ID: 1172920217

View in Genome Browser
Species Human (GRCh38)
Location 20:38474595-38474617
Sequence AAGCTAATGCAGCCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172920217 Original CRISPR AAGCTAATGCAGCCAGAGAC AGG (reversed) Intronic
901878341 1:12179754-12179776 AAGGTCATGCAGCCAGTGAGCGG - Intronic
902919538 1:19657771-19657793 AAGCCAAGGAAGCCAGAGAAAGG - Exonic
902966668 1:20009790-20009812 AAGCTAATATATCCAGAGAAAGG - Intergenic
903101343 1:21033482-21033504 AAGCTACTGCAACAAAAGACAGG + Intronic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
906486362 1:46238436-46238458 AAAGTAATACACCCAGAGACTGG + Intergenic
908677804 1:66625343-66625365 AATTCAATGCAGCCACAGACTGG + Intronic
914395066 1:147258430-147258452 AAGCTAATTCAGACAGAGCCAGG + Intronic
916500643 1:165384054-165384076 CAGCTAATGCTGCCAGTGTCAGG - Intergenic
918147089 1:181766430-181766452 AGGCTAATGCAAACACAGACTGG - Intronic
920819501 1:209367175-209367197 AGGCTAAGCCAGCCAGAGCCTGG - Intergenic
921540729 1:216411528-216411550 ATGATAATGCAGACAGAGGCTGG + Intronic
921895153 1:220391968-220391990 AAGCTAATGAAGGAAGACACAGG + Intergenic
922174125 1:223181829-223181851 AAGCTGAAGAAGCCAGAAACAGG + Intergenic
1063277610 10:4587964-4587986 AAGCTAATCCAGCCAGATATGGG + Intergenic
1064251608 10:13710447-13710469 CAGCTACAGCAGCCACAGACGGG - Intronic
1067900447 10:50235373-50235395 AAGCTACTGAAACCAGAAACAGG + Intronic
1068705259 10:60069059-60069081 AAGCAAGGGCAGCCAGAGAAAGG - Exonic
1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG + Intergenic
1077323702 11:1954172-1954194 AAGTCCAGGCAGCCAGAGACAGG + Intronic
1077747035 11:4918283-4918305 AAGTTAAGGCAGCCTGAAACGGG + Intronic
1084295577 11:68211785-68211807 AAGCTATTGGAGCCAGAGCTTGG + Intronic
1085016368 11:73176835-73176857 AAGCCCATGGAGCCAGAGAAGGG + Intergenic
1088568228 11:111195840-111195862 AAGAGAATGGAGGCAGAGACTGG + Intergenic
1202806690 11_KI270721v1_random:9367-9389 AAGTCCAGGCAGCCAGAGACAGG + Intergenic
1094040117 12:26113797-26113819 AAACTAATGTAGCCAGGGGCCGG - Intergenic
1095699428 12:45175744-45175766 AGGTTCATGTAGCCAGAGACTGG + Intergenic
1098503807 12:71226273-71226295 AAGCTAATACAGACAGAGCAGGG + Intronic
1098652487 12:72990531-72990553 AAACTACTGAAGCCAGAAACTGG - Intergenic
1100786630 12:98085769-98085791 AAGGAAAGGCAGACAGAGACAGG + Intergenic
1102541995 12:113627595-113627617 AAGATAAAGAAGCCAGAAACAGG + Intergenic
1103514945 12:121501425-121501447 AAGAAAATGAAGGCAGAGACTGG + Intronic
1103613128 12:122135996-122136018 AGGCTGATGCTCCCAGAGACAGG - Intronic
1104631901 12:130409701-130409723 CTGCTAATACAGCCAGTGACAGG - Intronic
1104836312 12:131794232-131794254 GAGCAAAAGCAGCCAGACACAGG + Intronic
1105064270 12:133183016-133183038 AAGCTAATGCAGCCTCTGATAGG - Intronic
1111887016 13:94034287-94034309 TAGCAAATGTAGCCAGCGACAGG - Intronic
1112065536 13:95788846-95788868 AAGCTAATGCAGTTAGACTCAGG - Intronic
1113066225 13:106376125-106376147 AAGCAAATGCAGCCGGGCACAGG - Intergenic
1113826098 13:113254921-113254943 AAGCAAATGCAGGCAAAGGCTGG - Intronic
1119990966 14:79196915-79196937 CAGCTATTGCAGCTTGAGACTGG + Intronic
1120509737 14:85398801-85398823 AAGCTAAAGAAGCCACAGCCAGG - Intergenic
1121549284 14:94786460-94786482 AAGCTAACACAGCAAGAGGCTGG - Intergenic
