51297388-51297410 CCATGGGACTCTGTCTCCCCCGG - Intronic
1129260620 15:74365287-74365309 CTTTGGGCCTCTGTGCCTCCAGG - Intronic
1129315484 15:74740666-74740688 CCTTGGGCATGTCTCTCTCCTGG - Intergenic
1129906608 15:79192044-79192066 CCCTGGGCCTCTGTGTCCACTGG + Intergenic
1132458773 16:39065-39087 CCGTGCTCCTCTGTGTCACCAGG + Intergenic
1132724154 16:1331668-1331690 CCCTGGGCCTCCGTTTCCCCAGG - Intergenic
1132760219 16:1505388-1505410 CCCTGGGCCTGTCTCCCTCCAGG + Exonic
1133042689 16:3068878-3068900 CTGTGGGCCTCCGTCTCCCAGGG + Intronic
1133044732 16:3081521-3081543 CTGTGGGCCTCCGTCTCCCAGGG + Intronic
1137249039 16:46729687-46729709 CCGTGTGGCTATGTCTCTGCAGG - Exonic
1137755587 16:50899577-50899599 CCGTGGGCCTCTCTTTCTGAGGG + Intergenic
1138242166 16:55436013-55436035 CAAGGGGACTCTGTCTCTCCGGG + Intronic
1138449883 16:57087458-57087480 CTGAGGGTCTCTCTCTCTCCAGG - Intergenic
1139526167 16:67518206-67518228 GCGTGGGGCACCGTCTCTCCAGG - Intergenic
1139984238 16:70884271-70884293 CCCTGGCCCTCTGTCCCTCCAGG - Intronic
1141083610 16:81075843-81075865 CCCTGGGCCTTGGTTTCTCCTGG - Intronic
1141137039 16:81473189-81473211 ATGTCGGCCTCTGTCTCTGCAGG + Intronic
1141871314 16:86788607-86788629 CCCTGGGCCTCTAGATCTCCAGG - Intergenic
1142095177 16:88235439-88235461 CCCAGAGCCTCTGCCTCTCCTGG + Intergenic
1142744003 17:1946093-1946115 CCCTGGGCCTCTGGCTGGCCTGG - Intronic
1143109392 17:4544920-4544942 CGCTGGGCCTCTGTCCCTCAGGG - Exonic
1143733399 17:8894099-8894121 CCCTGGGCCTCAGTTTCTCCTGG + Intronic
1144585438 17:16484836-16484858 CTGTGCTCCTGTGTCTCTCCTGG + Intronic
1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG + Intergenic
1146225584 17:31063112-31063134 CCTTGGGCCCCTGTCTCTATTGG + Intergenic
1146288888 17:31594180-31594202 CAGTGGCCCTCTGACCCTCCAGG - Intergenic
1146494605 17:33310302-33310324 CTCTGTGCCTTTGTCTCTCCAGG + Intronic
1147402702 17:40190670-40190692 CGGTGGATCTCTGTGTCTCCAGG - Exonic
1147625291 17:41896224-41896246 TCGTGGGCGTCTGTCACTGCTGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151460231 17:74249908-74249930 CTGTGGGGCTGTGTCTTTCCTGG + Intronic
1151734006 17:75927555-75927577 TCATGGGCCTGAGTCTCTCCTGG + Intronic
1152019215 17:77771735-77771757 CCGAGGCCGTCTGTCTCCCCAGG - Intergenic
1152243694 17:79174052-79174074 CCGTTTTCCTCTGTGTCTCCTGG - Intronic
1152345612 17:79748696-79748718 CCGAAGGCCCCAGTCTCTCCTGG + Intergenic
1152600188 17:81258433-81258455 CCGTGGGCCTCCGGCTCACCTGG - Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152631412 17:81412186-81412208 CCGTGGGCCCTGGTCACTCCAGG + Intronic
1152648906 17:81482953-81482975 CTGAGGGCGTCTGTCTCCCCAGG + Intergenic
1157498500 18:48172870-48172892 CTGTGCTCCTCTGTCTCTGCAGG - Intronic
1157572738 18:48723705-48723727 ACCTGTGCCCCTGTCTCTCCTGG - Intronic
