ID: 1172896623

View in Genome Browser
Species Human (GRCh38)
Location 20:38304726-38304748
Sequence GGTCAGAGGGAGAGTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 736}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172896613_1172896623 11 Left 1172896613 20:38304692-38304714 CCATTTGCCTCTCGTTGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG 0: 1
1: 0
2: 6
3: 65
4: 736
1172896611_1172896623 27 Left 1172896611 20:38304676-38304698 CCAGTTCTCAGCCTTGCCATTTG 0: 1
1: 0
2: 2
3: 39
4: 274
Right 1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG 0: 1
1: 0
2: 6
3: 65
4: 736
1172896612_1172896623 16 Left 1172896612 20:38304687-38304709 CCTTGCCATTTGCCTCTCGTTGC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG 0: 1
1: 0
2: 6
3: 65
4: 736
1172896616_1172896623 4 Left 1172896616 20:38304699-38304721 CCTCTCGTTGCTGAGGAGGCTGA 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG 0: 1
1: 0
2: 6
3: 65
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172896623 Original CRISPR GGTCAGAGGGAGAGTGTGGG AGG Intronic
900187552 1:1339470-1339492 GGACAGATGGACAGGGTGGGAGG + Intronic
900192310 1:1356634-1356656 GGGCTGAGGGGGAGTGGGGGTGG + Intronic
900338094 1:2174675-2174697 GCTCAGAGTCAGAGTCTGGGCGG + Intronic
900634062 1:3653053-3653075 GGTCGGAGGGAGCGCGCGGGCGG - Intronic
900809051 1:4787336-4787358 GGGAAGAGGGAGAGAGTGGGGGG + Exonic
901057024 1:6453315-6453337 GGGCAGTGTGAGAGAGTGGGTGG + Intronic
901333116 1:8425549-8425571 GGTCAGAGGTGGAGAATGGGAGG + Intronic
901449704 1:9328630-9328652 GGCCAGAGGGAGGCAGTGGGTGG - Intronic
901756777 1:11446184-11446206 GGTGACAGAGAGAGTGTGAGAGG - Intergenic
901909558 1:12445104-12445126 GGTCAGAGACAGTGTGTGTGAGG + Intronic
902454591 1:16523355-16523377 GGTCAGAGGGAAGGGGAGGGTGG + Intergenic
902477350 1:16695178-16695200 GGGCAGTGTGAGAGAGTGGGTGG - Intergenic
902497866 1:16886998-16887020 GGTCAGAGGGAAGGGGAGGGTGG - Intronic
902830464 1:19009189-19009211 GGCCAGTGGGAGGGTGGGGGGGG - Intergenic
903012930 1:20343564-20343586 GGTCATAGGGAGAGTAGGCGGGG - Intronic
904092661 1:27956100-27956122 GGCCAGAGGAGGAGGGTGGGAGG + Intronic
904316504 1:29669624-29669646 GGTCAGGAGGAGAGTGGGGAGGG - Intergenic
904497326 1:30894375-30894397 GGTGAGAGTGTGAGTGTGTGGGG + Intronic
904591077 1:31615648-31615670 GGTAGGGGGGAGAATGTGGGGGG + Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
905231690 1:36518484-36518506 GGTCAGAAGCCCAGTGTGGGTGG + Intergenic
905892889 1:41528234-41528256 GGTGTGAGGGTGAGTGTGTGAGG - Intronic
906251429 1:44313722-44313744 GGTGTTAGGGAGAGTGTGGGAGG - Intronic
906615382 1:47229851-47229873 GGTCAGAGAGAGAATGAGGTGGG - Intronic
906647946 1:47489677-47489699 GGTCTCAGGGAGAGGGTAGGTGG + Intergenic
906785337 1:48610772-48610794 GGGAAGAGGGAGAGTGCAGGAGG - Intronic
906924682 1:50102424-50102446 GGTCAAAGGGAGAGGAGGGGAGG - Intronic
907356143 1:53875619-53875641 GGTGAGAGAGACAGTGTGGAGGG - Intronic
907782475 1:57579950-57579972 GGTCACAGAGAGAGTGAGAGGGG + Intronic
908677377 1:66620547-66620569 AGACAGAGAGAGAGAGTGGGAGG + Intronic
908722380 1:67139399-67139421 GGTGACAGGGAGAGTGCTGGAGG - Intronic
909671189 1:78190516-78190538 TGTCAGAGGGTGGGAGTGGGAGG - Intergenic
909677125 1:78251010-78251032 GGTTAGAGGGAGAGAGAGAGAGG + Intergenic
910940553 1:92528779-92528801 GATGAGAGAGAGAGTGTGGGAGG + Intronic
912128314 1:106568971-106568993 GGAGGGAGGGAGAGAGTGGGAGG + Intergenic
912430859 1:109627681-109627703 GATCAGAGGGAGCAGGTGGGAGG - Intronic
912727348 1:112069831-112069853 GGGCAGAGGGAGAGTGGTGGGGG - Intergenic
912867108 1:113267363-113267385 GGGCACAGGGAGAGTCAGGGTGG - Intergenic
913408881 1:118528153-118528175 AGTTAGAGAGAGAGTGGGGGAGG + Intergenic
914827154 1:151144698-151144720 GGTCACTGGGAGAGTTTGTGGGG + Intronic
915340884 1:155176043-155176065 CGCCAGAGTGTGAGTGTGGGAGG + Exonic
916178429 1:162062645-162062667 GTTCAGAGCCAGAGTGGGGGTGG - Intergenic
916195396 1:162217640-162217662 AGGCAGAGTGAGAGTGTGGCTGG + Intronic
916326238 1:163562947-163562969 TATCAGAGGGTGAGGGTGGGAGG - Intergenic
916762849 1:167832831-167832853 GGGGAGGGGGCGAGTGTGGGAGG - Intronic
917149883 1:171932023-171932045 GGGGAGAGGGAGAGGGAGGGAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918071962 1:181139749-181139771 GGCCAGAGGGAGGATGTGGCTGG + Intergenic
918248685 1:182682837-182682859 GGACAGAGCAAGAGTGTGGATGG - Intronic
918991671 1:191704459-191704481 GGAGAGAGAGAGAGAGTGGGTGG - Intergenic
919748862 1:201024402-201024424 GGCCAGAGGGTCAGTGTGGGAGG + Intergenic
919839247 1:201597373-201597395 GGGAAGAAGGAGAGTGTAGGGGG - Intergenic
920081632 1:203378826-203378848 TGTCAGGGGAAGGGTGTGGGAGG - Intergenic
920245732 1:204585947-204585969 GTTCAGAGGGAGGGCGGGGGGGG + Intergenic
920511056 1:206552335-206552357 AGTCAGATGGAAGGTGTGGGAGG + Intronic
920555821 1:206903677-206903699 GGTGAGCTGGCGAGTGTGGGTGG - Intronic
920558719 1:206923295-206923317 GTGCAGAGGAAGTGTGTGGGGGG + Intergenic
921771571 1:219046860-219046882 GGAGAGAGGGAGAGTGAAGGAGG + Intergenic
922247295 1:223813103-223813125 GGGTGGAGAGAGAGTGTGGGTGG - Intronic
922466674 1:225849352-225849374 GGTCAGACTGGGGGTGTGGGAGG - Intronic
922485948 1:225973060-225973082 GGTCTGAGGGAGATTATGAGGGG + Intergenic
922722624 1:227906460-227906482 GGGAGGAGGGAGAGGGTGGGAGG - Intergenic
922750825 1:228069330-228069352 GTATAGAGGGATAGTGTGGGGGG + Intergenic
922964177 1:229674270-229674292 GGGGAGAGGGAGGCTGTGGGCGG - Intergenic
923086339 1:230706000-230706022 GGTCAGAGGCATAGTGAGGCTGG + Exonic
923622038 1:235587467-235587489 GGTGAGTGTGAGAGTGTGGATGG + Intronic
924208794 1:241743490-241743512 GGTAAGAGGGGGAGTGCGGAGGG - Intronic
924573861 1:245261516-245261538 GGAGAGAGGGAGAGAGAGGGAGG - Intronic
1062961296 10:1575611-1575633 GGACTGAGGGAGAGAGAGGGTGG - Intronic
1063132576 10:3191251-3191273 GGTCAGAGGGCGAGAGAGAGAGG - Intergenic
1064353257 10:14596084-14596106 GGCCAGAGGGCCTGTGTGGGAGG - Intronic
1064488133 10:15819069-15819091 GTTGAGAGGGAGAGTGCAGGAGG + Intronic
1065136144 10:22672270-22672292 GGTCGGGGGGACAGTGTGGGGGG + Intronic
1065483525 10:26216358-26216380 AGTCAGAGTGAGGGGGTGGGAGG - Exonic
1065664702 10:28045606-28045628 GGTGAGAGAGAGAGTGTGTGTGG + Intergenic
1065728754 10:28691662-28691684 GGGAAGAGGGAGAGGGAGGGAGG - Intergenic
1065768016 10:29050071-29050093 GGTGAGAGGGAGAGAGAGAGAGG + Intergenic
1065785211 10:29206648-29206670 GGTAAGAGGGAGAGGGTCAGAGG + Intergenic
1066384635 10:34931788-34931810 GGTGACAGGGAGGGTGAGGGAGG + Intergenic
1067204318 10:44200321-44200343 CTTCAGAGGAAGAGAGTGGGAGG - Intergenic
1067561007 10:47304386-47304408 GGAGAGAGGGAGAGAGAGGGAGG + Intronic
1068127347 10:52856866-52856888 ATTCAGAGGGAGTGTGTTGGAGG - Intergenic
1068751057 10:60592826-60592848 CGTCAGAAGGAGTGTGTGAGGGG - Intronic
1068883424 10:62074492-62074514 GGTATAAGGTAGAGTGTGGGAGG + Intronic
1069029719 10:63582852-63582874 GGTGAGTGGGAGATAGTGGGAGG - Intronic
1069062514 10:63909013-63909035 TGTCATAGGGAGAGAGTGAGAGG - Intergenic
1069761367 10:70813838-70813860 TGTCAGAGGGAGTGTGGGGTAGG + Intergenic
