ID: 1172899972

View in Genome Browser
Species Human (GRCh38)
Location 20:38327566-38327588
Sequence GCTGCCAAAACAACAACCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172899972_1172899976 -2 Left 1172899972 20:38327566-38327588 CCCTGGGTTGTTGTTTTGGCAGC 0: 1
1: 0
2: 6
3: 38
4: 272
Right 1172899976 20:38327587-38327609 GCACACAACTGGTTCCATGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1172899972_1172899979 26 Left 1172899972 20:38327566-38327588 CCCTGGGTTGTTGTTTTGGCAGC 0: 1
1: 0
2: 6
3: 38
4: 272
Right 1172899979 20:38327615-38327637 GCCGAGTCCAACAGGCTTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1172899972_1172899975 -5 Left 1172899972 20:38327566-38327588 CCCTGGGTTGTTGTTTTGGCAGC 0: 1
1: 0
2: 6
3: 38
4: 272
Right 1172899975 20:38327584-38327606 GCAGCACACAACTGGTTCCATGG 0: 1
1: 0
2: 1
3: 7
4: 112
1172899972_1172899978 18 Left 1172899972 20:38327566-38327588 CCCTGGGTTGTTGTTTTGGCAGC 0: 1
1: 0
2: 6
3: 38
4: 272
Right 1172899978 20:38327607-38327629 AGGTCAGCGCCGAGTCCAACAGG 0: 1
1: 0
2: 1
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172899972 Original CRISPR GCTGCCAAAACAACAACCCA GGG (reversed) Exonic
901264674 1:7901766-7901788 GCCACCAAAACAAAAACCCTCGG + Intergenic
901662283 1:10806065-10806087 GTTGACAAAACAAGAACCCCAGG + Intergenic
903314797 1:22494531-22494553 GGTTCCAAAACAGCAACCCATGG - Intronic
903673940 1:25052792-25052814 GCTGCCATAACAAAATACCATGG - Intergenic
904404172 1:30275293-30275315 GCTGCCATCACAACCATCCATGG + Intergenic
904432393 1:30472831-30472853 GCTGCCAGAACCACGAGCCACGG - Intergenic
905331491 1:37203604-37203626 GCTGCCAAAGCAAGCACCCAAGG - Intergenic
905881190 1:41464922-41464944 GCTGCCATAACAAAATACCATGG - Intergenic
906854921 1:49293424-49293446 GCCAGAAAAACAACAACCCAAGG + Intronic
907652009 1:56304055-56304077 GCTGCAAAAACAGTGACCCATGG + Intergenic
907963226 1:59302897-59302919 GCCCCCAAAACAACAACTCCAGG - Intronic
909639231 1:77853415-77853437 GCTGCAGAAACTACAACCAAAGG + Intronic
910010307 1:82453159-82453181 TCTGCCAAAACTACTATCCATGG + Intergenic
910419661 1:87045147-87045169 GCTGCCAAAAGCATAACCAATGG - Intronic
910975366 1:92900897-92900919 GCTGCACAAACATCAACACATGG - Intronic
911497512 1:98649920-98649942 GCTGGCAAAGCAACACCCCAAGG - Intergenic
912877840 1:113380247-113380269 GCTGCCATAACAAAATACCATGG + Intergenic
916965970 1:169944009-169944031 GGTGGCAAAGCAACACCCCAAGG - Intronic
920197596 1:204239499-204239521 TCTGCCAAGACAACCATCCATGG + Intronic
921625533 1:217374112-217374134 GCTGGCAAAGCAACACCCCAAGG + Intergenic
921766788 1:218982536-218982558 GTTGGCAAAGCAACACCCCAAGG - Intergenic
923577197 1:235170152-235170174 GCTGGCAAAAAAACTACCCCAGG + Intronic
923689373 1:236177524-236177546 ACTGCCACAGCAACTACCCAAGG - Intronic
1063108188 10:3012159-3012181 GCTGCTAAAACAAAATGCCACGG - Intergenic
1064010476 10:11731162-11731184 GGTGGCAAAGCAACACCCCAAGG + Intergenic
