ID: 1172922108

View in Genome Browser
Species Human (GRCh38)
Location 20:38492635-38492657
Sequence GTGAACTAAAAAGTAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172922108_1172922109 4 Left 1172922108 20:38492635-38492657 CCTGTATTTACTTTTTAGTTCAC 0: 1
1: 0
2: 0
3: 30
4: 320
Right 1172922109 20:38492662-38492684 CAAATAATAATAATATCTAAAGG 0: 1
1: 1
2: 14
3: 115
4: 1002
1172922108_1172922110 5 Left 1172922108 20:38492635-38492657 CCTGTATTTACTTTTTAGTTCAC 0: 1
1: 0
2: 0
3: 30
4: 320
Right 1172922110 20:38492663-38492685 AAATAATAATAATATCTAAAGGG No data
1172922108_1172922111 21 Left 1172922108 20:38492635-38492657 CCTGTATTTACTTTTTAGTTCAC 0: 1
1: 0
2: 0
3: 30
4: 320
Right 1172922111 20:38492679-38492701 TAAAGGGTAAAAACCAGCATAGG 0: 1
1: 1
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172922108 Original CRISPR GTGAACTAAAAAGTAAATAC AGG (reversed) Intronic
900661309 1:3785497-3785519 TTGAACTAAAATGTAAATAAAGG + Intronic
902285272 1:15404275-15404297 GTGAACAAAAAACAAAATATAGG + Intergenic
902427006 1:16331452-16331474 TTTAATTAAAAAGTAAAAACCGG + Intronic
903937062 1:26903091-26903113 GTGAAATAAAAAACAAATCCAGG - Intronic
904739235 1:32660128-32660150 GGTAACTCAAAAGGAAATACGGG - Intronic
906419097 1:45648413-45648435 ATGGAATAACAAGTAAATACAGG - Intronic
907779143 1:57549343-57549365 GTTAACTAACAAATAAATACAGG - Intronic
909081507 1:71118127-71118149 CTGAACTATACAGTATATACAGG + Intergenic
909879444 1:80855230-80855252 GTTAAATAAAAAGAAAATCCTGG + Intergenic
910032976 1:82753741-82753763 GTGATGTAAATAGGAAATACTGG - Intergenic
913482805 1:119304899-119304921 GTTAAATAAAAAGTAAACGCAGG - Intergenic
913547466 1:119883478-119883500 CTGAAGTAAAAAGTACAAACGGG + Intergenic
914791478 1:150881192-150881214 ATGAACTAAAAAGCAAAAACAGG - Intergenic
918663724 1:187121315-187121337 ATGAACCAAAAAGTAAATTCAGG - Intergenic
918678676 1:187323732-187323754 GGGAACAAAAAAGAAAATGCAGG + Intergenic
918717793 1:187813711-187813733 GTGAATTTGAAAGTAAATAATGG - Intergenic
918962609 1:191299933-191299955 GGGAGCTAAACATTAAATACAGG - Intergenic
918981909 1:191572226-191572248 GTAACCTAAAAAGAAAACACTGG + Intergenic
919004664 1:191881417-191881439 TTTTACTAAAAAATAAATACAGG + Intergenic
919237969 1:194870796-194870818 GTGAACTAAGAAGGAAATCAAGG + Intergenic
919359205 1:196568814-196568836 TTGAAGCAAATAGTAAATACTGG + Intronic
920318724 1:205100256-205100278 GTTAATTAAAAAGCAACTACGGG + Exonic
920769863 1:208873046-208873068 GTGCCCAAAATAGTAAATACAGG - Intergenic
921736837 1:218638144-218638166 GTGTACTAGAAAGTAGTTACTGG - Intergenic
921994680 1:221405309-221405331 GAGGATTAAAAAGGAAATACAGG - Intergenic
923100941 1:230816665-230816687 GTGAACTCAAATGTAAATGATGG + Intergenic
924034203 1:239919414-239919436 GTGTATTAGAAAGTACATACGGG - Intergenic
1063816573 10:9781589-9781611 CTGAACTAAAAACTCAATATTGG + Intergenic
1063908806 10:10808621-10808643 AAGAATTTAAAAGTAAATACAGG + Intergenic
1064534080 10:16341005-16341027 GTTAACTTCAAAGTAAAAACAGG + Intergenic
1064921534 10:20524689-20524711 GTCAACTATAAAGTAAAGAGAGG - Intergenic
1067093227 10:43282261-43282283 GTGAACTGAAAAGTGCATCCTGG - Intergenic
1067253007 10:44604882-44604904 ATTAACTAAAAAGAAAATAGAGG - Intergenic
1068314712 10:55324846-55324868 TTGAGCTAATAAATAAATACAGG + Intronic
1068716666 10:60196376-60196398 GGGAAATAAAAGGTAAATGCTGG - Intronic
1072047780 10:91673890-91673912 TTAAATTAAAAAGTAAAAACAGG + Intergenic
1072095202 10:92171544-92171566 GTGAACTCAAAAGGAAACAAAGG + Intronic
1072605496 10:96978465-96978487 GTGAACTCTGAAGTACATACTGG - Intronic
1073715811 10:106106084-106106106 GTGGACTGAAAAAAAAATACGGG + Intergenic
1073726732 10:106240478-106240500 CTGAAATAAAAATTTAATACAGG - Intergenic
1074710804 10:116175960-116175982 GTGAATTAAAAAAAAAATAGGGG + Intronic
1079466878 11:20739498-20739520 GTGACAGAAAATGTAAATACAGG - Intronic
1079599759 11:22296419-22296441 GTGAAGGAAAAAATAAATACTGG + Intergenic
1079634630 11:22720807-22720829 GCGAACTGAAAATTTAATACTGG - Intronic
1080891796 11:36415213-36415235 ATGAACTTTAAAGTAGATACTGG + Intronic
1081005595 11:37733442-37733464 GTGAACTAATAAACAAATTCTGG - Intergenic
1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG + Intronic
1082192156 11:49259191-49259213 AAGAAATAAAAAATAAATACAGG + Intergenic
1082281011 11:50271301-50271323 ATCAAATAAAAAGTAAAAACAGG - Intergenic
1083554606 11:63615965-63615987 GTCAATTAAAAAGTAAAAAATGG - Intronic
1085478334 11:76802034-76802056 GGGAACTAAAGAATAAACACAGG - Intergenic
1085582238 11:77663398-77663420 ATCAACTAAAAAGTAAAAACTGG + Exonic
1085954111 11:81369863-81369885 CAGAACTGAGAAGTAAATACAGG + Intergenic
1087362545 11:97178777-97178799 GTGAAGTAAAAAGAGAAAACTGG + Intergenic
1088137377 11:106574179-106574201 GAGTACTAATAAGTAAATAGAGG - Intergenic
1088367019 11:109050548-109050570 GTTAAATAATAAGTAAATACTGG + Intergenic
1088448459 11:109956739-109956761 GTAAAATAAAATGTAAAAACAGG - Intergenic
1088475733 11:110236993-110237015 GTGAACTAATATTTAAATCCAGG + Intronic
1088561608 11:111121193-111121215 GTGAACTATAAAGCATTTACTGG + Intergenic
1089066101 11:115663144-115663166 GTGAACAAAACAATAAATTCAGG - Intergenic
1089945744 11:122471473-122471495 GTGAAATAAAAAGAAAAAAATGG - Intergenic
1090340774 11:126018198-126018220 CTTACCAAAAAAGTAAATACAGG - Intronic
1090692873 11:129202758-129202780 GTGAATTCAACAGTAAATATTGG - Intronic
1093263252 12:16967071-16967093 ATAAAATAAAAAATAAATACAGG + Intergenic
1093385363 12:18547241-18547263 GTGAAAGAAAAAGTAAAACCTGG - Intronic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1094269876 12:28601613-28601635 GTGAAATAAAAAATAAAAATGGG - Intergenic
1095159127 12:38895445-38895467 GTGAGATGAAAACTAAATACTGG - Intronic
1095188661 12:39230947-39230969 TTGAACTAAAATGGAAACACTGG - Intergenic
1095897989 12:47300028-47300050 GATAACTGAAAAGTAAACACTGG - Intergenic
1097751674 12:63361492-63361514 GTGAATAAAAAAGTATATATTGG + Intergenic
1098739806 12:74158172-74158194 GTGAATCAAAAAGAAAATCCAGG + Intergenic
1098962801 12:76756708-76756730 TAGAACTAATAAGTGAATACAGG + Intergenic
1099130268 12:78820191-78820213 GTGAGATAAAGAGTACATACTGG - Intergenic
1099489828 12:83274808-83274830 GTGAATTAACAAGTATATCCAGG - Intergenic
1099584196 12:84495062-84495084 CTGAAACAAAAAGTAAATAAAGG + Intergenic
1099646002 12:85357605-85357627 GTAAACTGAAAAGTTAAAACTGG + Intergenic
1099747867 12:86730341-86730363 AGGAAATAAAAAGTAAACACAGG + Intronic
1100409771 12:94304265-94304287 ATGAACTCAAATGTAAATTCAGG - Intronic