1069940125 10:71949528-71949550 GGTTATGGGGAGAGTCTGGGTGG + Intergenic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1070985422 10:80685845-80685867 GGACAGAGGTAGAGGGTAGGGGG + Intergenic
1070987897 10:80703787-80703809 GGTCAGAAGCTGAGTGTGTGTGG - Intergenic
1071840333 10:89464040-89464062 GGACAGTGGGAGAGTGAGAGTGG - Intronic
1072199701 10:93147319-93147341 GATGAGAGGGTGAGTGTGGCTGG - Intergenic
1072587037 10:96792009-96792031 GGAAAGAGGGAGAGGGAGGGAGG - Intergenic
1072587057 10:96792105-96792127 GGAAAGAGGGAGAGGGAGGGAGG - Intergenic
1072627104 10:97119584-97119606 GGTCATCGGGAGGGTCTGGGAGG + Intronic
1072743705 10:97925683-97925705 GGTGAGAGTGAGTGTGTGGGGGG + Intronic
1073076749 10:100829214-100829236 GGGCAGAGGGAGAGAGGGGCAGG - Exonic
1073701633 10:105934255-105934277 GGTAATAGGCAGAGTGTGGAGGG + Intergenic
1073948157 10:108776370-108776392 GGCCAGAAGGAGAGAGTGGAGGG - Intergenic
1074542289 10:114374832-114374854 GGGCAGAGGGAGGGAGGGGGTGG + Intronic
1074695169 10:116044021-116044043 GGAGAGAGAGAGAGTGAGGGAGG - Intergenic
1074785801 10:116838369-116838391 GCCCAGAGTGAGAGTGTGTGTGG + Intergenic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1075546118 10:123356129-123356151 GGAAAGAGAGAGAGTGGGGGCGG + Intergenic
1075788347 10:125065611-125065633 GGCCGGAGGGAGAAAGTGGGAGG + Intronic
1076064713 10:127440141-127440163 GGTGAGAAAGAGAGTATGGGTGG + Intronic
1076402639 10:130193831-130193853 AGTCAGAGGGAGAGCATAGGGGG - Intergenic
1076707532 10:132309817-132309839 GGTCAGAGGGAGAGGAGGAGAGG - Intronic
1077140465 11:1022046-1022068 GGGCAGAGGGAGCGAGTGAGGGG - Intronic
1077140475 11:1022083-1022105 GGGCAGAGGGAGCGAGTGAGAGG - Intronic
1077140490 11:1022152-1022174 GGGCAGAGGGAGCGAGTGAGGGG - Intronic
1077140500 11:1022189-1022211 GGGCAGAGGGAGTGAGTGAGGGG - Intronic
1077383457 11:2258110-2258132 GGACTGAGGGAGAGTGGGAGAGG + Intergenic
1077500681 11:2908545-2908567 GGCCAGAGAGAGAGTGTGACTGG + Intronic
1078086207 11:8234332-8234354 GGCTGGAGGGAGAGAGTGGGAGG - Intronic
1078406650 11:11075654-11075676 TGGGAGAGGGAGGGTGTGGGTGG + Intergenic
1078432687 11:11300019-11300041 GGGCAGAGGGAGAGTCAAGGAGG + Intronic
1078536129 11:12175892-12175914 GGCCAGAGAGAGAGTGGGGTTGG + Intronic
1078609631 11:12809224-12809246 GGTCAGAGCTAGACTGTGAGTGG - Intronic
1079346745 11:19659313-19659335 GTTCAGATGGAGTGTGTGGTGGG + Intronic
1080885404 11:36363146-36363168 GGTGAGAGGGAAAGAGTGGCCGG + Intronic
1081119927 11:39254425-39254447 AGGCAGAGAGAGAGGGTGGGGGG + Intergenic
1081687986 11:45056041-45056063 GGAGAGAGAGAGAGTGAGGGGGG + Intergenic
1081775944 11:45675959-45675981 GGGCAGAGGGAGAATGTCAGGGG + Intergenic
1082798468 11:57395880-57395902 GGTCTGAGGGAGAGAATGGTGGG - Intronic
1082807262 11:57459070-57459092 GGTCCGAGAGAGAGTGAGGGAGG + Intergenic
1082975302 11:59064512-59064534 GGTTACAGGGAGAGGGTTGGAGG + Intergenic
1082979733 11:59108248-59108270 GGTTACAGGGAGAGGGTTGGTGG + Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083261034 11:61523296-61523318 GGTTAGAGGGACCGTGGGGGAGG + Intronic
1083861966 11:65424997-65425019 GGTTAGAGATACAGTGTGGGTGG + Intergenic
1084304283 11:68271724-68271746 GGGCAGTGGGAGAGTGAGTGGGG - Intronic
1084486713 11:69452399-69452421 GCAGTGAGGGAGAGTGTGGGAGG + Intergenic
1084534946 11:69751094-69751116 TGTGAGAGGGAGTGTCTGGGAGG + Intergenic
1085044843 11:73346777-73346799 GGGCAGGGAGAGGGTGTGGGCGG + Intronic
1085242305 11:75068196-75068218 GCTCAGGGAGAGAGGGTGGGTGG - Intergenic
1085305303 11:75482398-75482420 GATCAGAGGCAGAGCCTGGGTGG - Intronic
1085438110 11:76528870-76528892 GGTCAGAGGTAGACTGTAAGTGG + Intronic
1086304974 11:85470055-85470077 TGTCAGAGGAACAGTGTGGATGG - Intronic
1087939547 11:104078480-104078502 GGAAAGAGGGAGAGAGTGGTAGG - Intronic
1089076845 11:115745308-115745330 GGCCAGAGTGAGAGTATGCGTGG + Intergenic
1089295044 11:117462290-117462312 TCTCAGAGGGAGAGTGTGACTGG - Intronic
1089301486 11:117501653-117501675 TGTGAGAGGGAGTGTGTGTGTGG + Intronic
1089345972 11:117792130-117792152 GGACAGAGGTAGAGAGGGGGAGG - Intronic
1091382353 12:70082-70104 GGCCAGAGGAAGAATGAGGGAGG - Intronic
1091559962 12:1604751-1604773 GGTCAGAGTGTGTGTGTGGGGGG + Intronic
1091713376 12:2758848-2758870 GCTCAGGGGGAAAGGGTGGGAGG + Intergenic
1092021609 12:5207240-5207262 TGACAGAGGGTGAGGGTGGGAGG + Intergenic
1092030363 12:5278622-5278644 GATGTGAGGGAGAGAGTGGGCGG - Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092112052 12:5970860-5970882 GGTCAGAAGGATAAGGTGGGTGG - Intronic
1092243399 12:6849485-6849507 GGTCCATGGGTGAGTGTGGGAGG - Intronic
1093578455 12:20763538-20763560 AGGCTGAGGGATAGTGTGGGAGG - Intergenic
1093665770 12:21811173-21811195 GGAAAGAGGGAGAGTGAAGGGGG - Intronic
1094106548 12:26817857-26817879 GGGCAGAGGGAGGGTGGGGGAGG + Intronic
1094271597 12:28623356-28623378 AGTCAGGGGGAAAGGGTGGGAGG + Intergenic
1095658099 12:44695083-44695105 GGGCAGAGGAAGAGAGGGGGAGG + Intronic
1096077259 12:48813651-48813673 GGTCAGCAGGGGAGTGTAGGTGG + Intergenic
1096220011 12:49823225-49823247 GGTCAGAGGCAGAGGGCAGGGGG + Intronic
1096873842 12:54611963-54611985 GGTGAGAGGGGGAGTCAGGGAGG - Intergenic
1097232878 12:57522940-57522962 GGTGAGTGGGAGGGGGTGGGAGG - Exonic
1097270622 12:57771942-57771964 GGGCAGAGGGAGAGAGAGGAGGG - Intronic
1097502965 12:60429279-60429301 GGTCAGTTGCAGAGTGTGAGAGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098071053 12:66675186-66675208 AGACAGAGAGAGAGGGTGGGTGG + Intronic
1098929970 12:76400160-76400182 TTTCAGAGGGTGAGGGTGGGAGG - Intronic
1099475473 12:83103485-83103507 GGAGAGAGTGAGAGTGAGGGAGG + Intronic
1099784222 12:87239391-87239413 GTTGGGAGGGAGAGTGGGGGTGG + Intergenic
1100448020 12:94678967-94678989 GGTCAGAGGGCGTTTGTGGAAGG - Intergenic
1101262191 12:103044548-103044570 GGTCAGAGGGAGGTAGTGTGTGG + Intergenic
1102186548 12:110951904-110951926 AGACAGAGGGAGAGGGAGGGGGG + Intergenic
1102262968 12:111456218-111456240 GGCCAGATGGAGAGCCTGGGCGG + Exonic
1102283900 12:111639654-111639676 GGCCAGTGGGTGAGGGTGGGAGG + Intergenic
1102458820 12:113087577-113087599 GGAGAAAGGGAGAGGGTGGGGGG + Intronic
1102638753 12:114347674-114347696 GGACAGAGGGAGATGGTGGCTGG - Intergenic
1102973337 12:117188994-117189016 AGCCAGAGAGAGAGTGGGGGTGG - Intronic
1103037327 12:117667125-117667147 GGGAAGAGGGAGAGAGAGGGCGG + Intronic
1103900953 12:124303423-124303445 GGGCAGCAGGACAGTGTGGGGGG - Intronic
1103950105 12:124545786-124545808 GGTCAGGGTGAGGGTGGGGGTGG + Intronic
1103974871 12:124695951-124695973 GGTAAGAGGGAGAGTGCTTGAGG + Intergenic
1104091513 12:125521611-125521633 GGCCAGAGGGTGAGGGTGGAGGG + Intronic
1105290988 13:19053292-19053314 GGTCAGAGGAAGAGTGGTCGGGG - Intergenic
1105430501 13:20333008-20333030 GGTCAGGGGGAGACAGTGTGGGG + Intergenic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1106821414 13:33468577-33468599 GATGAGAGAGAGAGTGGGGGAGG - Intergenic
1107315701 13:39129338-39129360 AGGCAGAGGGAGCGTTTGGGAGG + Intergenic
1107727972 13:43319012-43319034 GGAGAGAGGGAGAGAGAGGGAGG + Intronic
1108288226 13:48929805-48929827 AGATATAGGGAGAGTGTGGGAGG - Intergenic
1108707570 13:53003457-53003479 GTTCAGAGGGTGGGAGTGGGTGG - Intergenic
1109134681 13:58632574-58632596 GCTCAGAGGGCTAGGGTGGGAGG - Intergenic