1064967673 10:21031275-21031297 GCTGCCACCACAACTACCCCAGG + Intronic
1065201307 10:23315989-23316011 GCTGGCAAAGCAACACCCCAAGG - Intronic
1065756777 10:28937864-28937886 CCTGCCTCAACAACAACCTATGG - Intergenic
1066166867 10:32798085-32798107 TCTGCCAAAACTACTATCCATGG - Intronic
1067324474 10:45253818-45253840 GCTCCCAACTCAAGAACCCAGGG - Intergenic
1069040667 10:63692492-63692514 GCAGCCAAGACAACAGCCAAAGG - Intergenic
1069190922 10:65488691-65488713 TATGCCAAAACAAAAGCCCAAGG + Intergenic
1069232981 10:66035344-66035366 GCTGCCAAAATACCACCCAAAGG - Intronic
1069756865 10:70778805-70778827 ACTGCCACAACCACCACCCATGG - Intronic
1071053074 10:81474251-81474273 GCTGCTGAAGCAACACCCCAAGG + Intergenic
1075125318 10:119694646-119694668 GCTGGAAAAACGACACCCCAAGG - Intergenic
1077258387 11:1600688-1600710 GCTGCCATAACAAAATACCACGG + Intergenic
1077938998 11:6819350-6819372 GCTGGCAAAACAACATCCCAAGG + Intergenic
1080706841 11:34702673-34702695 GCTGGCAAAGCAACATCCTAAGG + Intergenic
1081351732 11:42061905-42061927 GCTGCCATAACAAAATGCCATGG - Intergenic
1083482946 11:62961380-62961402 GCTGCCATAACAAAATACCACGG - Intronic
1085212036 11:74790464-74790486 GCTGGCAAAGCGACACCCCAAGG - Intronic
1086268093 11:85027390-85027412 GCTGGCAAATCGACATCCCAAGG - Intronic
1087131528 11:94672967-94672989 GCTGGCAAAGCGACACCCCAAGG + Intergenic
1089776935 11:120844335-120844357 GCTACAAAAACAAGAACACAGGG - Intronic
1090753861 11:129771498-129771520 TCTGCCAAAACTACCATCCATGG - Intergenic
1090974088 11:131667256-131667278 GCTGGAACAAGAACAACCCACGG - Intronic
1094675170 12:32612479-32612501 GCTGACAAAGCAACACCCCAAGG + Intronic
1095224210 12:39660126-39660148 GCTGTGAAAAGAACCACCCAAGG - Intronic
1096090583 12:48897808-48897830 TCTGCCAAAACTACCATCCACGG + Intergenic
1097491838 12:60281506-60281528 GCTGGCAAAGCGACACCCCAAGG - Intergenic
1099321873 12:81161621-81161643 GCTGGAAAAGCAACATCCCAAGG - Intronic
1099713917 12:86265328-86265350 GCTGGCGAAACAACACCCCAAGG + Intronic
1101430708 12:104624728-104624750 ACTGCCATAACAACATACCACGG + Intronic
1101750073 12:107576298-107576320 GCTGCCATAACAAAATGCCATGG + Intronic
1103827705 12:123753330-123753352 GCTGCCATAACAAAATACCACGG + Intronic
1105042064 12:132968306-132968328 GCTGGAAAAGCAACACCCCAAGG + Intergenic
1106076868 13:26467982-26468004 GGGGCCCAAACAACACCCCATGG - Intergenic
1106253357 13:28001003-28001025 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1107375287 13:39797927-39797949 GCTGCCATAACAAAATACCATGG + Intergenic
1107663734 13:42666942-42666964 AATGCCAAAACAACTACACATGG + Intergenic
1108559200 13:51626785-51626807 GCTGGCAAAGCAACACCCCAAGG - Intronic
1110458101 13:75712365-75712387 GCTGCCCTAAGAACAACCCCTGG - Intronic
1112160208 13:96859305-96859327 ACTGCCAAGAAAAGAACCCAGGG + Intergenic
1112316593 13:98368546-98368568 CCTGCCAAATCTACCACCCATGG - Intronic
1112682767 13:101786374-101786396 GCTGCCATAACAAAATACCATGG + Intronic
