ID: 1172890447

View in Genome Browser
Species Human (GRCh38)
Location 20:38260486-38260508
Sequence TTGGCGCGTTACCATGGTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172890438_1172890447 13 Left 1172890438 20:38260450-38260472 CCCACTGAAAGGGGGCAGAGCGA 0: 1
1: 0
2: 0
3: 13
4: 91
Right 1172890447 20:38260486-38260508 TTGGCGCGTTACCATGGTGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1172890439_1172890447 12 Left 1172890439 20:38260451-38260473 CCACTGAAAGGGGGCAGAGCGAG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1172890447 20:38260486-38260508 TTGGCGCGTTACCATGGTGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172890447 Original CRISPR TTGGCGCGTTACCATGGTGA CGG Exonic
902771227 1:18646719-18646741 GTGGCGCTTTACTATGGTGTGGG + Intronic
910785463 1:90993210-90993232 TTGGCTTGTTATCATGGTGGTGG - Intronic
1064494691 10:15896833-15896855 TTTGGGTGTTGCCATGGTGATGG + Intergenic
1091727195 12:2854445-2854467 TGGGCACCTCACCATGGTGATGG + Intronic
1102449726 12:113032423-113032445 TTGGAGTGTTGCCATGGTAATGG - Intergenic
1103415279 12:120738870-120738892 CTGGCGCGCTGCCATGCTGAAGG + Exonic
1112230673 13:97586491-97586513 TGGGCTCGTTAACATGGTGGTGG - Intergenic
1121097630 14:91228900-91228922 TGGCAGCTTTACCATGGTGAGGG - Intergenic
1126799835 15:52288831-52288853 TTGGCGCCTTGGCATGGGGAGGG - Intronic
1138385684 16:56634461-56634483 TTGGTGCCCTCCCATGGTGAAGG + Intergenic
1147150642 17:38511649-38511671 TTGGGGAGTAACCCTGGTGAGGG - Exonic
1161512088 19:4677491-4677513 TTGGTGCATTCCCAGGGTGATGG - Intronic
1167054427 19:47100421-47100443 TAGGCACGTTACCATGGAAATGG - Intronic
935276127 2:101476612-101476634 TTGGAGCTTCACCCTGGTGATGG - Intergenic
942640484 2:178056152-178056174 TTGGAGCGTTAACATATTGAGGG + Intronic
1172890447 20:38260486-38260508 TTGGCGCGTTACCATGGTGACGG + Exonic
1180032174 21:45219757-45219779 TAGGCGCTTTGTCATGGTGAAGG + Intronic
1184453774 22:44597785-44597807 CTGGGGTGTTGCCATGGTGACGG + Intergenic
950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG + Intronic
951351783 3:21615174-21615196 TGAGCTCATTACCATGGTGAGGG - Intronic
954363120 3:50132888-50132910 TTTGCCTGTTGCCATGGTGATGG + Intergenic
961438180 3:126933623-126933645 TTCGCTCATTACCATGGGGAGGG + Intronic
978062761 4:104358520-104358542 TTGGCTCTTTACTTTGGTGATGG - Intergenic
1016454240 6:144215064-144215086 TTGGCGCCATACAATGGAGATGG + Intergenic
1024230367 7:47359031-47359053 TTGGGGCGTTACCCAGGAGAGGG - Intronic
1024633510 7:51268310-51268332 GTGGAGGGTTACCATGGTGCAGG - Intronic
1034391622 7:150791870-150791892 TTGGCCCAGGACCATGGTGATGG + Intronic
1039031039 8:33309880-33309902 TTTGTGTGTAACCATGGTGATGG - Intergenic
1053071568 9:35105092-35105114 TTTGGGCGTGAGCATGGTGAGGG + Exonic
1187274009 X:17802971-17802993 TGGCCTCGTTACCATGGAGAAGG + Intronic
1187910700 X:24108784-24108806 ATGGTGCTTTAGCATGGTGAGGG + Intergenic
1188864928 X:35303205-35303227 TTGGCTCGTCAGCATGGTGTTGG - Intergenic
1194566971 X:95501272-95501294 TCTGCTCGTTACCAGGGTGACGG + Intergenic
1200089960 X:153630423-153630445 TTGTCCCTTTTCCATGGTGAGGG + Intergenic