ID: 1172919582

View in Genome Browser
Species Human (GRCh38)
Location 20:38469996-38470018
Sequence CTTCCTCCCAACATGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172919579_1172919582 -7 Left 1172919579 20:38469980-38470002 CCTTATGTGGCTTGGGCTTCCTC No data
Right 1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG No data
1172919575_1172919582 7 Left 1172919575 20:38469966-38469988 CCTCTTCATGTTTTCCTTATGTG No data
Right 1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172919582 Original CRISPR CTTCCTCCCAACATGGTGGC TGG Intergenic
No off target data available for this crispr