1111669177 13:91306526-91306548 GGAGAGAGGGAGAGTGAAGGGGG - Intergenic
1112751023 13:102583361-102583383 GGTGAGATGGAGGGTGTGAGGGG + Intergenic
1113454888 13:110441315-110441337 GGTCAGAAAGCGAGTCTGGGAGG - Intronic
1113531662 13:111031973-111031995 GGTCAGCTGGGGAGTGTGGAGGG + Intergenic
1113695236 13:112341566-112341588 GGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113755978 13:112811274-112811296 CGGCAGAGGGAGGGTGTGTGTGG - Intronic
1113890582 13:113733194-113733216 GGGCAGAGGGAGAGCCTTGGGGG - Intronic
1113947022 13:114050090-114050112 GGTCAGAGGGAGAGAGGAAGAGG + Intronic
1114597640 14:23926861-23926883 CGGCAGAGGAAGAGTGTGAGTGG - Intergenic
1114617814 14:24077542-24077564 GGTGAGAGGAAGAGTAGGGGAGG - Intronic
1115728080 14:36238884-36238906 GGTGTGAGGGACAGTGTGGGTGG + Intergenic
1117480727 14:56141641-56141663 GGTCAGCGGGAGAGAGAGTGAGG + Intronic
1118164412 14:63321860-63321882 AGTCAGAGAGAGAGTGCGGAAGG + Intergenic
1118450785 14:65900160-65900182 GGTGAGAGAGAGAGTGAGAGAGG - Intergenic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119737743 14:76994596-76994618 GGTGTGCAGGAGAGTGTGGGTGG - Intergenic
1119901520 14:78264470-78264492 GGTCAGTGGCAGAGTTGGGGAGG + Intronic
1121210810 14:92206969-92206991 AATGAGAGGGAGGGTGTGGGTGG + Intergenic
1121679053 14:95777373-95777395 AGTCTCAGGGAGTGTGTGGGTGG + Intergenic
1121697935 14:95928252-95928274 GGGCAGAGGGAGAGGGAGAGAGG - Intergenic
1121702853 14:95969030-95969052 GGCCAGAGGGAGGGGGTGGTGGG - Intergenic
1121880696 14:97498059-97498081 GGTCAGAGGGAGTTGGTTGGGGG + Intergenic
1122407508 14:101509110-101509132 AGGCAGAGGGAGAGTGAAGGCGG - Intergenic
1122785715 14:104162512-104162534 GGCCAGAGGGAGATTGAGGCTGG - Intronic
1122827698 14:104378852-104378874 AGTCAGAGGGGGAGGGTGCGGGG + Intergenic
1123185237 14:106510449-106510471 AGTCAGAGGGAAAGTGAGTGAGG - Intergenic
1124511059 15:30326255-30326277 GGTGAGAGAGAGAGTGAGAGAGG - Intergenic
1124533586 15:30525659-30525681 GGGCTGAGGGAATGTGTGGGTGG - Intergenic
1124765069 15:32481986-32482008 GGGCTGAGGGAATGTGTGGGTGG + Intergenic
1125098136 15:35878284-35878306 GGAGAGAGGAAGAGTGTGGCAGG - Intergenic
1125751246 15:42030578-42030600 TGTGAGAGGGAGATGGTGGGAGG + Intronic
1125778599 15:42242530-42242552 GGAGAGAGGGAGAGGGAGGGAGG + Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126227652 15:46289861-46289883 GGGAAGAGGGAGGGTGTGGGTGG + Intergenic
1126568971 15:50129452-50129474 TGATAGAGGGAGAGTGTGGAGGG - Intronic
1127550189 15:60029925-60029947 GGTCAGAGAGAGGGTGGTGGTGG - Intronic
1128122404 15:65162152-65162174 GGTCCGATGGAGGGTGTGGAAGG - Intronic
1128311015 15:66631842-66631864 GGTCAGAGGGGGAATGTGACTGG + Intronic
1128374718 15:67066444-67066466 GGGAAGAGGGAGAGAGAGGGAGG + Intronic
1128511013 15:68313930-68313952 GGTCTGAGGCAGACTGTGGAAGG + Intronic
1128647269 15:69386971-69386993 GGCCAGAGGGTGGGCGTGGGTGG - Intronic
1128666568 15:69542517-69542539 GGGCAGAGCGAGAGGGTGGAAGG + Intergenic
1128812765 15:70584674-70584696 GGCCAGAGGGGAAGTGTGGGAGG + Intergenic
1129250157 15:74304343-74304365 GGTCAGAGGGAGAGGCCTGGGGG - Intronic
1129389809 15:75214866-75214888 GGACAAAGGCAGGGTGTGGGAGG - Intergenic
1129461363 15:75701608-75701630 GGCCAGAGGGAGTGTGGTGGCGG - Intronic
1129714414 15:77838656-77838678 GGCCAGAGGGTGATTGCGGGTGG - Intergenic
1129723471 15:77890199-77890221 GGCCAGAGGGAGTGTGGTGGCGG + Intergenic
1129784390 15:78299482-78299504 GGCCAGAGGGCGAGTGAGCGAGG - Intronic
1130306327 15:82714308-82714330 TTTCAGAGGGAGAGTCGGGGTGG - Intergenic
1130360459 15:83180014-83180036 GGGCAGAGGGAGGTGGTGGGTGG + Intronic
1130536166 15:84786520-84786542 GGTCAGAGGTTGAGTTTGGCGGG + Intronic
1130917749 15:88319072-88319094 GGTCAAGAGGAGAGTGTGGCAGG + Intergenic
1131220968 15:90583737-90583759 GGGCAAAGGAAGAGTGTTGGGGG + Intronic
1131366500 15:91846308-91846330 GGGGAGAGGGAGAGGGAGGGAGG - Intergenic
1131512674 15:93057836-93057858 CTTCAGAGGGAGAGATTGGGGGG + Intronic
1131641538 15:94298910-94298932 GGAAAGAGGGAGAGGGAGGGAGG - Intronic
1132029356 15:98427660-98427682 GCTAAGAGGGAGAAAGTGGGCGG + Intergenic
1132237580 15:100233760-100233782 TGTCAGGGGGAGAGTGTGCCGGG + Intronic
1132255759 15:100374154-100374176 GGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1132421773 15:101676154-101676176 GGGCAGAGGGGCAGTGTGGTAGG + Intronic
1132586875 16:709451-709473 GGGCAGGGGCAGTGTGTGGGGGG - Intronic
1132753775 16:1471949-1471971 GGACAGAGGGAGTGTGTGTTTGG - Intronic
1132843244 16:1988683-1988705 GGTCAGAGGGAGAGAGAGGAGGG + Intergenic
1132995210 16:2819151-2819173 GGCCAGAAGGAGAGTGTGAGAGG + Intronic
1133027661 16:2995675-2995697 GGGCTGGGGGAGAATGTGGGTGG + Intergenic
1133371570 16:5249319-5249341 GGTCTGAGGGACAAGGTGGGGGG - Intergenic
1133950022 16:10383809-10383831 GCTAAGAGAGATAGTGTGGGAGG - Intronic
1134095710 16:11417111-11417133 GGACAGAGGGTGAGGGGGGGTGG - Intronic
1134316934 16:13127295-13127317 GGAGAGAGAGAGAGTGAGGGAGG + Intronic
1134587925 16:15428073-15428095 GGTGAAGGGGAGGGTGTGGGGGG + Intronic
1135128569 16:19832827-19832849 GGAGAGAGAGAGAGTGAGGGGGG + Intronic
1135562898 16:23490042-23490064 TGTCAGAGGGATAGGGTGGCGGG - Intronic
1136295678 16:29300824-29300846 AGACAGAGTGAGTGTGTGGGAGG + Intergenic
1136417854 16:30114381-30114403 GGGCAGAGGTGGAGGGTGGGGGG - Exonic
1136573371 16:31109457-31109479 GGCGGGAGGGAGAGTGTTGGGGG + Intronic
1137377877 16:47969656-47969678 AGGCAGAGGAAGAGGGTGGGAGG - Intergenic
1137787675 16:51151700-51151722 GGGGAGAGGGAGAGAGCGGGGGG - Intergenic
1137918924 16:52465490-52465512 GGTCAGGTGGAGGGTTTGGGGGG + Intronic
1138439743 16:57026862-57026884 GGTCAGTGGGAAATTGTGGAAGG - Exonic
1138695422 16:58808495-58808517 GGTCAGGGGATGAATGTGGGAGG + Intergenic
1139351400 16:66338468-66338490 AGAAAGAGGGAGAGTGGGGGAGG + Intergenic
1139394583 16:66630320-66630342 GGGGAGAGGGAGAGGGAGGGGGG - Intronic
1139434300 16:66927143-66927165 TGGCAGAGGGCGAGGGTGGGGGG + Intergenic
1139953130 16:70681454-70681476 GGGCAGAGGCACAGTGTGGAGGG + Intronic
1140697762 16:77551817-77551839 GAAGAGAGGGAGAGGGTGGGAGG + Intergenic
1141001135 16:80309380-80309402 GGTCAGAACAACAGTGTGGGTGG - Intergenic
1141132752 16:81446425-81446447 GGTCGAGGGGAGAGTGGGGGTGG + Intronic
1141278368 16:82608089-82608111 GGCCAGAGGGCTAGTGTGGGAGG + Intergenic
1141886277 16:86894535-86894557 GCACAGAGGGAGAGGGTCGGGGG - Intergenic
1142101592 16:88275011-88275033 AGACAGAGTGAGTGTGTGGGAGG + Intergenic
1142280941 16:89147250-89147272 GGTCACAGAGTGAGTGAGGGAGG + Intronic
1142280984 16:89147390-89147412 GGTCACAGAGTGAGTGAGGGAGG + Intronic
1142280992 16:89147420-89147442 GGTCACAGAGTGAGTGAGGGAGG + Intronic
1142281000 16:89147450-89147472 GGTCACAGAGTGAGTGAGGGAGG + Intronic
1142360687 16:89625145-89625167 GGTCAGGGGGAGAGAGTCCGAGG - Intronic
1143015169 17:3887734-3887756 GGTGAGAGGGACAGTGAGTGGGG + Intronic
1143890570 17:10099207-10099229 GGGCAGAGGGAGGGTTTGGATGG - Intronic
1144081740 17:11769454-11769476 GGTGAGAAGGGGCGTGTGGGAGG - Intronic
1144100888 17:11941331-11941353 GGACAGAGGGAGAGAGGGGAAGG - Intronic