1121737245 14:96227011-96227033 AAGCCACTCCAGCAAGAGACAGG + Intronic
1121993336 14:98582480-98582502 AAGGTAATGCAGGAGGAGACCGG - Intergenic
1127676925 15:61248366-61248388 AAGATAATGCAGCCATGGTCCGG + Intergenic
1134912775 16:18043016-18043038 ATGCCAACGCAGCAAGAGACTGG + Intergenic
1136063029 16:27739724-27739746 AAGTTAAAGTAGCAAGAGACAGG + Intronic
1136142868 16:28298477-28298499 AAGGTCACGCAGCCAGAGAATGG - Intronic
1137554074 16:49459381-49459403 AAGCTGATGCAGGCAGAGTGAGG - Intergenic
1137592482 16:49702307-49702329 AGGCCAAGGCAGCCAGGGACGGG + Intronic
1138763529 16:59572215-59572237 AAGCAAAAGCAACCAGAGGCTGG - Intergenic
1141322599 16:83025849-83025871 AATCTAATGCAGACAGAGCCAGG - Intronic
1143146027 17:4776147-4776169 GAGCTAAAGAAGCCAGACACAGG - Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1147783011 17:42957198-42957220 AAGCAAAGAGAGCCAGAGACAGG + Intronic
1148432289 17:47651219-47651241 AAGCTAAGTCCGCTAGAGACTGG + Intronic
1149456587 17:56793257-56793279 AAGGTTATTCAGCCAGTGACTGG + Intronic
1151177609 17:72301695-72301717 AAGAGTATGGAGCCAGAGACTGG - Intergenic
1152201815 17:78951817-78951839 AAGCTCATGGAGCCGGAGGCTGG + Intergenic
1152892468 17:82890392-82890414 AAGCAAATGCAGCCGGGGTCTGG + Intronic
1156861170 18:41837910-41837932 AGACTAATACAGTCAGAGACAGG + Intergenic
1157131836 18:45014461-45014483 AAGCCCATACAGCCAGAGACAGG + Intronic
1158220382 18:55144455-55144477 AAGCTGATGCAACCAGTGAAGGG - Intergenic
1160421159 18:78746254-78746276 CAGCTAATCCAGCTAGAGAAGGG - Intergenic
1161048999 19:2152079-2152101 AAGAAAATGAGGCCAGAGACAGG + Intronic
1161886494 19:7000519-7000541 CAGCTGATGCAGCTAGAGATGGG + Intergenic
1164710787 19:30355744-30355766 AATCTAATGCAGCCACTGACAGG - Intronic
1166127174 19:40722131-40722153 AAGCTCATGATGGCAGAGACTGG - Intronic
925585583 2:5461112-5461134 AAGCTCATGCAGGAGGAGACTGG - Intergenic
925593338 2:5531544-5531566 AAGCTAAAGCAGCTAAAGCCTGG - Intergenic
925926890 2:8677232-8677254 AAGCTAACGCAGCCACAAATCGG + Intergenic
926781664 2:16478177-16478199 AAGCTCTTGCAGCCTGTGACAGG + Intergenic
928141166 2:28730557-28730579 AAGCTAATGCAGCCAGAGTATGG + Intergenic
928673878 2:33631196-33631218 AAGTACATGAAGCCAGAGACTGG - Intergenic
928950732 2:36811045-36811067 AATCCAAAGTAGCCAGAGACGGG + Intronic
930949639 2:57124393-57124415 TAGCTGAGGCAGCCAGAGAAGGG - Intergenic
931047789 2:58375964-58375986 AAGCAAATGGAGGCAGAGATTGG - Intergenic
935791351 2:106593095-106593117 AGGCTAATGCAAGCAGAAACTGG - Intergenic
935853565 2:107249297-107249319 ATGCTAGTGCCTCCAGAGACAGG - Intergenic
936487182 2:112936204-112936226 AAGCCCATGCAGCCCGAGAAGGG + Intergenic
937019702 2:118639200-118639222 CAGCTAATACAGCCAGCGAATGG - Intergenic
937940216 2:127279445-127279467 AAGCTAATTCTGCTAGAGAAAGG - Intronic
938212498 2:129480498-129480520 CAGCTAATGCTTCCGGAGACAGG + Intergenic
939084603 2:137703550-137703572 AAACTAATGCATCAAGAGAGTGG + Intergenic
940187499 2:151003333-151003355 AAGCTGTTGGAGCCAGAAACTGG + Intronic
945011093 2:205464495-205464517 CAGCTAGAGCAGCCAGAGAGGGG + Intronic
946920582 2:224577270-224577292 AAGGTTATGCAGCTAGAGGCCGG + Intronic
948263252 2:236619971-236619993 AAGCTGATACTGCCATAGACAGG + Intergenic