1100994747 12:100292765-100292787 GTGCAGTAAAAAATAAAAACAGG - Intronic
1105359394 13:19693008-19693030 GTCACCTAAAAGGTAAATAAAGG + Intronic
1105719018 13:23095582-23095604 GTGAACCACAAACTAAAAACAGG + Intergenic
1106489909 13:30211584-30211606 ATGAACCAAAAAGTAAACACTGG - Intronic
1107598906 13:41992609-41992631 GGGAACTAAGAATTAAAGACAGG + Intergenic
1109210652 13:59531642-59531664 GTGAACTGTTAAGTAGATACTGG + Intergenic
1110235095 13:73209516-73209538 GTGCACTAAAAAGGAAACACAGG - Intergenic
1110887355 13:80655882-80655904 GTGAACAAAAAACTAAAAACTGG + Intergenic
1111134136 13:84018428-84018450 GTGTTCTATAAAATAAATACTGG - Intergenic
1111634598 13:90887803-90887825 GTGAACTGAAAAATATATTCTGG + Intergenic
1112003108 13:95229979-95230001 GATAGCTAAAAAGTAAAAACAGG + Intronic
1112601926 13:100865041-100865063 GAAAACTAATAAGGAAATACTGG - Intergenic
1112906777 13:104432319-104432341 TTTAAATAAAAATTAAATACAGG + Intergenic
1112955920 13:105058193-105058215 GTTATATAAAAAGTAAATTCTGG - Intergenic
1113703356 13:112406009-112406031 GTAAACTAAAAAATAAAGAATGG - Intronic
1114051515 14:18922399-18922421 GTGAGTTAAAAAGAAACTACTGG + Intergenic
1114111046 14:19479525-19479547 GTGAGTTAAAAAGAAACTACTGG - Intergenic
1115902470 14:38167984-38168006 TTGAACTCAAACGAAAATACTGG + Intergenic
1117945640 14:61017007-61017029 GTTAACTGGAATGTAAATACAGG - Intronic
1118559144 14:67059284-67059306 GTTAATTAAAAACAAAATACTGG - Intronic
1120026599 14:79592634-79592656 GTGATCTACAAAGAATATACAGG - Intronic
1120509156 14:85392478-85392500 GTCAATTAAAAATTAAGTACAGG - Intergenic
1122185862 14:99995253-99995275 GTGAAATAACATGTAAATAATGG - Intronic
1123132267 14:105998234-105998256 GATATTTAAAAAGTAAATACTGG - Intergenic
1123463180 15:20493374-20493396 GTGAACTAAGAAGCTATTACTGG + Intergenic
1123582488 15:21729350-21729372 GATATTTAAAAAGTAAATACTGG - Intergenic
1123619138 15:22171946-22171968 GATATTTAAAAAGTAAATACTGG - Intergenic
1123654878 15:22507040-22507062 GTGAACTAAGAAGCTATTACTGG - Intergenic
1124274022 15:28310775-28310797 GTGAACTAAGAAGCTATTACTGG + Intronic
1124308789 15:28602240-28602262 GTGAACTAAGAAGCTATTACTGG - Intergenic
1127199692 15:56631102-56631124 GTTAACTGAAAAGGATATACAGG + Exonic
1127439206 15:58988990-58989012 TTGAACTAAAAAGAACAAACTGG + Intronic
1127947827 15:63772910-63772932 ATGAACTAAATGGTAAATATTGG - Intronic
1128002544 15:64206852-64206874 CTGAACTAAAATGAAAATCCAGG - Intronic
1130475424 15:84262040-84262062 GGGAATTAAAAAGAACATACAGG - Intergenic
1130482841 15:84376094-84376116 GGGAATTAAAAAGAACATACAGG - Intergenic
1130783269 15:87068313-87068335 TTTAACTAAAAAGTAAAAAAGGG + Intergenic
1131199446 15:90384714-90384736 ATGAACTAAAAAGAAAATCTAGG + Intergenic
1131215465 15:90531511-90531533 GTGAACAGAAATGTAAGTACAGG - Intronic
1131352186 15:91711259-91711281 GTGAACTCAGGAGTAAAAACAGG - Intergenic
1131812317 15:96185416-96185438 GTGAACTACAAAGTGTATATGGG + Intergenic
1132106290 15:99065095-99065117 TTGTACTAAAAAGTAGAGACGGG - Intergenic
1135564533 16:23501508-23501530 GAAAACTAAATAGAAAATACAGG - Intronic
1137657487 16:50172673-50172695 GTGAACTCTAAAGTAAATTACGG - Intronic
1138257149 16:55575772-55575794 CTGAAATAAAAAGTAAACTCAGG - Intronic