1161894461 19:7069803-7069825 CCGCGGGCCTGCGTCCCTCCCGG + Intronic
1162382603 19:10340319-10340341 CCCTGAGCCACTGTCTATCCAGG + Intergenic
1163473071 19:17508827-17508849 CACTGGGCCACTGTCTCACCTGG - Intergenic
1164457611 19:28421569-28421591 CCGTGGGCCTCTCTGTCACATGG - Intergenic
1164756271 19:30691980-30692002 CCGGGGGTCTTTGTCTCTGCAGG + Intronic
1165329231 19:35132098-35132120 CAGTGGGCCTATGTCTTTCATGG - Intronic
1166313651 19:41976665-41976687 CCCTGGTCCTCTGGCTCTCCTGG - Intronic
1167320762 19:48796106-48796128 CCGTGGGCCTCTGAGGCCCCTGG - Intronic
1167368829 19:49068735-49068757 CTTTGGGTCTCTGTCTCTCTGGG + Exonic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1167622358 19:50567201-50567223 CCTTGGGCACGTGTCTCTCCAGG - Intronic
1167679963 19:50913008-50913030 CTGTGTCTCTCTGTCTCTCCTGG + Intergenic
1168078766 19:53994164-53994186 GGGTGGGCGTCTGTCTCCCCAGG - Intronic
1168465202 19:56596028-56596050 CTGTGGAGCTGTGTCTCTCCAGG + Intronic
1202657440 1_KI270708v1_random:36818-36840 CCGTGGGCCTCGGGCGATCCCGG + Intergenic
927066921 2:19480943-19480965 CCGTGGGCCTCCCCCGCTCCAGG + Intergenic
929434191 2:41914836-41914858 GTGTGGGCCTCTGTGTCTCTTGG + Intergenic
931728161 2:65130466-65130488 CCGTGGGGCGCTGACTCGCCCGG - Intergenic
934567805 2:95350205-95350227 CCTTGTCCCTCTGTGTCTCCTGG + Intronic
935122290 2:100193499-100193521 CCGTGGGCCTCATTTCCTCCAGG + Intergenic
935315621 2:101830864-101830886 CCGTGTGTCTCTGTCTCTAAAGG + Intronic
935512658 2:103995263-103995285 CTCTGGGCCTCTGTTTCCCCAGG + Intergenic
938227265 2:129626760-129626782 CAGTGGGCCTCTTCTTCTCCAGG - Intergenic
944440410 2:199737647-199737669 CCTGGGGCCACTGTGTCTCCTGG + Intergenic
945080735 2:206085141-206085163 CTGGGGGCCGCTGTCTCTCCGGG - Intronic
945939882 2:215937770-215937792 CCTTGGGTCTCTGTCTCACATGG - Intergenic
947542227 2:230987131-230987153 CCCTGCGCCTCTGTGTGTCCCGG - Intergenic
947626545 2:231622702-231622724 TCTGGGGCCTCTGCCTCTCCAGG + Intergenic
948844916 2:240678467-240678489 CCGGGGGCCTCTGGCACCCCCGG - Intronic
948848944 2:240696412-240696434 CCGGGGGCCTCTGGCACCCCCGG + Intronic
948861899 2:240756791-240756813 CCGGGAGCCTCTGTCTCTTCTGG + Intronic
949000354 2:241609873-241609895 CCACGGGGCTCTGGCTCTCCTGG + Intronic
1170431157 20:16278174-16278196 CTGTGGCCCCCTGTCTCTCTCGG - Intronic
1171780719 20:29415438-29415460 CCGGGGGCCTCTGTGTGCCCAGG - Intergenic
1172480891 20:35270719-35270741 CTGAGGCCCTCTGACTCTCCTGG - Intronic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1173225503 20:41160232-41160254 CCTGGGTCCTCTGGCTCTCCGGG - Intronic
1173617494 20:44412686-44412708 CCCAGGCCCGCTGTCTCTCCTGG - Intronic
1174447773 20:50602137-50602159 CCGTGGGCCTCAGCAACTCCAGG + Exonic