1113442555 13:110340564-110340586 GCTGCCAAAGGAACTCCCCAAGG - Intronic
1116222170 14:42102167-42102189 GCTGCCATAACAAGACACCATGG + Intergenic
1116415217 14:44670409-44670431 TCTGCCAAGACTACCACCCATGG + Intergenic
1116565420 14:46438849-46438871 GCAGCCTAAACAAAACCCCAGGG + Intergenic
1116617410 14:47155806-47155828 GCTGGCAAAGCGACACCCCAAGG + Intronic
1116706757 14:48312292-48312314 GCAGCAACAACAACAACACATGG - Intergenic
1117248643 14:53913079-53913101 GCTGAGAAAACTACAAACCATGG - Intergenic
1118122280 14:62859060-62859082 TCTGCCAAAACTACCATCCATGG - Intronic
1118444090 14:65836267-65836289 GCTGCCAAGACAACTCTCCAAGG + Intergenic
1118472959 14:66092754-66092776 GCTGGAAAAGCAACAGCCCAAGG - Intergenic
1118845512 14:69545103-69545125 GCTGCCATAACAAATACCCCAGG + Intergenic
1119620680 14:76129885-76129907 GCTGCCATAACAACATGCCATGG + Intergenic
1123978327 15:25574075-25574097 TCTGCCAAAACTACCATCCATGG - Intergenic
1124431099 15:29609148-29609170 GCAGCAAAACCCACAACCCAAGG - Intergenic
1124694277 15:31850755-31850777 GCTCCAAAACCAACAACCCAAGG + Intronic
1125233174 15:37481809-37481831 GCTGCCATAACAAAATGCCACGG + Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1127704025 15:61529606-61529628 GCTGCCATAACAAAATACCACGG + Intergenic
1129133803 15:73527746-73527768 GCTGCAAAACCAAAGACCCATGG + Intronic
1129500508 15:76032647-76032669 GATGCTTAAACAACAACCAAAGG - Intronic
1130227667 15:82072321-82072343 GCTAGGAAAACAACACCCCAAGG - Intergenic
1131378582 15:91945588-91945610 TATGCCAAAATAACACCCCAGGG + Intronic
1131550889 15:93355930-93355952 GCTGCCATAACAAAATACCACGG + Intergenic
1133205813 16:4232880-4232902 GCTGCCAAAACTGCAGCCCCCGG - Intronic
1134186958 16:12091975-12091997 GCTGCGAAAACAAAACACCATGG - Intronic
1135142765 16:19935852-19935874 GCTTCCAAAAAAACTCCCCAGGG - Intergenic
1137344007 16:47637510-47637532 GCTGGCAAAGCAACACCCCAAGG + Intronic
1137863523 16:51870463-51870485 GCTGCCAAGACACCAGCCCGAGG + Intergenic
1139566647 16:67781716-67781738 CCTGCCAAAACCACAATGCAAGG + Intronic
1139953886 16:70684467-70684489 GCTGCCAGGACAACAGCCCCAGG - Intronic
1140103641 16:71939431-71939453 GCTGGCAAAGCAACACCCTAAGG + Intronic
1143719726 17:8801127-8801149 GCTGCCCACAGAAGAACCCAGGG - Intergenic
1143924269 17:10355982-10356004 GCTGCCAAAAGAACAACTCAGGG + Intronic
1144553466 17:16261332-16261354 GCTGGCGAAGCAACACCCCAAGG + Intronic
1144632670 17:16882023-16882045 GGTGTCAAGACAACAAGCCAGGG - Intergenic
1144638381 17:16924907-16924929 GATGTCAAGACAACAAGCCAGGG - Intergenic
1146087094 17:29839395-29839417 GCTGGCAAAGCAACACCCCAAGG + Intronic
1147037457 17:37692314-37692336 GCACCCATAATAACAACCCAAGG - Intronic
1149062103 17:52434638-52434660 GCTGCCATAACAAAATACCATGG + Intergenic
1151557353 17:74853170-74853192 TCTGCCACCACAAAAACCCAAGG + Intronic
1151727853 17:75894915-75894937 GCTGCAAACACAACAGCCCTTGG + Intronic
1151892012 17:76956552-76956574 GCTGCCAAGAGAAGAACCCAGGG - Intergenic