948296370 2:236863722-236863744 AAGCAAATCAAGCCAAAGACAGG + Intergenic
1170082111 20:12487999-12488021 AAGCAACTGAAGGCAGAGACTGG + Intergenic
1171040759 20:21760814-21760836 AAGCAAAAGAAGCCAGACACAGG - Intergenic
1172920217 20:38474595-38474617 AAGCTAATGCAGCCAGAGACAGG - Intronic
1173178155 20:40780889-40780911 TAGGCAATGCAGCCAGAGAGAGG + Intergenic
1174996569 20:55575883-55575905 GAGATAATGGAGCCAGAGACTGG + Intergenic
1180725044 22:17940673-17940695 AAGCAATGGCAGCCAGAGAGAGG + Intronic
1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG + Intronic
1181177605 22:21046507-21046529 TAGCTAATCCTGCCAGAGTCAGG - Intronic
1183012845 22:34961424-34961446 AAGGTAATGGGGCAAGAGACGGG + Intergenic
1183544583 22:38448785-38448807 AGGCCAATGCAGCCGCAGACAGG + Intronic
1184606820 22:45579148-45579170 GAGCAGATGCAGCCAGAGAAAGG - Intronic
950365883 3:12483900-12483922 AAGCTCACGCAGCCAGTGAGGGG + Intergenic
950897942 3:16470310-16470332 AAGCCAAGGCAGGCAGATACTGG + Intronic
953472705 3:43180596-43180618 GAGCAAATGCAGCAAAAGACAGG + Intergenic
955600728 3:60642364-60642386 AAGCTAATTCAGTCAGACCCAGG + Intronic
961734451 3:128992846-128992868 AAGCTGATGCAGCCACAGTTGGG + Intronic
962040808 3:131705781-131705803 TTGCTAATGAAGTCAGAGACAGG - Intronic
963525798 3:146412206-146412228 AAGCAACTGCAGCCTGAGAAAGG - Intronic
964338164 3:155679475-155679497 AAGCTAATGCAGTAAGTGAATGG + Intronic
969090983 4:4693875-4693897 AAGCCCCTGCAGCCAGAGAGAGG + Intergenic
969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG + Intronic
970156308 4:13144981-13145003 TAGCTAATGCCCCCAGAGGCTGG + Intergenic
970661051 4:18286273-18286295 AAGCTAATGGAGCCAGAAATGGG - Intergenic
975147996 4:70991547-70991569 AAGTTTTTGCAGCCAGAAACTGG + Intronic
976855353 4:89598101-89598123 AGGCTAATGCAGCCAGAATGAGG + Intergenic
976953758 4:90867728-90867750 AAGCTCATGGAGCCAAAGAGTGG - Intronic
977258962 4:94774668-94774690 AAGATAGTGCAGGCAGAGAAAGG - Intronic
977777904 4:100943832-100943854 AAGCAAATGCAGTCACAGAGAGG - Intergenic
983559283 4:169084982-169085004 AAGCTAATTCAGCCAGCCCCTGG - Intergenic
984583611 4:181537838-181537860 AAATTAATGCAGACAAAGACAGG - Intergenic
986009120 5:3696187-3696209 GAACTAAAGCAGCAAGAGACAGG + Intergenic
986267567 5:6203375-6203397 AAGCTTTTGCACCCAGAGCCTGG - Intergenic
986314102 5:6574627-6574649 AAGCCACTGCAGCTGGAGACAGG + Intergenic
987212382 5:15695887-15695909 AAGCAACTGCAGCTAGAAACAGG - Intronic
990003532 5:50921780-50921802 AGGGTAATGCAGCCGGAGATTGG + Intergenic
991633621 5:68681277-68681299 AAACTAAAGCAGTCAGAGATCGG - Intergenic
993027684 5:82665117-82665139 AAAATAGTCCAGCCAGAGACAGG + Intergenic
993908339 5:93649331-93649353 AACCAAAAGCAGGCAGAGACTGG + Intronic
994598748 5:101874028-101874050 AAGCTGTTGCAGAGAGAGACTGG + Intergenic
995475686 5:112545817-112545839 AAGAAGATGCAGCTAGAGACAGG - Intergenic
996554253 5:124761775-124761797 AAACTAATGAAGGCAGAGAGAGG + Intergenic
999228038 5:150043799-150043821 AAGCTCACCCAGCCAGAGAAGGG + Intronic
1002095527 5:176828613-176828635 AAGCTAAAGCAGAGAGTGACAGG - Intronic
1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG + Intergenic
1003006333 6:2385758-2385780 ATGCTAATGTGGCCAGAGAGAGG + Intergenic
1003684841 6:8292261-8292283 AAGCTAACCAAGCCACAGACTGG - Intergenic