1144779037 17:17798760-17798782 GGTGAGTGGGAGAGTGGCGGTGG - Intronic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145026902 17:19475322-19475344 GGGGAGAGGGAGAGGGAGGGGGG - Intergenic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1145416658 17:22718881-22718903 GAGCAGAGGGAGTGTGTGGCTGG - Intergenic
1145786242 17:27595688-27595710 GGGCAAAGGGAGAATGTGGGGGG - Intronic
1145815615 17:27793184-27793206 GGACAGATGGGGAGGGTGGGGGG + Intronic
1146127119 17:30238467-30238489 GCTCAGAGGGAGGGAGTGGGAGG - Intergenic
1146178062 17:30679471-30679493 GGACAGAGGGGGAGGATGGGGGG + Intergenic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146636539 17:34510318-34510340 GGTGGGAAGGAGAGAGTGGGTGG + Intergenic
1146804262 17:35852641-35852663 GGTTTGAGGGAGAGAGTGGAGGG + Intronic
1146829659 17:36057703-36057725 GGGCAGAGGAAGAGAGAGGGAGG - Intergenic
1146925432 17:36741177-36741199 TGTGAGAGAGAGTGTGTGGGTGG + Intergenic
1146946818 17:36878823-36878845 GGACAGAGAGAGAGAGAGGGAGG - Intergenic
1147167625 17:38601874-38601896 GGTCAGAGGGAGGAAGGGGGAGG + Intronic
1147203988 17:38823718-38823740 GGTTAGAGGGAGAAAGAGGGAGG - Intronic
1147239292 17:39080030-39080052 TGACAGAAGGAGAGTGTGGCTGG - Intronic
1147622154 17:41875402-41875424 GGGGAGAGGGAGAGGGAGGGGGG - Intronic
1147649110 17:42051844-42051866 TGTCAGAGGCAGACGGTGGGTGG - Intronic
1148138653 17:45312263-45312285 GGTGAGAGGCAGAGTGTGCCTGG - Intronic
1148554263 17:48568731-48568753 GGACAGAGGGAGAGAGGGAGAGG + Intronic
1148554267 17:48568739-48568761 GGAGAGAGGGAGAGGGAGGGAGG + Intronic
1148555055 17:48573641-48573663 GGTCAGAGGGAGAGAAAGAGGGG - Intronic
1148628442 17:49088325-49088347 GGAGAGAGGGAGAGGGAGGGAGG + Intergenic
1148783064 17:50132375-50132397 GGACAGACGGGGAGTGGGGGAGG + Intergenic
1148796612 17:50200254-50200276 GGTGAGAGGGGGAGGGCGGGGGG + Intronic
1148823997 17:50378684-50378706 GGGCAGAGCCAGAGGGTGGGAGG + Intronic
1150337857 17:64343363-64343385 GCACAGAGGGAGAGTGAGTGTGG - Intronic
1150477982 17:65488584-65488606 GGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150488326 17:65559272-65559294 GCGCAGAGGGAGGGGGTGGGTGG - Intronic
1151210912 17:72543218-72543240 GGTCTGAGGGAGAGTCTTGGGGG - Intergenic
1151536251 17:74740555-74740577 GGTCAGAGGGAGAGCCTAGGAGG + Intronic
1151852748 17:76700804-76700826 GGAGAGAGAGAGAGAGTGGGCGG + Intronic
1151882885 17:76905444-76905466 GATCAGAGGGAGAGAGGGGTAGG + Intronic
1151933620 17:77248201-77248223 GGTTAGTGGGAGAGTGGGGGAGG - Intergenic
1152057197 17:78039316-78039338 GGTAAGAGGTAGGGAGTGGGGGG - Intronic
1152623657 17:81378856-81378878 GGTGAGGGGGAGAGTGGGGTGGG - Intergenic
1152650760 17:81491615-81491637 GGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1152923472 17:83077394-83077416 GGTCAGGGAGAGGGTGTGTGGGG - Intergenic
1153471421 18:5450472-5450494 GGTGAGGGGAAGAGTGTGAGGGG + Intronic
1153661918 18:7333042-7333064 GGTCACAGAGAGGGTGTGGCAGG + Intergenic
1154489452 18:14908555-14908577 GGTCAGAGCGAGAGGGTTAGGGG - Intergenic
1155125356 18:22870014-22870036 TGTCAGAGGCGGAGTGGGGGAGG + Intronic
1155361754 18:25010143-25010165 ACTCAGAGGGAAAGGGTGGGAGG + Intergenic
1155364169 18:25033786-25033808 GGGGAGAGGGAGAGAGGGGGGGG + Intergenic
1155441332 18:25865574-25865596 GGTAAGAGGTGGCGTGTGGGGGG + Intergenic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1155941043 18:31802388-31802410 GGTGAGGGGGAGAATGTGGAGGG - Intergenic
1157191638 18:45586832-45586854 GATCAGAGGGGGAGTCTTGGGGG + Intronic
1157366078 18:47065431-47065453 GGTATGGGGGAGAGTGTCGGGGG + Intronic
1157582249 18:48780489-48780511 GGCTGGAGGGAGACTGTGGGAGG + Intronic
1157603321 18:48909124-48909146 TGTCAGCGGGAGGGGGTGGGAGG - Intergenic
1157692003 18:49691456-49691478 GGCGAGAGGAAGAGTGTGTGGGG + Intergenic
1157701420 18:49763332-49763354 GGACTGAGGGAGAGTTAGGGAGG - Intergenic
1158138317 18:54229821-54229843 GGTTGGGGTGAGAGTGTGGGTGG - Intergenic
1158661921 18:59396194-59396216 GGTCAGATTCCGAGTGTGGGGGG - Intergenic
1159653146 18:71000705-71000727 GGAGAGAGGGAGAGGGAGGGAGG + Intergenic
1160105472 18:75970501-75970523 GTACAGAGGGAGGGTGTGAGAGG - Intergenic
1160697816 19:493207-493229 GGTCGCAAGGAGAGTGGGGGAGG - Intronic
1160789515 19:917156-917178 GGTCGGAGTGAGAGCGCGGGAGG - Intergenic
1161255238 19:3305176-3305198 GCTCGGAGGGAGACTGTGAGGGG + Intergenic
1161845571 19:6710100-6710122 AGAGAGAGGGAGAGTGAGGGGGG + Intronic
1161938309 19:7385959-7385981 GGAGAGAGGGAGAGAGGGGGAGG - Intronic
1162324987 19:9993605-9993627 GGCCAAAGGGTGAGTGTGTGAGG - Exonic
1162735558 19:12745256-12745278 GGCCAGAGGGAGCCTGTGGTGGG - Intronic
1162922750 19:13913137-13913159 GGGCAGGGGCACAGTGTGGGTGG - Intronic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1163114438 19:15180659-15180681 GGTGAGTGGGAGCATGTGGGCGG - Exonic
1163184434 19:15628217-15628239 GGTCAGAGGGAGGTGGTGAGAGG + Intronic
1163283475 19:16331526-16331548 GGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1163390446 19:17027095-17027117 GAGGAGAGGGAGAGTGGGGGCGG - Intergenic
1163476017 19:17526693-17526715 GGTGGGAGGGACAGTGTTGGGGG + Intronic
1163675382 19:18653272-18653294 GGTAAGAAGGAGTGAGTGGGTGG - Intronic
1163826981 19:19529338-19529360 GGAGAGATGGAGAGTGGGGGTGG - Intronic
1165121599 19:33562582-33562604 GGCCAGAGGGAGAGTGGCGGGGG + Intergenic
1165749413 19:38251162-38251184 GGAGAGAGGGAGGTTGTGGGGGG + Intronic
1165817191 19:38649347-38649369 GGTGAGTGGGTGTGTGTGGGGGG + Intronic
1165999768 19:39871065-39871087 GGTCAGGGCCAGGGTGTGGGGGG + Intronic
1166329093 19:42068567-42068589 GCTCAGAGGCAGAGAGAGGGAGG + Intronic
1166503589 19:43357928-43357950 GTTGAGAGGGAGAGTGTGTGTGG - Intronic
1166504476 19:43362359-43362381 GGTCAGAGGGAGGTTGAGTGTGG - Exonic
1166506865 19:43376833-43376855 GTTGAGAGGGAGAGTGTGTGTGG + Intergenic
1166557060 19:43707285-43707307 GTTCAGAGAGAGAGGGTGGGAGG - Intergenic
1166877915 19:45909112-45909134 GGTGAGAGGCAGATTGTGTGGGG + Intergenic
1167090322 19:47339636-47339658 TGCCAGAGGGAGAGGGTGAGAGG - Intronic
1167721442 19:51182813-51182835 GGAGGGAGGGAGAGTGTGGGTGG + Intergenic
1167763534 19:51463957-51463979 GGAGGGAGGGAGAGTGTGGGTGG - Intergenic
1167799356 19:51730162-51730184 AGACAGAGGGAGAGGGAGGGAGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168720795 19:58554031-58554053 GGCCAGATGGTGAGTGTGGGTGG - Exonic
1202711366 1_KI270714v1_random:21004-21026 GGGCAGGGTGAGAGAGTGGGTGG - Intergenic
925916230 2:8608406-8608428 GGACAGAGGGCCAGTGTTGGTGG - Intergenic
925971624 2:9110478-9110500 GGTCAGTGGGGGTGTGTGTGTGG - Intergenic
926403107 2:12520368-12520390 TGTCAGTGGGAGAGGGAGGGAGG + Intergenic
926558841 2:14392984-14393006 GGTCAGAGGGACAGGGCGGTGGG - Intergenic
926809369 2:16742655-16742677 GGGCTGAGGGAGAGGCTGGGAGG + Intergenic
927088177 2:19690542-19690564 GGAGAGAGGGAGAGAGAGGGAGG + Intergenic
927242793 2:20933152-20933174 GGGGAGAGGGGGAGTGTGGCAGG + Intergenic
927885234 2:26714234-26714256 GCTCAGAGAGGCAGTGTGGGTGG + Intronic
927965636 2:27265931-27265953 GGTCACAGGGAGAATGAGGGAGG + Intronic
928174364 2:29024025-29024047 GGTCAGGGGAAGGGTGGGGGTGG + Intronic
929439363 2:41953215-41953237 GGTCAGTGGGAGAGATTGGGAGG + Exonic