1152530625 17:80916629-80916651 GCTGGCAAAGCAATACCCCAAGG + Intronic
1152864050 17:82711729-82711751 GCTGGCGAAGCAACACCCCAAGG - Intergenic
1153724135 18:7937625-7937647 GCTGGCGAAGCAACACCCCAAGG + Intronic
1154145052 18:11860288-11860310 GCTGCCAAAATGTCATCCCATGG + Intronic
1154506314 18:15044004-15044026 TCTGCCAAAACTACCATCCATGG + Intergenic
1156606525 18:38672867-38672889 TCTGCCAAGACTACCACCCATGG + Intergenic
1157926163 18:51768224-51768246 GCTCCCAGAACTACAGCCCAGGG - Intergenic
1157993118 18:52521355-52521377 GCTGCCATAACAAAACACCATGG + Intronic
1165240959 19:34466957-34466979 GCTGCCAAAAGCATAACCAATGG + Exonic
1165655172 19:37526561-37526583 GATGCCAGAACAACACACCAGGG - Intronic
1166006533 19:39911504-39911526 GGTGCCTAACAAACAACCCAAGG - Intronic
1166504814 19:43364576-43364598 GCTGCCAAAACAGCAGGCAAAGG - Intergenic
1166505726 19:43370338-43370360 GCTGCCAAAACAGCAGGCAAAGG + Intergenic
1167858516 19:52263552-52263574 GTTGCAAAGACAACAACCTAAGG - Intergenic
925351526 2:3204184-3204206 GCTGGGAAAACTAGAACCCAGGG + Intronic
925725538 2:6867187-6867209 GCTGCCATAACAAAATACCACGG + Intronic
928142580 2:28743183-28743205 GCTGACAAAAAAACAAGCAATGG + Intergenic
928182553 2:29079850-29079872 GCTGGCAAAGCAACACCCTAAGG - Intergenic
928265840 2:29811060-29811082 GTTGCCATAACAACATACCATGG - Intronic
929516778 2:42610534-42610556 ACTGCCAAAACGACAAACAAGGG - Intronic
931005673 2:57848743-57848765 GCTGGCAAAGCGACACCCCAAGG - Intergenic
931300670 2:60974955-60974977 GCTGGCGAAGCAACACCCCAAGG + Intronic
933103031 2:78284150-78284172 TCTTCCAAAACAACCACCCATGG + Intergenic
934534662 2:95122900-95122922 TCTGCCAAAACAACTATCCTTGG - Intronic
935457880 2:103291375-103291397 GCACCCAACACATCAACCCATGG - Intergenic
936244304 2:110813327-110813349 GCTGCCACTGCCACAACCCAAGG - Intronic
937628035 2:124066022-124066044 GCAGCCAGCACAACAATCCAAGG + Intronic
937766307 2:125664740-125664762 GGTGCCAGACCAAGAACCCACGG - Intergenic
937948592 2:127365585-127365607 GCTGACCAAACAGCAACCCCAGG + Intronic
938688491 2:133764218-133764240 GCTTCCCAAACAACATTCCATGG - Intergenic
939044672 2:137236330-137236352 GAAACCAAAACACCAACCCAGGG - Intronic
941333072 2:164204573-164204595 GCTGGTGAAACAAAAACCCAAGG + Intergenic
941370176 2:164655296-164655318 GCTGCCAAAAGATGAAGCCAGGG + Intronic
941929015 2:170923027-170923049 GCTGGCAAAGCAACACCCTAAGG - Intergenic
942717180 2:178906636-178906658 GCTTCCAACTCAGCAACCCAGGG - Intronic
943263696 2:185698347-185698369 GCTGCGAAAACTACTATCCATGG + Intergenic
943383912 2:187179977-187179999 TCTGCCAAGACTACCACCCATGG - Intergenic
943960363 2:194255408-194255430 GATGGCAAAGCAACACCCCAAGG + Intergenic
946523271 2:220489694-220489716 GATGCCAAAACTAAAACCCGAGG - Intergenic
946873209 2:224103562-224103584 ACTTCCAAAACAAAATCCCACGG - Intergenic
947200357 2:227609303-227609325 GCAGCCAAAACAAAGACACAAGG + Intergenic
948434707 2:237945137-237945159 ACTGCAAAAGCAACAACCTAAGG + Intergenic
1168773244 20:429156-429178 GCTGGGAAAACTACAGCCCATGG + Intronic
1170227410 20:14007000-14007022 GCTGACAATACATGAACCCAGGG - Intronic
1170352976 20:15462642-15462664 GCTTTCAAATCAACAAACCAAGG - Intronic
1170458531 20:16555108-16555130 GCTGGCAAAATGACACCCCAAGG + Intronic
1170595224 20:17800415-17800437 GCTGCCAGAGCAGGAACCCAGGG + Intergenic
1171522635 20:25787313-25787335 TCTGCAAAAAAAAAAACCCATGG - Intronic
1171554192 20:26068570-26068592 TCTGCAAAAAAAAAAACCCATGG + Intergenic
1172899972 20:38327566-38327588 GCTGCCAAAACAACAACCCAGGG - Exonic
1173045877 20:39511315-39511337 GGTTATAAAACAACAACCCAAGG - Intergenic
1173300295 20:41796472-41796494 TCTGCCAAAACTACCATCCATGG - Intergenic
1176791539 21:13325019-13325041 TCTGCCAAAACTACCATCCATGG - Intergenic
1176890543 21:14312617-14312639 GCTGCAATAACAACATACCATGG - Intergenic
1176953755 21:15075589-15075611 GATGCCAAATGAACAAACCATGG + Intergenic
1177320802 21:19517357-19517379 ACTGCCAAAAAAACAACACAAGG - Intergenic
1177484385 21:21738054-21738076 GCTGCCATAACAAAATACCATGG + Intergenic
1177624724 21:23645674-23645696 ACTGGCAAAGCAACACCCCAGGG - Intergenic
1178356624 21:31914554-31914576 GCTGCCACAACAAAATACCATGG + Intronic
1179456433 21:41504206-41504228 GCTGCCACAACCACAAGCCAAGG + Intronic
1179881388 21:44294555-44294577 GCTCCCCCAACACCAACCCAAGG - Intronic
1181095384 22:20501496-20501518 CCTGCAAAAACAACCACCTAAGG + Intronic
1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG + Intergenic
1181980600 22:26763321-26763343 TCTGCCAAAACAAAGACCCACGG + Intergenic
1182590076 22:31372499-31372521 ACTGCCAAAAGAAAAACCCTGGG - Intergenic
1182857397 22:33529903-33529925 GCTGCCAAAACACAAACACATGG - Intronic
949169884 3:985499-985521 TCTGCCAAGACTACCACCCATGG - Intergenic
950778806 3:15373522-15373544 GCTGCCATAACAAAATGCCATGG + Intergenic
952111893 3:30133755-30133777 GCTGCCATAACAAAATACCATGG - Intergenic
952582609 3:34852475-34852497 GCTGCCATAACAAAATACCATGG + Intergenic
953290001 3:41650765-41650787 GCTGCAAAAGCAACACCCTAAGG + Intronic
953603208 3:44387799-44387821 GCTGGAAAAGCAACACCCCAAGG + Intronic
953655154 3:44845570-44845592 GTTGCCAAAACATCAAATCAAGG + Intronic
954847353 3:53571458-53571480 GCTGCCAAGTAAACAATCCATGG - Intronic
955615779 3:60805256-60805278 GCTGCCATAACAAAACACCAAGG + Intronic
957614645 3:82510499-82510521 GCTGGAAAAGCAACACCCCAGGG + Intergenic
961097400 3:124169432-124169454 GCTACCAAAACATCAACCACTGG - Intronic
961498753 3:127315500-127315522 GTTGCCAATACAGCATCCCAGGG + Intergenic
962203785 3:133418954-133418976 GCTGCCAGAACAAAGGCCCATGG + Intronic
963267948 3:143257847-143257869 TCTGCCAAAACTACCATCCATGG - Intergenic
964827687 3:160848337-160848359 GCTGGGTCAACAACAACCCAGGG + Intronic
965259840 3:166467883-166467905 TCTGCCAAAACTACCACCCATGG + Intergenic
966254362 3:177900092-177900114 GCTGGCAAAGCAACACCCTAAGG + Intergenic
969482846 4:7455924-7455946 GCTGCCAAAACAAAATACCTGGG + Intronic
970172658 4:13305127-13305149 GCTGCCATAACAAAATGCCATGG + Intergenic
970524134 4:16914180-16914202 GCTGCCAAAATTACCATCCATGG + Intergenic
970940438 4:21626568-21626590 GCTGCCATAACAAAACACCATGG - Intronic
972598052 4:40547550-40547572 GCTGCCATAACAAAATACCATGG - Intronic
973034582 4:45390428-45390450 GGGGCCAAAGCAAAAACCCATGG - Intergenic
973932152 4:55803966-55803988 GCTGCGGAAACCCCAACCCATGG + Intergenic
975498468 4:75058870-75058892 GCTGGCAAAACAACACCCCAAGG + Intergenic
977466163 4:97384492-97384514 TCTGCCAAAACTACCATCCATGG + Intronic
978300897 4:107269161-107269183 GCTGGTGAAACAACACCCCAAGG - Intronic
982292620 4:153793479-153793501 TCTGCCAAGGCACCAACCCACGG - Intergenic
983069566 4:163253246-163253268 GCTGGAAAAGCAACACCCCAAGG - Intergenic
983266573 4:165513880-165513902 GCTGCTAAAACAAAATGCCATGG + Intergenic
983410907 4:167396794-167396816 GCTGCCAGAACACCAACATATGG + Intergenic
983661852 4:170136852-170136874 GCTGCCACATCAACAAGTCAGGG - Intergenic
983715603 4:170777363-170777385 GCTGGTAAAGCAACACCCCAGGG + Intergenic
983885258 4:172974575-172974597 GCTGGCAAAACAACACCCCAAGG - Intronic
986959987 5:13200294-13200316 TCTGCCAAGACTACCACCCATGG + Intergenic
987181531 5:15372958-15372980 GCTGGCAAAATAACAAGCCAAGG + Intergenic
988145094 5:27294926-27294948 GCTGCCATAACAAAATACCATGG - Intergenic
990210376 5:53477420-53477442 GATGCCAAAACAACTAGTCAAGG + Intergenic
990732136 5:58820894-58820916 GCTGACATAATAATAACCCATGG - Intronic
990878931 5:60518357-60518379 GCTGGCAAAGCAACACCCCAAGG + Intronic
991288706 5:65009819-65009841 GCTGCCATAACAAAATACCATGG - Intronic
992838760 5:80667404-80667426 GCTGGCGAAGCAACACCCCAAGG - Intronic
993478834 5:88397565-88397587 ACCGCCAAAACAAAAACCCAAGG + Intergenic
993941503 5:94063634-94063656 GCTGCCAAAACTAGAGCCCAAGG + Intronic
995013628 5:107285920-107285942 ACTGCCAAAACCACAACCCACGG - Intergenic
995386490 5:111595479-111595501 GCTGGCAAAGCAAGACCCCAAGG - Intergenic
995728069 5:115203151-115203173 GCTGGCAAGTCAACAAGCCAGGG + Intergenic
996912292 5:128669619-128669641 TCTGCCAAAACTACCATCCATGG - Intronic
997603958 5:135159956-135159978 ACTGCCACAACTACAATCCAGGG - Intronic
998124873 5:139610969-139610991 GCTGCCAAAACTATAACCAAAGG + Intronic
998271548 5:140710952-140710974 GCTCCCAAAACAACCACACAGGG - Intergenic
998272395 5:140718608-140718630 GCTCCCAAAACAACCACGCAGGG - Intergenic
998273184 5:140725839-140725861 GCTCCCAAAACAACCACGCAGGG - Intergenic
999505195 5:152187316-152187338 GCAGCCAAAAAAAAAACCGATGG - Intergenic
999887012 5:155935711-155935733 GCTGGAAAAGCAACACCCCAAGG - Intronic
1002386851 5:178874799-178874821 TCTGGCAAATCAAAAACCCAGGG - Intronic
1002409325 5:179061316-179061338 GCTGCCCAAACACCAACCCCAGG - Intronic
1003172124 6:3728100-3728122 TCAGTCAGAACAACAACCCAGGG - Intronic
1005594866 6:27369173-27369195 GCTGGCGAAGCAATAACCCAAGG + Intergenic
1008186691 6:48401230-48401252 CCTGCCAAAAGAACATCCCGGGG - Intergenic
