ID: 1172914938

View in Genome Browser
Species Human (GRCh38)
Location 20:38436365-38436387
Sequence CACTGGGAGTCTCTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172914929_1172914938 14 Left 1172914929 20:38436328-38436350 CCTGGGAGAGGCCCATGGGATTC No data
Right 1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG No data
1172914930_1172914938 3 Left 1172914930 20:38436339-38436361 CCCATGGGATTCCCAGACTGTGA No data
Right 1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG No data
1172914925_1172914938 26 Left 1172914925 20:38436316-38436338 CCATATTTTGTACCTGGGAGAGG No data
Right 1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG No data
1172914934_1172914938 -8 Left 1172914934 20:38436350-38436372 CCCAGACTGTGAGAACACTGGGA No data
Right 1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG No data
1172914931_1172914938 2 Left 1172914931 20:38436340-38436362 CCATGGGATTCCCAGACTGTGAG No data
Right 1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG No data
1172914935_1172914938 -9 Left 1172914935 20:38436351-38436373 CCAGACTGTGAGAACACTGGGAG No data
Right 1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172914938 Original CRISPR CACTGGGAGTCTCTGTGATG GGG Intergenic
No off target data available for this crispr