1175292171 20:57883018-57883040 GCATGAGCCTGTGTCTCTCCTGG - Intergenic
1175383235 20:58577796-58577818 TTCTGGGCCTCTTTCTCTCCTGG - Intergenic
1176086531 20:63297766-63297788 GGGTGGGCTTCTGTCTCTTCGGG + Intronic
1176113050 20:63419146-63419168 CCGCGGGCCTCTGGCTTTCTGGG + Intronic
1176254002 20:64141114-64141136 CTGGGGGTCTCTGTCTCTCCGGG - Intergenic
1177594432 21:23217651-23217673 TCTTGTGCCTCTGCCTCTCCAGG - Intergenic
1179347114 21:40568927-40568949 CCATGGGCCTCAGCATCTCCAGG + Intronic
1179809343 21:43860551-43860573 CCGAGGGCCCCTGGCTCTCCCGG + Intergenic
1180207971 21:46274098-46274120 CCCTGGGCATGTGCCTCTCCTGG + Intronic
1180914227 22:19474130-19474152 CTGTGGGCCTATCTCACTCCTGG + Intronic
1180966177 22:19789043-19789065 CTGTGGGCCTGCGTCTCTCCTGG - Intronic
1180988069 22:19917281-19917303 CTGTGGGGCTCTGTATCCCCTGG - Intronic
1181093300 22:20489079-20489101 CCGAGGGCTGCTGGCTCTCCGGG - Exonic
1181531453 22:23519813-23519835 CCTTGGGTCTCTGACACTCCGGG - Intergenic
1182743367 22:32585237-32585259 CCCTGGGCCTCTGCTTCTCTGGG - Intronic
1183524462 22:38315334-38315356 CCGGGGTTCCCTGTCTCTCCTGG - Intronic
1184408443 22:44313270-44313292 CCGTGGCCCTCAGTCTCTGTTGG + Intergenic
1185372623 22:50468069-50468091 TCCTGGGCCTCAGTCTCTCCGGG + Intronic
950404809 3:12797598-12797620 CCCTGGGCCTCAGTTTCCCCAGG - Intronic
951657459 3:25025672-25025694 CAGTGGGCCCATGTCCCTCCTGG - Intergenic
953573991 3:44098165-44098187 ATGTGGGCCACAGTCTCTCCAGG - Intergenic
957084290 3:75665834-75665856 CCGGGGGCCTCTGTGTGCCCAGG + Exonic
962347331 3:134627755-134627777 CCATGGGCATCTTTCCCTCCAGG + Exonic
962854280 3:139329993-139330015 CTGTGGGTCTCTGGCTCCCCTGG + Intronic
966124384 3:176558699-176558721 CTGTGGGGCTCTGTTTCTGCAGG + Intergenic
967632973 3:191768509-191768531 CAGTGGGCTTCTGTCTGGCCAGG - Intergenic
968281804 3:197482840-197482862 CCTTCTGCCTCTGTCTCTCCTGG - Intergenic
968600400 4:1506015-1506037 CCGAGGGCCTCTGTCCCCCCAGG + Intergenic
969220694 4:5756650-5756672 CCCTGGGCCTATTTCTCACCTGG - Intronic
969323379 4:6426467-6426489 GTCTGGGGCTCTGTCTCTCCTGG - Intronic
969988246 4:11234041-11234063 CCGATGACCTCTGTCTCCCCAGG + Intergenic
977475905 4:97509125-97509147 CTATGGGCTTATGTCTCTCCAGG + Intronic
985031956 4:185798068-185798090 CCGTGCACCTCTGATTCTCCAGG - Intronic
985446698 4:190025737-190025759 CCGGGGGCCTCTGTGTGCCCAGG - Exonic
985574900 5:669484-669506 CTTGGGGCCTCTGTCTGTCCTGG + Intronic
986031387 5:3896265-3896287 GCGTGTGCCTCTGCCTCTCCAGG + Intergenic
990098782 5:52156503-52156525 GGGTGGGGCTCTGTCTCACCTGG + Intergenic
992351712 5:75936311-75936333 CCTTGGGTCTATGTCTCTACAGG + Intergenic
992676806 5:79112923-79112945 CCGGGGGCCTCTGTCGTGCCAGG - Intronic
998462836 5:142322227-142322249 CCGCCGGCCTCTGCCTCCCCTGG - Intronic