1009243217 6:61204066-61204088 GCTGGTGAAACAACACCCCAAGG - Intergenic
1009645655 6:66396885-66396907 GCTGGCAAAGCAACACCCGAAGG + Intergenic
1010107790 6:72189455-72189477 GCTGCCAAGACTACCATCCATGG - Intronic
1010600374 6:77817940-77817962 GCTGCCAAAAAAACAAATAATGG - Intronic
1010847046 6:80721166-80721188 GCTGGCCAAACAACACCCCAAGG + Intergenic
1011284013 6:85705248-85705270 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1013347986 6:109280936-109280958 GCTGCCATAACAAAATACCATGG + Intergenic
1013959181 6:115877522-115877544 GCTGCCTTAACAACAATCAAAGG - Intergenic
1014125295 6:117770124-117770146 GCTGCCATAACAAAATACCACGG + Intergenic
1015678585 6:135779257-135779279 GCTGCCATAACAACGTACCATGG + Intergenic
1016252567 6:142062814-142062836 GCTGCCAAAAGCATAACCAAAGG + Intronic
1016331980 6:142962704-142962726 TCTGCCAGACCAATAACCCAAGG + Intergenic
1016391509 6:143580001-143580023 GCCTGCAAAACAACAGCCCATGG - Intronic
1017958311 6:159198647-159198669 GCAGCCATCATAACAACCCAAGG - Intronic
1018939909 6:168302150-168302172 GCTGGCTAATCAATAACCCAAGG - Intronic
1019206803 6:170368701-170368723 GCTGCCATAACAAAACACCACGG + Intronic
1019809100 7:3151155-3151177 GAGGAAAAAACAACAACCCAAGG - Intronic
1020474708 7:8581861-8581883 GCTAGCAAAGCAACACCCCAAGG - Intronic
1020832401 7:13109219-13109241 GCTGGCAAAGCAACACTCCAAGG - Intergenic
1022048131 7:26639381-26639403 GCTGCCATAACAAAATACCACGG - Intronic
1022992539 7:35722661-35722683 GCTGCCATAACAAAACACCATGG + Intergenic
1027024314 7:74840016-74840038 GATGCCACAGCAACAGCCCAAGG + Intronic
1027063451 7:75104102-75104124 GATGCCACAGCAACAGCCCAAGG - Intronic
1028034991 7:85971538-85971560 ACTGGCCAAGCAACAACCCAGGG - Intergenic
1028378750 7:90175699-90175721 GCTGGCAAAGCAACACCCCAAGG - Intronic
1029092982 7:98062962-98062984 GCTGATAAAATAACAAGCCAAGG - Intergenic
1029902502 7:104056409-104056431 GCTGCCATAAGAAAAACCTAAGG - Intergenic
1030359614 7:108580704-108580726 GCTGGCAAAATGACACCCCAAGG + Intergenic
1030364977 7:108635446-108635468 GCTGCCATAACAAAATACCACGG - Intergenic
1031346482 7:120673228-120673250 GCTGCCATAACAAAATACCACGG - Intronic
1031767936 7:125804812-125804834 TCTGCCAAAACCACCACCCATGG + Intergenic
1032780774 7:135163959-135163981 GCTGCCAAGACAACCACCTGGGG - Intronic
1032858466 7:135857095-135857117 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1033567923 7:142597786-142597808 TCTGCCAAAACACCAAAACATGG - Intergenic
1034016349 7:147591198-147591220 GCTGCCATAACAAAATACCATGG + Intronic
1034204446 7:149303600-149303622 GCTGCTAAAACAAAATACCATGG + Intergenic
1034210254 7:149357233-149357255 GCTGGCAAAGCAACACCCCAGGG - Intergenic
1035480833 7:159182633-159182655 GCTGCTATAACAACATACCATGG - Intergenic
1036006920 8:4675101-4675123 GCTGCCATAACAAAATACCATGG - Intronic
1036055160 8:5244051-5244073 CCTACCAAAAAAACAAGCCAGGG + Intergenic
1036611816 8:10356809-10356831 GCTGCCGTAACAACATACCATGG - Intronic
