ID: 1172917212

View in Genome Browser
Species Human (GRCh38)
Location 20:38452083-38452105
Sequence TTGGGTAGGAATAAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172917212_1172917221 -3 Left 1172917212 20:38452083-38452105 CCCCCCTCCTTATTCCTACCCAA No data
Right 1172917221 20:38452103-38452125 CAAGAACCACCTGACACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172917212 Original CRISPR TTGGGTAGGAATAAGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr