ID: 1172876367

View in Genome Browser
Species Human (GRCh38)
Location 20:38166721-38166743
Sequence AAATATCCACTGAAGCAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172876367_1172876370 -6 Left 1172876367 20:38166721-38166743 CCGTGTTGCTTCAGTGGATATTT No data
Right 1172876370 20:38166738-38166760 ATATTTCTCCCTGGGTCAAACGG No data
1172876367_1172876375 5 Left 1172876367 20:38166721-38166743 CCGTGTTGCTTCAGTGGATATTT No data
Right 1172876375 20:38166749-38166771 TGGGTCAAACGGGCTCTGGCTGG No data
1172876367_1172876371 -5 Left 1172876367 20:38166721-38166743 CCGTGTTGCTTCAGTGGATATTT No data
Right 1172876371 20:38166739-38166761 TATTTCTCCCTGGGTCAAACGGG No data
1172876367_1172876372 1 Left 1172876367 20:38166721-38166743 CCGTGTTGCTTCAGTGGATATTT No data
Right 1172876372 20:38166745-38166767 TCCCTGGGTCAAACGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172876367 Original CRISPR AAATATCCACTGAAGCAACA CGG (reversed) Intergenic
No off target data available for this crispr