1038351082 8:26776956-26776978 GCTGCCACACCAACAGGCCAAGG + Intronic
1038701279 8:29851720-29851742 TCTGACAAAGCAACAGCCCATGG + Intergenic
1039384167 8:37117396-37117418 ACTGCCAAAACAACCATCCATGG + Intergenic
1041274567 8:56143452-56143474 GCTGGCGAAGCAACACCCCAAGG + Intergenic
1042027567 8:64440210-64440232 GCTGAAAAAACAACAACATATGG - Intergenic
1043082389 8:75783609-75783631 GCTGGCAGAGCAACACCCCAAGG - Intergenic
1043164025 8:76880656-76880678 TCTGCCAAAACTACCATCCATGG - Intergenic
1043238245 8:77897434-77897456 GCTATCAAAACAGCATCCCATGG - Intergenic
1043382233 8:79715349-79715371 GCTGCCATAACAAAATACCATGG + Intergenic
1043737544 8:83767604-83767626 GCTGGAAAAACAACAACCCAAGG - Intergenic
1044245713 8:89942711-89942733 GTTGCCAAAAATATAACCCAGGG + Intronic
1045888186 8:107123899-107123921 GCTGGTGAAGCAACAACCCAAGG + Intergenic
1045980811 8:108185124-108185146 GCTGCCATAACAAAATGCCACGG - Intergenic
1046407179 8:113790240-113790262 GCTGGAAAAGCAACACCCCAAGG - Intergenic
1047884283 8:129231401-129231423 TCTGCCAAAACTACCATCCATGG + Intergenic
1050199968 9:3134073-3134095 CATGCCAAAAGCACAACCCATGG + Intergenic
1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG + Intergenic
1050496406 9:6246880-6246902 GCTGCCATAACAAAATACCATGG - Intronic
1050589499 9:7147837-7147859 GCTGGCAAAGCAACACCCTAAGG - Intergenic
1051029516 9:12657974-12657996 GCTGGAAAAACAACACTCCAAGG - Intergenic
1052895355 9:33742524-33742546 TCTGCCAAAACTACCATCCATGG - Intergenic
1054863639 9:69978006-69978028 GCTTCCAAAAATGCAACCCAAGG - Intergenic
1055851883 9:80641699-80641721 GATACCAAGACAAGAACCCATGG - Intergenic
1056442473 9:86634591-86634613 GCTGCCATAACAACATACCATGG + Intergenic
1059292485 9:113239077-113239099 GTTGCCAAACTAAAAACCCATGG + Intronic
1059555976 9:115280759-115280781 CCTGCCAAAGAAACAATCCAGGG + Intronic
1059878513 9:118663236-118663258 CCTGCAAAAACAAAACCCCATGG - Intergenic
1060804980 9:126569596-126569618 TCTGCCAAAACCACCATCCATGG - Intergenic
1061729885 9:132605625-132605647 GCTGCCACCACAACAGACCAGGG + Intronic
1186023872 X:5287095-5287117 GCAGCAGAAACAACAACACACGG + Intergenic
1186590718 X:10927531-10927553 GCTGCCATAACAAAATACCATGG + Intergenic
1191831622 X:65421562-65421584 ACTGCCAAAACTACCATCCATGG + Intronic
1192187140 X:68955503-68955525 GCAGCAATAACAACAACCCCTGG + Intergenic
1194126279 X:90021145-90021167 GCTGCCTAAACACCAACACCTGG + Intergenic
1194649557 X:96498944-96498966 TCTGCCAAAACTACCATCCATGG + Intergenic
1195111670 X:101656804-101656826 GCTGCCAAGAAAGCAACCCCTGG - Exonic
1195208840 X:102630888-102630910 GCTGCCACAACAAAATACCACGG - Intergenic
1196933754 X:120708285-120708307 CCTACCAAAAAAAAAACCCAGGG - Intergenic
1197342371 X:125288698-125288720 GCTGGAAAAGCAACACCCCAAGG + Intergenic
1197780454 X:130153883-130153905 GCTGCCATAACAAAACACCACGG - Intronic
1200133170 X:153862418-153862440 GCTGGCAAAACAGCACCCAAAGG + Exonic
1200835195 Y:7725750-7725772 GCTGCATGAACAACAATCCAAGG + Intergenic