929878987 2:45820411-45820433 GGGGAGAGGGGGAGTTTGGGAGG + Intronic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
930742390 2:54844985-54845007 AGAAAGAGGGAGAGTGTGAGAGG + Intronic
930991360 2:57659749-57659771 GCTTTGAGGGAGAGGGTGGGAGG - Intergenic
932278148 2:70466994-70467016 GGACACAGGGAGAGTGTGGGGGG + Intronic
933567994 2:83974829-83974851 GTTTAGAGGTAGAGGGTGGGAGG + Intergenic
933886525 2:86722728-86722750 GGTCATAGGCAGAGTTTGAGAGG + Intronic
933923655 2:87073977-87073999 GGTCATAGGCAGAGTTTGAGAGG - Intergenic
934884187 2:98010172-98010194 GGTCAGAGGGGTAGGGAGGGAGG - Intergenic
935747813 2:106204602-106204624 GGGCAGGGGGAGCGTGGGGGTGG + Intergenic
936026574 2:109035327-109035349 TGTAAGAGGGAGTGTCTGGGAGG - Intergenic
936471411 2:112801960-112801982 GGTGTGAAGGAGAGTGGGGGTGG + Intergenic
936512921 2:113163076-113163098 GGTTAGAGGGTAAGTGTGAGGGG - Intronic
937936319 2:127248412-127248434 GATCAGATGGAGAAAGTGGGAGG + Intergenic
938043444 2:128095493-128095515 GGACAGGAGGAGAGTGGGGGAGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938878009 2:135554168-135554190 GGGAAGAGGGAGAATGTGGAAGG - Intronic
939106261 2:137952104-137952126 GATCATAGGGAAAGTGTGTGTGG - Intergenic
939234827 2:139477629-139477651 GGACAAAGGGAGAATATGGGAGG + Intergenic
941428628 2:165383890-165383912 AGTCAGAGTGAGAGAGTGAGAGG + Intronic
941615715 2:167716253-167716275 GGGCCGAGGGAGGGTGCGGGGGG - Intergenic
941747115 2:169098555-169098577 GGTCAGAGGGAGGGTTTGGGAGG - Intergenic
941804668 2:169699169-169699191 TGTCAGAGGGTGGGGGTGGGAGG - Intronic
941918027 2:170824600-170824622 GGGCAGGGGGAGAGTGGGTGGGG - Intronic
942069198 2:172300112-172300134 GTTCAGATGGAGAGGGAGGGAGG + Intergenic
943197526 2:184773642-184773664 GGACTGAGGGAAAGAGTGGGAGG + Intronic
943921608 2:193713730-193713752 TTTCAGAGGCAGAGGGTGGGGGG - Intergenic
944478101 2:200127370-200127392 GGTCAGAGAGAGAGTCAGGCAGG - Intergenic
944797772 2:203206387-203206409 GGACAGAGGGAGAGAGGGAGAGG - Intronic
944869070 2:203891901-203891923 GGTCAGAGGGAGAGAGAGGTAGG - Intergenic
945110817 2:206357710-206357732 GTTCAGAGGGAGACTGGGAGAGG + Intergenic
945834426 2:214822085-214822107 GGTCAGAGAGAGAGGGTGGTTGG + Intergenic
946360470 2:219216536-219216558 GGTCAGAAAGAGACTGTGGCTGG - Intronic
947065906 2:226225374-226225396 GGCAAGAGAGAGAGAGTGGGAGG - Intergenic
948632884 2:239313163-239313185 GGTGAGAGGGAGAGACTGGGCGG - Intronic
948741040 2:240046143-240046165 GGGCAGAGGGAGAGTGGAGCTGG + Intergenic
949035537 2:241814273-241814295 GGTGCGAGGGAGGGTGGGGGAGG + Intronic
949070110 2:242019354-242019376 GGTGAGAGGGGGTGTGTGGCTGG + Intergenic
1168743164 20:212324-212346 GGACAGTGGGAAAGTTTGGGAGG - Intergenic
1169015549 20:2289893-2289915 GGCAGGAGGGAGAGTGAGGGAGG - Intergenic
1169034027 20:2435108-2435130 AGTCCAAGGGAGAGTGTGAGTGG + Intergenic
1169189383 20:3648182-3648204 GGTCTGAGAGGGAGGGTGGGTGG - Exonic
1169194280 20:3674901-3674923 GGCAAGAGGGAGGGTGTGGTAGG + Intronic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170243809 20:14198173-14198195 GGTAAGAGGGAGAGAGAGAGAGG + Intronic
1170299640 20:14868773-14868795 GGTTACAGGCAGTGTGTGGGTGG + Intronic
1170436743 20:16338227-16338249 GGTAGGATGAAGAGTGTGGGGGG - Intronic
1170711736 20:18797604-18797626 GGGCAGAGTGAGGCTGTGGGAGG + Intergenic
1171155008 20:22864089-22864111 GGTCATGGGGAGACAGTGGGTGG - Intergenic
1171177947 20:23068266-23068288 GGTCAGAGGGAGGGTGAGTGGGG - Intergenic
1171322439 20:24258252-24258274 GGTCAGAGGTAAAGGGTGAGGGG - Intergenic
1171335012 20:24376515-24376537 GGTCAGAGGGGCATTGGGGGAGG - Intergenic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172578837 20:36030853-36030875 GGTCAGAGGCTGTGTGTGGACGG + Intergenic
1172777579 20:37416414-37416436 GCTCAGAGGGAGAGAGAGAGGGG - Intergenic
1172822776 20:37752805-37752827 GTACAGAGGGAGTGCGTGGGTGG + Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1173330819 20:42074998-42075020 GGTTAGTGGTGGAGTGTGGGGGG - Exonic
1173712927 20:45176213-45176235 GGTGGGAGGGAGGTTGTGGGAGG + Intronic
1173880168 20:46406228-46406250 GGTCGGAGGGAGAAGGAGGGAGG - Intronic
1174812618 20:53660099-53660121 GGACGGCGGGAGAGTGTGGCAGG + Intergenic
1175108958 20:56632373-56632395 TGTCAGAGGGAGAGTTTTGCAGG + Intronic
1175158224 20:56988547-56988569 CTGCAGAGGGACAGTGTGGGAGG - Intergenic
1175809141 20:61848210-61848232 GCTCAGGTGGGGAGTGTGGGAGG - Intronic
1176139390 20:63538347-63538369 GGTCAGTGGGAGGGTGGGGCGGG - Intergenic
1176214726 20:63942609-63942631 GGCCTGAGGAGGAGTGTGGGCGG + Intronic
1176282847 20:64324751-64324773 GGCCAGAGGAAGAATGAGGGAGG + Intergenic
1176367821 21:6044425-6044447 GGTCAGGGGGATTGTGTTGGGGG + Intergenic
1177858762 21:26428253-26428275 GGGGAGAGAGAGAGGGTGGGAGG + Intergenic
1178090695 21:29160068-29160090 GCTCAGATGTAGAGTGAGGGGGG - Intronic
1178516250 21:33249922-33249944 GGTCAGAGGGTAAATGTGGCTGG + Intronic
1179003993 21:37493671-37493693 GGTCAGAGGCAGTGAATGGGAGG + Intronic
1179469772 21:41602782-41602804 GGTGAGAGGGAGGGGGTGAGAGG + Intergenic
1179507486 21:41851541-41851563 GGTGAGAGGCAGTGTGTGTGTGG + Intronic
1179592961 21:42423074-42423096 GGTCAAAGGGAGAGTAAAGGTGG + Intronic
1179755698 21:43494117-43494139 GGTCAGGGGGATTGTGTTGGGGG - Intergenic
1179875116 21:44263131-44263153 GGGCAGAGGGGCAGTGTGGGAGG + Intergenic
1180155860 21:45977239-45977261 GGGAGGAGGGAGAGGGTGGGAGG - Intergenic
1180922076 22:19526141-19526163 AGTAAGAGTGAGAGGGTGGGTGG - Intronic
1181305508 22:21914987-21915009 GGTTAGAGGGTGAGTGGTGGGGG + Intergenic
1181448734 22:23001407-23001429 GGTAATGGGCAGAGTGTGGGGGG - Intergenic
1181453359 22:23038475-23038497 GGTATGAGGGACAGTGAGGGAGG + Intergenic
1181978916 22:26752410-26752432 TGTCAGTGGGAGACTGTTGGGGG + Intergenic
1181992363 22:26847174-26847196 GGTCAGATGGAGAGTGCGTCAGG - Intergenic
1182022427 22:27091891-27091913 GGACAGAGGGACGGTGTGAGGGG + Intergenic
1182066826 22:27436921-27436943 GGTCAGAGGAAGAGTGTTCCAGG - Intergenic
1182095180 22:27621134-27621156 GGTAACAGGGAGGGTGAGGGAGG - Intergenic
1182420403 22:30245994-30246016 GGTCAGCGGGCGAGTGAGGCTGG + Intronic
1182436393 22:30333242-30333264 GGTGAGAGGGAGAGGCAGGGTGG + Exonic
1182464664 22:30506846-30506868 GGGCAGAGTGACAGAGTGGGCGG + Intergenic
1182714017 22:32340748-32340770 GGACAGAGGGACAGTGGGGTGGG + Intergenic
1182763323 22:32740555-32740577 GGTGAGACGCAGAGTGTGGCTGG + Intronic
1183102698 22:35593613-35593635 GGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1183394168 22:37561836-37561858 GGTCTGAAGGAGAGCGGGGGCGG - Intronic
1183474223 22:38026944-38026966 GGCAAGAGGGAAAGTGTGTGTGG + Intronic
1183639312 22:39083544-39083566 GGTCAGAGGGGGAGGTTTGGAGG + Intronic
1183675482 22:39296921-39296943 GGACTGAGGGAGAGTTGGGGAGG - Intergenic
1183709105 22:39491962-39491984 GGCAACAGGGAGAGTCTGGGTGG + Exonic
1184240775 22:43210355-43210377 GGTCCGAGGGCTAGTGTGGGGGG - Intronic
1184445232 22:44543187-44543209 GGGCAGAGGGAGAGTCTGAGAGG - Intergenic
1184907733 22:47500132-47500154 GGTCAGAGAGAGAGAGGAGGTGG + Intergenic
1184943029 22:47782664-47782686 GGACAGGGGAAGAGTGTGTGGGG + Intergenic