1004807035 6:19213933-19213955 AAGCCACTGCAGCCATAAACTGG - Intergenic
1006918533 6:37612565-37612587 AAGGTTATGGTGCCAGAGACTGG + Intergenic
1007315563 6:40985934-40985956 CAGCTGCTGCAGCCAGAAACTGG + Intergenic
1007969314 6:46034672-46034694 AAGCTAAGGCAGAAAGAGATGGG - Intronic
1013858906 6:114609720-114609742 AAGCTCATGCAGCCAAGGAATGG - Intergenic
1015555177 6:134453778-134453800 AAGCTAATGCTGGCAGAGCTGGG + Intergenic
1015870762 6:137774193-137774215 AAGCCAGTGCTGCCAGAGTCTGG + Intergenic
1015997632 6:139010787-139010809 AAGCCACTGCAGCCAGCAACTGG + Intergenic
1016550947 6:145279369-145279391 AAGCTAATGCAGCAATAATCAGG - Intergenic
1016897586 6:149068310-149068332 AAGGTCATGCAGCCAGAAAGTGG - Intronic
1017413720 6:154197063-154197085 CAGCAAATGCATCCTGAGACTGG + Intronic
1020399808 7:7762673-7762695 AATATAGTGCAGACAGAGACAGG + Intronic
1021181431 7:17510262-17510284 AAGATAATGCAGCCAGACATAGG + Intergenic
1021802328 7:24319366-24319388 AAGCAACTGGAGCCATAGACTGG + Intergenic
1023081863 7:36533881-36533903 AGGCAAAAGCAGCCAGACACTGG - Intronic
1023134570 7:37038318-37038340 AACCTAAAGCATCCAGGGACAGG - Intronic
1023812992 7:43926712-43926734 AAGCGAACGCAGCCTGAGAAAGG + Intronic
1024991803 7:55240621-55240643 AAGATAATGCCGCCAATGACTGG + Intronic
1025584089 7:62759781-62759803 AAACTAATGAATCCAAAGACAGG + Intergenic
1030070903 7:105696720-105696742 TTGCTAATGCAGACAGAGAAGGG + Intronic
1031788889 7:126073890-126073912 AGGCTAATGCAGCTTGAGAAGGG - Intergenic
1034944672 7:155254094-155254116 AAGCTACCACAGCCAGAGGCTGG - Intergenic
1035345191 7:158192843-158192865 AGGCTGAGGCAGCCAGAGGCCGG + Intronic
1037411471 8:18603015-18603037 AACCTAATGCAGCAACTGACAGG + Intronic
1037652672 8:20853080-20853102 AAGTTAATGGAGCCAGGGGCTGG + Intergenic
1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG + Intergenic
1046852271 8:118988083-118988105 AAGCTGCTGGAGCCATAGACTGG + Intergenic
1049296315 8:141841767-141841789 AAGCTAAAGAAGCCACAGAGGGG - Intergenic
1050441945 9:5673353-5673375 AATCTAATGCAGGCATAAACAGG + Intronic
1052033721 9:23657143-23657165 AAACTGAGGCAGCCAGAGCCAGG - Intergenic
1052616386 9:30847291-30847313 AAGCCAATACATGCAGAGACAGG + Intergenic
1052778271 9:32754902-32754924 GAACAAGTGCAGCCAGAGACTGG + Intergenic
1055525847 9:77133061-77133083 ATGGTAATGCAGCCACAGATAGG - Intergenic
1058994976 9:110290799-110290821 AACCTGATGTTGCCAGAGACAGG - Intergenic
1059416770 9:114167467-114167489 AAGATTATGCAGCCAGATAAGGG + Intronic
1059561135 9:115335564-115335586 AATCTAAATCAGCCAGGGACAGG + Intronic
1060758092 9:126227167-126227189 AAGGCAATGCAGCCAGGGCCAGG + Intergenic
1061166916 9:128928282-128928304 CAGCTCCTGCAGCCAGAGACAGG + Intronic
1061394641 9:130337341-130337363 AAGCGACTGCAGTCAGAGTCAGG + Intronic
1189075105 X:37906213-37906235 AAGCAAAGGCAGACAGACACAGG - Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1196103455 X:111871454-111871476 AAGGTAATCCAGCCAGGGAGTGG - Intronic
1196593540 X:117517028-117517050 AAGCAACAGCAGCCAGTGACTGG + Intergenic
1197280727 X:124532810-124532832 GAGCAAATGCAGCAAGATACAGG - Intronic
1198132039 X:133705361-133705383 TAGCTAATGTAGCTAGACACGGG + Intronic
1199824569 X:151485895-151485917 AAGTTAATGTATCCAGAGAGAGG - Intergenic