ID: 1172895842

View in Genome Browser
Species Human (GRCh38)
Location 20:38299462-38299484
Sequence CCTTTTATGAGACGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172895837_1172895842 20 Left 1172895837 20:38299419-38299441 CCTTGGAGGCTCATATCTTTCTG 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 87
1172895834_1172895842 28 Left 1172895834 20:38299411-38299433 CCTGTGCCCCTTGGAGGCTCATA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 87
1172895833_1172895842 29 Left 1172895833 20:38299410-38299432 CCCTGTGCCCCTTGGAGGCTCAT 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 87
1172895839_1172895842 -4 Left 1172895839 20:38299443-38299465 CCAGATTACTCAAAGGAGCCCTT 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 87
1172895835_1172895842 22 Left 1172895835 20:38299417-38299439 CCCCTTGGAGGCTCATATCTTTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 87
1172895836_1172895842 21 Left 1172895836 20:38299418-38299440 CCCTTGGAGGCTCATATCTTTCT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172895842 Original CRISPR CCTTTTATGAGACGTGAAGC TGG Intronic
900989133 1:6090015-6090037 CCTTTGATGGGACGGGCAGCAGG + Intronic
901727629 1:11254440-11254462 CTTATTATGAGAATTGAAGCTGG - Intronic
905519213 1:38585187-38585209 CCTTCTAGTAGAGGTGAAGCAGG - Intergenic
917227296 1:172799022-172799044 CTGATTATGAGAGGTGAAGCTGG + Intergenic
924213403 1:241793840-241793862 CATGTTATGAGACATGAAGCAGG - Intronic
924398988 1:243657222-243657244 CCTTCTATGAACCGTGAAGAGGG + Intronic
1063916732 10:10890620-10890642 CTTTTGCTGAGAGGTGAAGCTGG + Intergenic
1064239330 10:13611396-13611418 CCTTTTATGAAAAGTCAAGAGGG - Intronic
1071972080 10:90917888-90917910 CCTTTTAAGAGCTATGAAGCTGG + Intronic
1072699189 10:97627812-97627834 TATTTTCTGAGACGTGATGCTGG + Intronic
1074692613 10:116019914-116019936 CCTTTGTTCAGACGTGAAGAAGG + Intergenic
1075663835 10:124216869-124216891 CCATTTATGCGACCTGGAGCTGG + Intergenic
1081608638 11:44544793-44544815 CCTTTCATGAGCAGTGAATCAGG - Intergenic
1087221341 11:95549689-95549711 CATTTTATGAGACGAGAAGACGG - Intergenic
1087453381 11:98353107-98353129 GCTTTTAGGAGACCTGAAGTGGG + Intergenic
1090222005 11:125034656-125034678 CCTTTCATGAGCAGTGAATCAGG + Intronic
1099846828 12:88037359-88037381 CCTTTTATGACAGGTGGAGAAGG + Intronic
1100813779 12:98365999-98366021 CCTTTTACGAAACATGAGGCTGG - Intergenic
1104285027 12:127417420-127417442 CCTTTTGTGGGAGGTGAGGCTGG - Intergenic
1107107937 13:36667012-36667034 CTGTTTATGAGACTTGAAGCAGG - Intergenic
1108914677 13:55591956-55591978 CCTTTTATAAGCAGTGAATCAGG + Intergenic
1120161067 14:81144879-81144901 GCTATTATGAGACATGAAGGAGG + Exonic
1120772319 14:88393533-88393555 ATTTTAATGAGAAGTGAAGCTGG - Intronic
1124071070 15:26393574-26393596 TCTTTTTTGAGACGGGTAGCTGG - Intergenic
1124380130 15:29158236-29158258 CCTTTCATGAGACGTAAAGCAGG - Intronic
1129860903 15:78860657-78860679 CCGTTGATGAGACCTGAAGTTGG - Intronic
1130082339 15:80745107-80745129 CCTTTTATAAGTCATTAAGCTGG - Intronic
1135435666 16:22425292-22425314 CCTTTGAGCAGATGTGAAGCCGG + Intronic
1142044872 16:87919096-87919118 CCTTTAAGCAGATGTGAAGCCGG + Intronic
1143315923 17:6033445-6033467 CCTTGTATGAGTCCTGAGGCAGG - Intronic
1147268748 17:39251679-39251701 TCTTTGATGAGACTTGAACCAGG + Intergenic
1147889931 17:43710047-43710069 ACGTTCATGAGACTTGAAGCTGG + Intergenic
1159559486 18:69978183-69978205 CCTCTCATGAGCAGTGAAGCAGG + Intergenic
1165940231 19:39411243-39411265 CCTGTTATGAGACCTGAGTCAGG + Intergenic
1166512186 19:43416351-43416373 CCTGTTATGAGACAGGAAGGAGG - Exonic
930600167 2:53433565-53433587 CCTATTATGAGAAGTAAAGAAGG + Intergenic
932336785 2:70936144-70936166 CCTTTTCTGAGGCAAGAAGCGGG - Intronic
933090618 2:78111650-78111672 CTTTTTCTGAGATGTGTAGCAGG + Intergenic