1184974777 22:48053218-48053240 GTTCAGAGGTAAATTGTGGGAGG - Intergenic
1184988858 22:48154121-48154143 GGTCAGAGGGAGATTTTCAGAGG + Intergenic
1185284414 22:49993995-49994017 GGTCAGGGGCACAGTGGGGGTGG - Intergenic
949909558 3:8890579-8890601 GGAAGGAGGGAGAGTGGGGGTGG + Intronic
950505296 3:13390906-13390928 GGGCACAGGGAAAGTGTGGGTGG - Intronic
950612732 3:14136690-14136712 GGGGAGAGGGAGTGGGTGGGGGG + Intronic
951567230 3:24023346-24023368 GGACAGACGGTGAGTGTGTGTGG + Intergenic
952145584 3:30528496-30528518 GGTCACTGGGGGAGTGGGGGCGG - Intergenic
952325794 3:32319430-32319452 GGGCATAGGGAGAGAGAGGGAGG - Intronic
952540047 3:34358038-34358060 GGTAAGTGGGACAGGGTGGGTGG + Intergenic
952703656 3:36353310-36353332 GGTCAGGGGAAGAGTGGGAGGGG + Intergenic
953385426 3:42503188-42503210 GGTGAGAGGGAGGATGTGAGGGG + Intronic
953552085 3:43910967-43910989 GGCAAGAGGAAGAGTGGGGGAGG - Intergenic
953823563 3:46230813-46230835 GATCAGAGGGCCAGTGTGGAGGG - Intronic
953930011 3:47001179-47001201 GGTGAGAGGGAAAGTCTGGAGGG + Exonic
953947794 3:47164101-47164123 GGTGAGAGGGAGAGAGCGGCTGG - Intergenic
954363894 3:50136345-50136367 GGTCAGGGAGAGGGGGTGGGTGG - Intergenic
954469849 3:50683842-50683864 GGGGAGAGGGAGTGGGTGGGGGG - Intronic
954639025 3:52087086-52087108 GGATAGAGGGAGAGTGGGGCGGG + Intronic
954876025 3:53803704-53803726 GGCCAGAGGGAGAGTGGAGCTGG + Intronic
956096512 3:65721975-65721997 GGGCAGAGTGAGAATGTGGGAGG - Intronic
957260497 3:77896369-77896391 TGTGAGAGGGAGCATGTGGGAGG - Intergenic
959866510 3:111276528-111276550 TGTGAGAGGGAGAGAGAGGGAGG - Intergenic
960242265 3:115358892-115358914 GGGGAGAGGGAGAGAGAGGGGGG + Intergenic
960955267 3:123027035-123027057 GCACTGAGGGAGAGTGCGGGCGG - Intronic
961004543 3:123396061-123396083 GGTGGGAGGGAGAGGGAGGGAGG + Intronic
961168377 3:124779219-124779241 GGGCAGAGGGCGAGAGTGTGAGG + Intronic
961282747 3:125776369-125776391 GGTCTGAGGGATAAGGTGGGGGG - Intergenic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
961505542 3:127368633-127368655 GGGCAGGGGGAGAGTGAGGTTGG - Intergenic
961684347 3:128618995-128619017 GGTGAGAAGGAGGCTGTGGGAGG - Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
962101064 3:132343307-132343329 GGTCATCGTGAGAGTCTGGGGGG + Intronic
962679341 3:137782420-137782442 GGAGAGAAGGAGAGTGTGAGAGG + Intergenic
962947383 3:140184406-140184428 GGTGAGAGAGAGAGTGAAGGAGG + Intronic
962947563 3:140185680-140185702 GGGCAGATGGAGATGGTGGGGGG + Intronic
963149293 3:142027900-142027922 GCACAGTGTGAGAGTGTGGGTGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
964401319 3:156302288-156302310 GGTAAAAGGGACAGTGTAGGTGG - Intronic
964515577 3:157504267-157504289 GGTAACAGGGAGGGTGGGGGCGG + Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965166175 3:165196232-165196254 GGTCAGACGGCGAAGGTGGGGGG + Intronic
965781366 3:172289465-172289487 GATCAGAAGGGGAGTGTGGTAGG - Intronic
966260763 3:177976000-177976022 GGTCTGAGGTATAGTGTGAGTGG - Intergenic
966344506 3:178963767-178963789 GGTCAGAGGGAGGGGGCTGGAGG - Intergenic
966872839 3:184302881-184302903 AGTCAGAGGTAGAGTCAGGGAGG - Intronic
967034474 3:185637825-185637847 GGTCAGAGCTAGAGGGTGGGGGG + Intergenic
967963521 3:194943263-194943285 AGAGAGTGGGAGAGTGTGGGAGG - Intergenic
968228329 3:196989791-196989813 AGACAGAGGCTGAGTGTGGGTGG + Intronic
968628184 4:1637423-1637445 GGACAGAGGGAGCCTGGGGGAGG + Intronic
968782185 4:2591413-2591435 GGTCATAGGTACAGTGTGAGGGG + Intronic
968808278 4:2788724-2788746 GGGCAGAGGGGGTGTGGGGGAGG - Intergenic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
968997605 4:3955537-3955559 GGTCAGGAGGAGAGTGGTGGTGG + Intergenic
969113696 4:4858855-4858877 GTTCAGAGCGAGGGTGGGGGGGG + Intergenic
969131083 4:4991521-4991543 TGTGAAAGGGTGAGTGTGGGTGG - Intergenic
969480508 4:7444583-7444605 GGTCAGAGGGATCATGTAGGTGG + Intronic
969504471 4:7576159-7576181 GGTCAGAAGGAGAATGTTAGTGG - Intronic
969847317 4:9929632-9929654 GGGCAGAGGGAGGGTGTGAGGGG + Intronic
969967092 4:11008074-11008096 GGACAGAGGGAGTGAGGGGGAGG + Intergenic
970829959 4:20325401-20325423 GGTCAGGGGTAGGGTGGGGGTGG + Intronic
972385472 4:38561573-38561595 AGCAAGAGAGAGAGTGTGGGTGG - Intergenic
972667422 4:41180534-41180556 GGGCAGAGGGAGGGTGAGGCTGG + Intronic
972782465 4:42297878-42297900 GGTAAAAGGAAGAGTGTGAGTGG + Intergenic
972810669 4:42582495-42582517 GGGGAGAGAGAGTGTGTGGGGGG - Intronic
973157998 4:46981756-46981778 GGTAAGAGTGAGAGACTGGGAGG + Intronic
973279655 4:48345462-48345484 GGTCAGATGGAGAGTGTGGTGGG + Intronic
973553307 4:52056763-52056785 GGTCACAGGGTGAGTCTGGTGGG - Intronic
973959742 4:56097758-56097780 TGTTAGATGGAGAGAGTGGGAGG + Intergenic
974139674 4:57868928-57868950 GGACAGAGAGAGACAGTGGGGGG - Intergenic
975166987 4:71187627-71187649 GTTTAGAGGAAGAGTTTGGGTGG + Intronic
975603300 4:76125837-76125859 GGAGAGAGGGAGAGAGGGGGAGG + Intronic
975654249 4:76625492-76625514 AGACAGAGGGAGAGGCTGGGTGG - Intronic
976113694 4:81703630-81703652 GGACAGAGGGAGAAGTTGGGTGG - Intronic
976406971 4:84670869-84670891 TGGGGGAGGGAGAGTGTGGGGGG + Exonic
976772975 4:88674230-88674252 GGTTACAGGAAGAGGGTGGGGGG + Intronic
978660755 4:111123620-111123642 AGACAGAGGGAGAGAGAGGGAGG + Intergenic
978900816 4:113947545-113947567 GGAGAGAGGGAGAGTGAGGGAGG + Intronic
978900828 4:113947592-113947614 GGAGAGAGGGAGAGAGAGGGAGG + Intronic
979988345 4:127343365-127343387 GCTCAGAGAGAGAGAGCGGGGGG - Intergenic
981550153 4:145935945-145935967 GGTTAGAGGGAGGGTGGGAGAGG - Intronic
981716857 4:147760477-147760499 GGGGAGAGGCAGAGTCTGGGTGG + Intronic
981772618 4:148327834-148327856 GGTCAGAGGGTGTATGTGAGAGG - Intronic
982213967 4:153064621-153064643 GCTCAGAGGGAGAGGGTCGTGGG - Intergenic
982230826 4:153206695-153206717 GGTCAGGGGGTGTGTATGGGTGG + Intronic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
984784198 4:183553172-183553194 GGTGAGAGGATGAGTGTGTGTGG + Intergenic
984784216 4:183553320-183553342 GGTGAGAGGATGAGTGTGTGTGG + Intergenic
984784237 4:183553494-183553516 GGTGAGAGGATGAGTGTGTGTGG + Intergenic
985070810 4:186165064-186165086 GGTCAGAGGGAAAGTGAGGCTGG - Intronic
985265268 4:188150968-188150990 GGTGAGAAGGAGAGTGAGAGTGG + Intergenic
985265391 4:188151400-188151422 GGTGAGAGGGGGAGTGAGAGAGG + Intergenic
985272437 4:188206948-188206970 GGTGAGTGGATGAGTGTGGGTGG + Intergenic
986128414 5:4905047-4905069 GGCCACAGGGGCAGTGTGGGTGG - Intergenic
986199818 5:5570486-5570508 GGACAGAGGGAGCATGTGCGGGG + Intergenic
986802805 5:11279277-11279299 GGTGAGAGGGACAGTTTTGGAGG - Intronic
987028750 5:13955203-13955225 GGAGAGAGAGAGAGTGAGGGGGG - Intergenic
987029246 5:13960748-13960770 GGGGAGAGGGTGGGTGTGGGAGG - Intergenic
987192067 5:15488575-15488597 GGGCAGATGGAGAATTTGGGTGG + Intergenic
987482689 5:18478341-18478363 GGGCAAAGAGAGAGTGTGAGAGG + Intergenic
987888390 5:23842160-23842182 GGCTTGAGGGAAAGTGTGGGAGG - Intergenic
988780453 5:34516563-34516585 GGACAGAGGGAGAATGGCGGAGG - Intergenic
988896305 5:35678318-35678340 GGTTAGAAGCAGATTGTGGGTGG - Intronic
989062353 5:37421934-37421956 GGTGGGAGTGAGAGTGTGGGAGG + Intronic
989202069 5:38773643-38773665 AGTCAGAGGCACAGTGTGGCTGG + Intergenic