999666480 5:153917738-153917760 CCTTGGCTCTCTGTCTCTCCTGG + Intergenic
1000334130 5:160229356-160229378 CCTCGGGGCTCTGTCCCTCCAGG + Intronic
1001030981 5:168262576-168262598 CCAGGGCCCTCTGTCTCGCCTGG - Exonic
1001651677 5:173320335-173320357 CCTTGGCCCTCTCTCTCTCCAGG + Intronic
1002182475 5:177437957-177437979 CAGTGGGCCTCATTATCTCCAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002991728 6:2245228-2245250 TCGTGGGCTGCGGTCTCTCCAGG - Intronic
1004162899 6:13230224-13230246 CAGTGGGCCTTTAGCTCTCCAGG + Intronic
1006517123 6:34551287-34551309 CGGTGGGCCTCTGTACCTCCAGG - Intronic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1014468075 6:121780904-121780926 CCTTGGCCTTCTGTCTCTTCTGG - Intergenic
1015800604 6:137058377-137058399 CCGTGTCTCTCTCTCTCTCCTGG - Intergenic
1015982962 6:138857480-138857502 CAGTGGGTCTCTGTCTGTACTGG + Intronic
1017138325 6:151167687-151167709 CCGTGGGCACCACTCTCTCCCGG - Intergenic
1017658993 6:156655734-156655756 CTGTGGCTCTCTTTCTCTCCAGG - Intergenic
1019261316 7:83600-83622 GCGGGGGCCTCTGCCTCTGCTGG + Intergenic
1019420655 7:949233-949255 TTGTGGGCCTCTGCCTCCCCCGG + Intronic
1019429251 7:991101-991123 ACGTGGGCCTCGGGCTCCCCTGG - Intergenic
1019706112 7:2498035-2498057 CCATCTGCCTCTGTCTCTCGGGG - Intergenic
1022236514 7:28467004-28467026 CCTTGGCCCCCTGTCCCTCCAGG - Intronic
1022894999 7:34740927-34740949 CCGTGAGCCTCTGTAAATCCTGG + Intronic
1025020587 7:55476549-55476571 CCCCTGGCCTCTGTCCCTCCTGG - Intronic
1026921960 7:74162344-74162366 CAGTGCCCCTCTGTCTCTGCAGG - Intergenic
1029744938 7:102511651-102511673 TCGTCAGCATCTGTCTCTCCCGG + Intronic
1029762930 7:102610812-102610834 TCGTCAGCATCTGTCTCTCCCGG + Intronic
1033220523 7:139524024-139524046 CCGCGGGCCTCAGCCTCTGCGGG - Exonic
1033595469 7:142855359-142855381 CCGTTGGCCGCAGTCTCTGCAGG - Exonic
1035027583 7:155836044-155836066 CAGTGGGGCTCTGTCCCGCCAGG - Intergenic
1035865380 8:3076286-3076308 CTGTGCACCTCTGTCTCTGCAGG + Intronic
1036184763 8:6613597-6613619 CCTTGGGCTCCTGTCTCCCCGGG - Intronic
1036200811 8:6770358-6770380 CCATGTCCATCTGTCTCTCCTGG + Intergenic
1036810946 8:11867593-11867615 GCCTGGGCCTCGGTGTCTCCGGG - Intronic
1037564757 8:20108325-20108347 GTGTGGGCCTTTGTCTCACCTGG + Intergenic
1037913696 8:22759236-22759258 CCCTGGGCCTCCGTCTATGCGGG - Intronic
1040286089 8:46101127-46101149 CAGGGTGCCTGTGTCTCTCCCGG - Intergenic
1040298077 8:46173598-46173620 CAGTGTGCATGTGTCTCTCCTGG + Intergenic
1040300771 8:46186901-46186923 CAGGGTGCCTGTGTCTCTCCTGG - Intergenic
1040307158 8:46218037-46218059 CAGGGTGCCTGTGTCTCTCCCGG - Intergenic
1040313255 8:46247691-46247713 CAGCGTGCCTCTGTCTCTCGCGG + Intergenic
1040330732 8:46384502-46384524 CAGTGGGCCTGTGTCTCTCATGG + Intergenic
1040334746 8:46410343-46410365 CAGGGTGCCTCTGTCTCTCACGG + Intergenic
1040338517 8:46428243-46428265 CAGTGTGCCTGTGTCTCTCACGG + Intergenic
1040340610 8:46438641-46438663 CAGTGTGCCTGTGTCTCTCGTGG - Intergenic
1040341883 8:46445215-46445237 CAGCGTGCCTCTGTCTCTCATGG - Intergenic
1040342475 8:46447904-46447926 CAGTGTGCCTGTGTCTCTCACGG - Intergenic
1041713769 8:60915207-60915229 CCTTGGGCCTCCTTCTCTCCTGG + Intergenic
1042733062 8:71958150-71958172 CAGTGGGCCTCTGGAACTCCAGG - Intronic
1043756081 8:84005672-84005694 CTTTGGGCCTCTGTGGCTCCTGG - Intergenic
1049095284 8:140544914-140544936 ATGTGGGCCTCGGGCTCTCCGGG + Intronic
1049581173 8:143411746-143411768 CCTGTGGCCTCTGTCTCTACTGG - Intergenic
1051054222 9:12964815-12964837 CCATGTTTCTCTGTCTCTCCTGG - Intergenic
1052878887 9:33588013-33588035 CCATGAGCCTCTGCCTCTGCAGG - Intergenic
1053416574 9:37950573-37950595 CCCCGTGCCTCTGCCTCTCCTGG - Intronic
1053435120 9:38069135-38069157 CCGTCGCTCGCTGTCTCTCCCGG - Exonic
1053497086 9:38556207-38556229 CCATGAGCCTCTGCCTCTGCAGG + Intronic
1055833153 9:80406636-80406658 TGGTGGGCCTGTGTCTCTCTGGG - Intergenic
1056332894 9:85536191-85536213 CCTTGGCACTCTGTCCCTCCTGG + Intergenic
1057555127 9:96082110-96082132 CAGTCGGCCTCTGTATCTGCAGG - Intergenic
1057800108 9:98185797-98185819 CCTTGGGCCAGGGTCTCTCCTGG - Intronic
1057917795 9:99071039-99071061 AAGTCGGCCTCTGTCTCTCAAGG + Intergenic
1060188382 9:121577464-121577486 CAGTGGGCCTCTGTCTCGGCAGG + Intronic
1060282989 9:122226530-122226552 GCGCGGGCCTCTTTCACTCCGGG + Intronic
1061429377 9:130521602-130521624 CCATTGGCCTCCATCTCTCCAGG - Intergenic
1061878896 9:133558614-133558636 CCGTGAGCCTGTGTCTGGCCGGG + Intronic
1061985048 9:134125803-134125825 TCAAGGGCCTCAGTCTCTCCAGG - Intergenic
1061995090 9:134179141-134179163 CCGTGTTCCTCTGTCTTTCCAGG + Intergenic
1062054632 9:134464424-134464446 CCGGCAGCCTCTGCCTCTCCTGG + Intergenic
1062160098 9:135075286-135075308 CCGCGCGCCTCGCTCTCTCCCGG - Intergenic
1062189428 9:135240171-135240193 TCCTGGTCCTCTGTGTCTCCAGG - Intergenic
1062453439 9:136625023-136625045 CCCTGGGCCTCGGTTTCCCCAGG - Intergenic
1187484300 X:19687628-19687650 CTGTGGCCCTCCGTCTTTCCCGG + Intronic
1188983350 X:36748421-36748443 CCTTGGCTCTGTGTCTCTCCTGG + Intergenic
1190966971 X:55310113-55310135 TCCTGGGCATCAGTCTCTCCAGG - Intergenic
1194002994 X:88455059-88455081 CCGTGCTCCTCTTTCTCTCATGG - Intergenic
1195111746 X:101657140-101657162 CCAAGGGCCTCTGTCACCCCGGG + Exonic
1195709802 X:107764903-107764925 CCGAAGGCCTCTGCCTCCCCAGG + Intronic
1197966831 X:132072580-132072602 CCCTGGGCTTATGTATCTCCAGG - Intergenic
1199950239 X:152700642-152700664 CCGGGGGCCTCTGGTCCTCCAGG - Exonic
1200120002 X:153785739-153785761 GCGTGGGCCTCCCTCACTCCAGG - Intergenic