934050027 2:88202078-88202100 ACTTTTAGGAGACATGAAGGTGG + Intergenic
938011368 2:127831558-127831580 CATTTTCTGAGCCGTGTAGCTGG - Intergenic
939662463 2:144907094-144907116 CCTTTTATGAAAAATAAAGCAGG + Intergenic
945518276 2:210790324-210790346 CCTTTGCTGAGTCCTGAAGCAGG + Intergenic
946257116 2:218451251-218451273 ACTTTTATGTGACTTGAATCTGG + Exonic
946671172 2:222105949-222105971 CCTTCTAGGAGCCCTGAAGCTGG - Intergenic
1172002123 20:31787439-31787461 CCCTTTCTGAAAAGTGAAGCGGG - Intronic
1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG + Intronic
1174417856 20:50379344-50379366 GCTTTTATGAGCTGTGAAGGAGG + Intergenic
1175701347 20:61139755-61139777 CGTTTTATAAGACGGGAAGAAGG + Intergenic
1176884820 21:14243085-14243107 GCTTTTCTGAGTCCTGAAGCAGG + Intergenic
1177902252 21:26931590-26931612 CCTTTGATGAGCCGTGGAGATGG - Intronic
1178849010 21:36197707-36197729 CCTTTTAAGAAACGTGAACTTGG + Intronic
1179505111 21:41834885-41834907 CCTTGTGTGAGGCCTGAAGCCGG - Intronic
950563213 3:13748115-13748137 CCTCTTTTGAGAGGTGAAGGAGG - Intergenic
953897789 3:46815571-46815593 CCTTTCATGAGCGGTGAATCAGG + Intergenic
954053673 3:48004341-48004363 CCTTTCATGAGCAGTGAATCAGG - Intronic
955417793 3:58708870-58708892 CTCTTTTTGAGAAGTGAAGCTGG + Intergenic
958732396 3:97972869-97972891 CCTTTTATGAATAGAGAAGCAGG + Intergenic
964858170 3:161170201-161170223 CCTTTGCAGAGACATGAAGCTGG - Intronic
965770017 3:172172039-172172061 CTTTTTATGAGAGGCGAAGGAGG - Intronic
967619483 3:191615722-191615744 CCTTTTCAGGGACATGAAGCTGG + Intergenic
967700232 3:192584061-192584083 CCATTTAAGAGACGTGGAACTGG + Intronic
969195204 4:5556627-5556649 CATTTTATGAAACCAGAAGCTGG + Intronic
974479412 4:62423926-62423948 CCTTTCATGAGTAGTGAATCAGG + Intergenic
974912501 4:68139954-68139976 CCTATTATGAGAAATGAAGTTGG - Intergenic
978847516 4:113291703-113291725 AATTTTATGAGAAGTGAAGCAGG + Intronic
978920073 4:114173485-114173507 CCATCTATGAAGCGTGAAGCAGG + Intergenic
979265426 4:118696417-118696439 CCTTTAATGAGATGTTAAGGTGG + Intronic
982429735 4:155309168-155309190 ACTTTTCTGAGACGAAAAGCTGG - Intergenic
987346751 5:16985658-16985680 TCTTATTTGAGAGGTGAAGCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
993791389 5:92215837-92215859 CCTTTCATGAGCAGTGAATCAGG - Intergenic
999423946 5:151470100-151470122 CTTTTTATGAGACTGGAAGGAGG + Intronic
1009629662 6:66178763-66178785 CATTTTCTTAGACGTGAAGTGGG - Intergenic
1012731050 6:102881110-102881132 CCTTTTAAGAGAAGTTAATCAGG + Intergenic
1014416619 6:121192324-121192346 CCTCTCATGAGAGGTGAATCAGG - Intronic
1015596945 6:134875034-134875056 CCTTTTCTGAGCTGTGTAGCTGG + Intergenic
1016470278 6:144368151-144368173 CTTTTTATGAGACATGAAAAGGG - Intronic
1019354329 7:570910-570932 GCTTGGAAGAGACGTGAAGCAGG - Intronic
1024795735 7:53017415-53017437 GTCTTTATGAGAGGTGAAGCCGG + Intergenic
1025252801 7:57363208-57363230 GCTTTTATGAGCTGTGAAGGAGG - Intergenic
1028419479 7:90616460-90616482 CCTTTTAAGAGAAGAGAATCAGG - Intronic
1028873803 7:95798426-95798448 CATTTTATGAGACACTAAGCAGG + Intronic
1031713338 7:125076205-125076227 CCTTTTCTGACATGTGAAGACGG + Intergenic
1033374510 7:140744525-140744547 CCTTTTAACAAACCTGAAGCTGG + Intronic
1033415794 7:141160344-141160366 CCTTCAAGGAGAAGTGAAGCTGG - Intronic
1037537082 8:19834889-19834911 CCTTCTATGATCCGGGAAGCAGG - Intronic
1046364566 8:113209982-113210004 CCTTTTAGGAGAAGTAAAACGGG - Intronic
1057554883 9:96080074-96080096 TCTGTGATGAGACCTGAAGCGGG - Intergenic
1188248075 X:27857720-27857742 ACACTTATGAGAGGTGAAGCCGG - Intergenic
1192268129 X:69554521-69554543 GCTTTTATGAGACCTTGAGCAGG + Intergenic
1193249082 X:79266493-79266515 CCTTTTAAAAGAAGTGAAGTAGG - Intergenic
1193832555 X:86307041-86307063 CCTTTCATGAGCAGTGAATCAGG - Intronic
1198783436 X:140260900-140260922 CCTCTTATGAGCAGTGAATCAGG + Intergenic