989579351 5:43017509-43017531 GGGCAGAGGGATGGTGTGGAAGG + Intergenic
990744893 5:58949953-58949975 GGTAAGAGGGAGGGTGGGTGGGG - Intergenic
991133892 5:63158077-63158099 GGTGGGAGGGAGAGAGTGTGGGG - Intergenic
991608139 5:68423502-68423524 GGTCTATGGGAGAGAGTGGGTGG + Intergenic
994019755 5:95009029-95009051 GGTAAGAGTGAGAGTGAGAGAGG + Intronic
994019953 5:95011605-95011627 GGAGAGAGAGAGAGTGAGGGAGG - Intronic
994257069 5:97610081-97610103 GGTCTGAGGGAGATTGGGTGGGG + Intergenic
995528536 5:113070052-113070074 GCTCAAAGGCAGATTGTGGGTGG + Intronic
995919725 5:117296998-117297020 GATCTGATGGAGAGTTTGGGAGG + Intergenic
998204214 5:140147633-140147655 GGACAGAGGGAGTGGGTGTGGGG - Intergenic
998462452 5:142319856-142319878 AGTCAAGGGGAGGGTGTGGGTGG - Intronic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
998816391 5:146018242-146018264 GGAGAGAGGGAGGGTGAGGGTGG - Intronic
999300673 5:150488319-150488341 GGGCTGAGAGAGAGTGTGGTGGG + Intronic
999477729 5:151916685-151916707 GGTCAGAAGGAGAGGGTATGTGG - Intronic
999567714 5:152884066-152884088 AGTTAGAGGGAGAGTGTGGTAGG - Intergenic
1001057918 5:168464655-168464677 GGTCAGAGGAAGAGGCTGGGTGG + Intronic
1001257411 5:170194527-170194549 GAGCAGAGGCAGAGTCTGGGAGG + Intergenic
1001521356 5:172395832-172395854 GGTCAAGGGGAAGGTGTGGGAGG + Intronic
1001858048 5:175029734-175029756 GATCAGAGGGAGAGAGAGGTAGG + Intergenic
1002633357 5:180595230-180595252 TGTGGGAGGGAGAGTGTGGGAGG + Intergenic
1002633361 5:180595244-180595266 TGTGGGAGGGAGTGTGTGGGAGG + Intergenic
1002724664 5:181286566-181286588 GTTTAGAGGGAGAGTGGGGTGGG - Intergenic
1002776561 6:332867-332889 GCGTGGAGGGAGAGTGTGGGAGG + Intronic
1003174558 6:3745277-3745299 GGTCTGCGGGAGAGTGCTGGAGG - Intronic
1003349314 6:5301067-5301089 GGTGGGAGGGAGTGTTTGGGGGG + Intronic
1003445260 6:6178032-6178054 GGCCACAGGGAGAGGGGGGGGGG + Intronic
1003912193 6:10752763-10752785 GGAAAGAGGGAGGGAGTGGGAGG + Intronic
1004097769 6:12575820-12575842 GGTGACAGGGAGAGTGGAGGTGG - Intergenic
1005223978 6:23620131-23620153 GGACAGAGAGAGAGGGAGGGGGG + Intergenic
1005223985 6:23620152-23620174 GGACAGAGAGAGAGGGAGGGGGG + Intergenic
1006300408 6:33190982-33191004 GGCCAGAGGTAGAGTGGTGGAGG - Intronic
1006335245 6:33417149-33417171 GGTCAGAGGGGGAGAGTTGTGGG + Intronic
1006336022 6:33420836-33420858 GGCCAGATGGAGAGAGAGGGAGG + Intronic
1006341289 6:33448565-33448587 GGTCTGAGGGCCAGAGTGGGAGG - Intronic
1006608257 6:35275347-35275369 GGGCAGAGGGGCAGTGAGGGTGG - Intronic
1006836151 6:36999933-36999955 GGTGGGAGGGAGGGTGAGGGAGG - Intergenic
1006836419 6:37001689-37001711 GGTGGGAGGGAGAGAGTGTGAGG + Intergenic
1006906885 6:37538699-37538721 TGTCAGAGCTAGAGTGTGAGGGG - Intergenic
1006910280 6:37559016-37559038 GGTAAGAGGAAAAGTGGGGGTGG - Intergenic
1007069465 6:39025331-39025353 GTCCAGAGGGAGTGTGGGGGAGG - Intronic
1007074985 6:39060625-39060647 GGGCAGAGGGAGAGAGAGGCTGG - Intronic
1007270387 6:40631741-40631763 GGGTACAGGGTGAGTGTGGGTGG + Intergenic
1007305105 6:40897639-40897661 CGGCAAAGGCAGAGTGTGGGTGG - Intergenic
1007554806 6:42756923-42756945 GGAGAGAGGGAGGGTGGGGGGGG - Intronic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1007740464 6:44006509-44006531 GGTCAGAGTGGTAGGGTGGGAGG + Intergenic
1007751348 6:44073640-44073662 GGACAGAGGGAGAGTCCGGGTGG + Intergenic
1008074731 6:47133802-47133824 GAAAAGAGGTAGAGTGTGGGAGG + Intergenic
1008237524 6:49068309-49068331 GGTGAAAAGGATAGTGTGGGTGG + Intergenic
1008656389 6:53618393-53618415 GGTCAGAAGGAAAGCGTGGGAGG - Intergenic
1008774871 6:55026251-55026273 ATTCAGAGGGAAAGGGTGGGAGG - Intergenic
1010622102 6:78089485-78089507 GGAGAGAGGGAGAGGGAGGGAGG + Intergenic
1011101039 6:83722873-83722895 GATCTGAGGGCTAGTGTGGGAGG + Intergenic
1011459487 6:87588807-87588829 TTTCAGAGGGAGAGGGTAGGAGG - Intronic
1012422412 6:99079374-99079396 GGGGAGAGGGAGAGAGGGGGAGG - Intergenic
1012431381 6:99167170-99167192 GGAGAGAGGGAGAGGATGGGTGG + Intergenic
1013268456 6:108523154-108523176 GACCAGTGAGAGAGTGTGGGCGG + Exonic
1013429436 6:110042671-110042693 GGTTAGGGGGAGAATGTGGGAGG - Intergenic
1013563960 6:111337057-111337079 GGCAAGAGGTAGAGGGTGGGGGG + Intronic
1013869476 6:114739771-114739793 AGCAAGAGAGAGAGTGTGGGAGG - Intergenic
1016562986 6:145417972-145417994 GGTGTGAGGGAGGGAGTGGGCGG - Intergenic
1017725493 6:157273854-157273876 GCTGGGAGGGCGAGTGTGGGCGG - Intergenic
1018278535 6:162159062-162159084 GCTCTAAGGGTGAGTGTGGGAGG - Intronic
1018425806 6:163679410-163679432 GGGCAGAGAGAGGGTGTGTGTGG + Intergenic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018697945 6:166405395-166405417 GCTCAGGGGGTGAGGGTGGGAGG - Intergenic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019158174 6:170052728-170052750 GGAGAGAGGGAGAGGGAGGGAGG - Intergenic
1019284900 7:218527-218549 GGTCAGAGGGAGGGCGGGGCAGG + Intronic
1019421224 7:952192-952214 GGTCATGGGGAGAGTTTGGAAGG + Intronic
1019623277 7:2002899-2002921 GGGCAGAGGGAGAGGATGTGGGG - Intronic
1019690103 7:2405638-2405660 GGGCAGTGAGAGAGTGGGGGCGG + Intronic
1019775413 7:2909527-2909549 GGTGAGAGGCAGAGGGTGAGGGG - Intronic
1019790158 7:3006778-3006800 GGAAAGAGGGAGGGAGTGGGTGG + Intronic
1021762410 7:23914238-23914260 GGTGGGAGGGAGCGGGTGGGAGG + Intergenic
1023328409 7:39085737-39085759 GGAGAGAGGGAGAGTGTGTGTGG + Intronic
1023360912 7:39414435-39414457 AGGCAGAGGGAGAGTGGAGGGGG + Intronic
1023601992 7:41889468-41889490 GGGCAGAGGGGGACTGTGAGAGG - Intergenic
1023649976 7:42359483-42359505 AGCTAGAGAGAGAGTGTGGGTGG + Intergenic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1023860940 7:44217460-44217482 GGTGAGAGGGAGAGGAGGGGAGG + Exonic
1023863344 7:44227799-44227821 GGACAGAGGGAGAATGTGAGGGG + Intronic
1024270802 7:47639892-47639914 GGTCAGGGAGTGAGTGAGGGAGG + Intergenic
1024541181 7:50476271-50476293 TGGCAGTGGGAGAGTGAGGGAGG - Intronic
1024854685 7:53764380-53764402 GGCCTGAGGGAGGATGTGGGGGG - Intergenic
1026229801 7:68472875-68472897 GGGCAGAGAGGAAGTGTGGGAGG - Intergenic
1026253603 7:68691691-68691713 GGTCAGAGGGAAGCTCTGGGTGG - Intergenic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1026806103 7:73430407-73430429 GGTTAGAGGGAGGGAGGGGGAGG - Intergenic
1027052883 7:75030859-75030881 GTTCACAGGGAGAGTTTGTGGGG + Intronic
1027217904 7:76196023-76196045 GTTCAGAGGGAGAGTGACTGGGG + Intergenic
1027218999 7:76202165-76202187 GAGCAGAGGGGCAGTGTGGGAGG + Intronic
1027344599 7:77244779-77244801 GGTCAGTGGGAGGGTGTGGAGGG - Intronic
1028394745 7:90355967-90355989 GGCCAGAGGGAGAGGATAGGAGG - Intronic
1029437719 7:100572370-100572392 GGTCAGAGGTATGGTCTGGGGGG + Exonic
1029520561 7:101058908-101058930 GGAGAGAGAGAGAGTCTGGGAGG - Intergenic
1031826170 7:126568497-126568519 AGACAGAGGGAGAGAGAGGGAGG - Intronic
1032063725 7:128747555-128747577 GCTCAGTGGGGGAGGGTGGGAGG - Exonic
1033112551 7:138594356-138594378 TGTGAGAGGGAGATGGTGGGGGG - Intronic
1034264440 7:149774080-149774102 GGTCCGGGGGAGGGTCTGGGAGG + Intergenic
1034285432 7:149880583-149880605 GCTCAGAGAGGGAGTGTAGGGGG - Exonic
1034470771 7:151253289-151253311 GGACGGAGGGAGTGAGTGGGAGG - Intronic
