ID: 1172915510

View in Genome Browser
Species Human (GRCh38)
Location 20:38440549-38440571
Sequence GCAACGAGTATGTTGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172915510_1172915513 -2 Left 1172915510 20:38440549-38440571 CCTGCTTTCAACATACTCGTTGC No data
Right 1172915513 20:38440570-38440592 GCAAAGGATTGGACTGTAGCTGG No data
1172915510_1172915516 20 Left 1172915510 20:38440549-38440571 CCTGCTTTCAACATACTCGTTGC No data
Right 1172915516 20:38440592-38440614 GGAAGACAAGGTTCCACCACAGG No data
1172915510_1172915515 8 Left 1172915510 20:38440549-38440571 CCTGCTTTCAACATACTCGTTGC No data
Right 1172915515 20:38440580-38440602 GGACTGTAGCTGGGAAGACAAGG No data
1172915510_1172915514 -1 Left 1172915510 20:38440549-38440571 CCTGCTTTCAACATACTCGTTGC No data
Right 1172915514 20:38440571-38440593 CAAAGGATTGGACTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172915510 Original CRISPR GCAACGAGTATGTTGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr