ID: 1172880720

View in Genome Browser
Species Human (GRCh38)
Location 20:38198308-38198330
Sequence GCAGCCTGTAGATTGGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172880720_1172880724 -1 Left 1172880720 20:38198308-38198330 CCCGAGGCCAATCTACAGGCTGC No data
Right 1172880724 20:38198330-38198352 CAGTTTGCTGATTGCTCTAAGGG No data
1172880720_1172880723 -2 Left 1172880720 20:38198308-38198330 CCCGAGGCCAATCTACAGGCTGC No data
Right 1172880723 20:38198329-38198351 GCAGTTTGCTGATTGCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172880720 Original CRISPR GCAGCCTGTAGATTGGCCTC GGG (reversed) Intergenic
No off target data available for this crispr