1034564558 7:151902711-151902733 GGTCAGAGGCACAGTGGGGGAGG - Intergenic
1035650024 8:1257190-1257212 GGTGAGCGGGAGAGGGTTGGTGG - Intergenic
1036206041 8:6806326-6806348 GGTGAGAGGGTGAGGATGGGGGG + Intergenic
1036546232 8:9771939-9771961 GGGGAGAGGGAGGGAGTGGGAGG + Intronic
1036685209 8:10904888-10904910 GGTCAGAGAGAGGGTGAGGCAGG - Intronic
1037204735 8:16302847-16302869 GGTGAGAGAGAGAGAGCGGGAGG - Intronic
1037648576 8:20816245-20816267 AGGCAGAGGGAGTGTGAGGGAGG - Intergenic
1037753268 8:21696181-21696203 GGACAGAGGGAGAGGGAGAGGGG - Intronic
1038502206 8:28054607-28054629 GCTCAGAGGGAGAGTGTGAGAGG - Intronic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1039888205 8:41667504-41667526 AGTCAGTGGGAGAAAGTGGGGGG + Intronic
1040421108 8:47241300-47241322 GGTCAGGGTCAGAGTGGGGGGGG + Intergenic
1040936403 8:52786271-52786293 GGTGAGGGGGTGAGTGTGGGGGG + Intergenic
1041236759 8:55811160-55811182 AGTGAGAGAGGGAGTGTGGGTGG + Intronic
1041352353 8:56960400-56960422 TGTCAGAGGGAGAGGGGTGGTGG - Exonic
1042826609 8:72986057-72986079 GGTCATGGGGTGAGGGTGGGAGG + Intergenic
1044115015 8:88325438-88325460 GGTGAGGTGGAGTGTGTGGGAGG - Intronic
1044422522 8:92014525-92014547 GGTGTAAGGGATAGTGTGGGTGG - Intronic
1044714501 8:95088200-95088222 GGTGAGAGGCAGCCTGTGGGAGG - Intronic
1044999833 8:97869461-97869483 GGACAGGGGGAGAGGGAGGGCGG + Intronic
1045295483 8:100868679-100868701 TGGCAGAGGGAGAGAGAGGGAGG + Intergenic
1045473735 8:102536075-102536097 GGCGAGAGGGTGGGTGTGGGTGG - Intronic
1047192805 8:122693645-122693667 GGTCAGAAGGAGAGTGTATTAGG - Intergenic
1047800193 8:128301251-128301273 GCACAGAGGGAAAGTGTGTGTGG + Intergenic
1048810290 8:138279766-138279788 GGTGAGAGGGAGTAGGTGGGTGG - Intronic
1048882555 8:138882815-138882837 AGTGTGAGGGAGAGTGTGTGAGG - Intronic
1048919997 8:139219509-139219531 GGTCAGGGGGAGTGTTTGTGTGG - Intergenic
1049408006 8:142460256-142460278 GGGCAGGGGGTGAGTGTGGCAGG + Intronic
1049435941 8:142586294-142586316 GGCCAGAGGGCCAGAGTGGGTGG + Intergenic
1049742664 8:144248587-144248609 GGTCAGAAGGAGCCTGAGGGAGG + Intronic
1050985641 9:12078668-12078690 GGACAGAGGAAGGGGGTGGGGGG - Intergenic
1051357526 9:16253551-16253573 GTCCAGAGGGAGGGTGTTGGGGG - Intronic
1051835748 9:21335461-21335483 AGTCAGCGGGAGGGTGGGGGTGG + Intergenic
1052072836 9:24104302-24104324 TGTCAGAGGGGGAGAGAGGGAGG + Intergenic
1052100988 9:24446139-24446161 GGTCATAGGCACAGTCTGGGAGG + Intergenic
1053470989 9:38346119-38346141 GGTCAGGTGGAGAGTGTGGTTGG - Intergenic
1053541022 9:38973975-38973997 TGGCTGAGGGAGAGAGTGGGTGG - Intergenic
1053805443 9:41797023-41797045 TGGCTGAGGGAGAGAGTGGGTGG - Intergenic
1054625118 9:67389932-67389954 TGGCTGAGGGAGAGAGTGGGTGG + Intergenic
1055021989 9:71679930-71679952 GGGAAGAGGGTGGGTGTGGGAGG - Intergenic
1055336111 9:75235192-75235214 GGTCAAAGGCCCAGTGTGGGTGG - Intergenic
1056199084 9:84257220-84257242 GTACAGAGAGAAAGTGTGGGAGG + Intergenic
1056382129 9:86064977-86064999 GAACAGAGTGAGGGTGTGGGAGG + Intronic
1056517620 9:87370500-87370522 GGACAGAAGGAGAGCGTGGGTGG + Intergenic
1056864756 9:90219756-90219778 GGTCATATCCAGAGTGTGGGAGG - Intergenic
1058314523 9:103548308-103548330 GGAGAGAGGGAGAGAGAGGGAGG + Intergenic
1058618891 9:106863089-106863111 AGTGAGAGGGAGAGGGAGGGAGG + Exonic
1059414145 9:114153034-114153056 GGGCAGAGGGAGAACCTGGGAGG + Intergenic
1059605578 9:115831307-115831329 GGTCAGAAGGGGAGTGTGTTGGG - Intergenic
1060112013 9:120913314-120913336 GAGCAGAGGGTGAGTGTGGGAGG - Exonic
1060315669 9:122508105-122508127 GGAAGGAGGGAGAGTGAGGGGGG + Intergenic
1060407768 9:123381342-123381364 GGGCAGAGAGAGAGTGGCGGGGG + Exonic
1061642643 9:131971355-131971377 GGACAGGGGGAGAGAGAGGGAGG + Intronic
1061845686 9:133386889-133386911 GAGCAGAGGGAGCGTGTGAGGGG - Intronic
1062147368 9:134997096-134997118 GGTGAGTGGGAGAGTGTGGAGGG + Intergenic
1062379459 9:136280317-136280339 GCTCAGAGGGTGTGTGTGGAAGG + Intergenic
1062416746 9:136455029-136455051 GGTGAGATGGAGAGTCTGGAGGG + Intronic
1062586298 9:137251447-137251469 GGGCTGAGGGACAGTGTGGGGGG + Intronic
1062603476 9:137331365-137331387 GGTGGGAGGGTGAGTGTGGGAGG - Intronic
1062645183 9:137544188-137544210 GGTCAGAGGGGAAGTTGGGGGGG - Intronic
1062715320 9:138007350-138007372 AGTCAGAGGGTGAGTCTGTGGGG + Intronic
1203785475 EBV:125186-125208 GGTAAGAGGGAGATGGGGGGAGG + Intergenic
1185736282 X:2499339-2499361 GTTCAGAGGGTCAGTGTGGTGGG - Intronic
1186080413 X:5924846-5924868 ACTCAGAGGGAAAGGGTGGGAGG + Intronic
1187204564 X:17169907-17169929 GGACAGAGGGAGAGCTTGGAGGG - Intergenic
1187459921 X:19477820-19477842 GGAGAGAGGGAGAGGGAGGGAGG + Intronic
1187738565 X:22329670-22329692 GGTTGGAGTGGGAGTGTGGGAGG - Intergenic
1189301990 X:39958725-39958747 GGGCAGAGGCAGGCTGTGGGTGG - Intergenic
1189377946 X:40480459-40480481 GGTCAGAGGGTGGTTGGGGGTGG + Intergenic
1189489754 X:41461169-41461191 ACTCAGAGGGAAAGGGTGGGAGG - Intronic
1189577862 X:42374856-42374878 GGTCAGAGGGGCAGAGTGGCAGG - Intergenic
1189879652 X:45477085-45477107 GGCCAGTGGGGGAGAGTGGGAGG - Intergenic
1189987221 X:46564627-46564649 AGACAGAGAGAGAGTGTGTGTGG + Intergenic
1190096308 X:47483517-47483539 GGTCAAAAGGCGTGTGTGGGGGG - Intergenic
1190128242 X:47724403-47724425 GGTCAGGGGCAGGATGTGGGTGG + Intergenic
1190157704 X:48007112-48007134 GGGCAGAGGGGGAGTGAAGGGGG + Intronic
1190166064 X:48073680-48073702 GGTCAGAGGGATAGGGATGGTGG + Intergenic
1190173476 X:48129997-48130019 GGGCAGAGGGGGAGTGAAGGGGG + Intergenic
1190732716 X:53235633-53235655 GGACAGATGGAGAGAGTGGTTGG + Intronic
1191670580 X:63745031-63745053 GGGAGGAGGGAGAGAGTGGGTGG + Intronic
1192200087 X:69061129-69061151 GGGCAGTGGGAGTGTGTTGGGGG - Intergenic
1192830364 X:74744958-74744980 GGAGAGAGGGAGAGAGAGGGAGG - Intronic
1194556085 X:95361822-95361844 AGTGAGAGAGAGAGTGGGGGCGG - Intergenic
1194902482 X:99530201-99530223 TGTCAGGGGGAGAGTGGGGAGGG + Intergenic
1195049133 X:101080644-101080666 GGACAGAGGGACAGGGTGGAGGG + Intronic
1197148014 X:123190233-123190255 GGGAAGAGGGGGAGTGAGGGAGG - Intronic
1199083842 X:143606830-143606852 GGTAAGAGAGAGCGTGTTGGAGG - Intergenic
1199555308 X:149101757-149101779 AATCAGAGAGAGAGCGTGGGAGG - Intergenic
1199745184 X:150767985-150768007 GCTCTGAGGGAGAGTGCGTGGGG - Exonic
1199948032 X:152682935-152682957 GGAGAGAGGGAGCGTGTGAGAGG - Intergenic
1199961647 X:152785519-152785541 GGAGAGAGGGAGCGTGTGAGAGG + Intergenic
1200018435 X:153182298-153182320 GGAGAGAGGGAGTGTGTGAGAGG - Intronic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic
1200292026 X:154884480-154884502 GGGCAGGGGGTGTGTGTGGGAGG + Intronic
1200310942 X:155076553-155076575 GGAGAGAGAGAGAGTGAGGGGGG + Intronic
1200338864 X:155380217-155380239 GGGCAGGGGGTGTGTGTGGGAGG + Intergenic
1200347605 X:155460475-155460497 GGGCAGGGGGTGTGTGTGGGAGG - Intergenic
1201268193 Y:12229145-12229167 GGTGAGAGGGAGATGGTGGCAGG - Intergenic
1201550439 Y:15212012-15212034 GGTGAGAGAGAGAGGGAGGGAGG + Intergenic
1202258283 Y:22942791-22942813 AGTCAGAGGGAGAGAGAGAGAGG + Intergenic
1202411273 Y:24576549-24576571 AGTCAGAGGGAGAGAGAGAGAGG + Intergenic
1202459508 Y:25093523-25093545 AGTCAGAGGGAGAGAGAGAGAGG - Intergenic