1139929120 16:70511063-70511085 GTTAATTAAAAACAAAATACAGG - Intronic
1140067274 16:71622203-71622225 GTGAACTAATAAGAAAACCCAGG + Intergenic
1140091570 16:71843420-71843442 GTCCATTAAAAAGTAAAAACAGG - Intergenic
1140311187 16:73850079-73850101 GTTTACTAAAAAGTAAATCGTGG - Intergenic
1142787306 17:2234227-2234249 GTAAAAAAAAAAGAAAATACAGG - Intronic
1143094831 17:4473090-4473112 GTGAAATAAACATTCAATACTGG - Intronic
1149828281 17:59849353-59849375 GGGATTTAAAAAGTGAATACAGG + Intergenic
1149856147 17:60084726-60084748 GTGAAATAAAAAATAAAAATAGG + Intergenic
1150716737 17:67578679-67578701 GTGAACAGAAAAGGAAATACAGG + Intronic
1203167078 17_GL000205v2_random:107243-107265 GTGAACTAAAAGGTAAAAGAGGG - Intergenic
1153595334 18:6719563-6719585 GTGTACTAAAAAATATTTACTGG + Intergenic
1155703793 18:28782599-28782621 GTGAACTAAAAATGAAAATCTGG - Intergenic
1155949272 18:31891178-31891200 GTAAACTACAAATTTAATACAGG + Intronic
1156984446 18:43332743-43332765 GAGAAATAAAAAGTAACTAAAGG + Intergenic
1158246423 18:55437892-55437914 GTGAAATTCAAAGTAAATATAGG + Intronic
1159123975 18:64201628-64201650 GTGAATTAAAAAGTGAACAATGG + Intergenic
1159494722 18:69187789-69187811 GGAAAATAAAAAGTAAATATTGG + Intergenic
1159824803 18:73194395-73194417 GTGAAATTAAAAGTACTTACAGG - Intronic
1159924565 18:74256240-74256262 GTGAACCAAAAAGAAAAAAGAGG + Intronic
1164434029 19:28212883-28212905 GTGATTTAAAAAGAAAATTCAGG - Intergenic
925511784 2:4635562-4635584 GAGCTATAAAAAGTAAATACAGG + Intergenic
928189741 2:29152807-29152829 GTGACGTCAAAAGTAAATACTGG + Exonic
928776706 2:34773301-34773323 GTGAAATAAAAATTGAGTACAGG - Intergenic
930339651 2:50096309-50096331 CTGAATTAAATAGTAAATACCGG - Intronic
930661862 2:54062848-54062870 ATGAACAAAAAAGAAAAAACAGG + Intronic
931819583 2:65937788-65937810 GACACCTAAAATGTAAATACTGG - Intergenic
931956376 2:67430458-67430480 GAGAACTAGAAAGCTAATACTGG + Intergenic
932685538 2:73866122-73866144 GTGAACTAAAAATTGAACCCTGG - Exonic
932802363 2:74752230-74752252 GTTAACTAGAGAGTAAATAGTGG + Intergenic
936377189 2:111951484-111951506 GTGTACAAAAAAGAAAATCCTGG - Intronic
937129884 2:119501860-119501882 TAGAACTAAAAAGTATATTCAGG + Intronic
937622927 2:124009677-124009699 GTGAATTAAAAAATAAAAAAAGG - Intergenic
938949085 2:136240839-136240861 GTCAACTAAAAATGAAATGCAGG - Intergenic
939598072 2:144152815-144152837 GTGAAATAAGCCGTAAATACAGG + Intronic
939604780 2:144240592-144240614 TTGAAGTATAAAGTAAATAAAGG - Intronic
939729234 2:145761266-145761288 GGGACCTAAAAAGTAAATGGTGG - Intergenic
940833752 2:158497391-158497413 GTGAACTAAAGAGAAAAAGCAGG - Intronic
941066804 2:160912557-160912579 GTGAACTCTAAAGCAAATGCAGG - Intergenic
941568461 2:167139161-167139183 GTAAGCTAGAAAGTGAATACTGG + Intronic
943365623 2:186964908-186964930 CTGAACTGAAAAGTGAACACAGG - Intergenic
947326137 2:228979353-228979375 GTGAACTTTAAAATAAATAAAGG - Intronic
947416026 2:229897344-229897366 GACAACTAAAAAATAAATAAGGG + Intronic
948138407 2:235654525-235654547 GTGTAGTAAAAAGTAAAGAATGG + Intronic
1170229690 20:14030998-14031020 GTGAACTAAAAAGCAAATCATGG - Intronic
1171454198 20:25258092-25258114 ATGATCAAAAAAGTAAAAACAGG + Intronic
1172548064 20:35777207-35777229 GAGAACTGACAAGTAAATACGGG - Intronic
1172922108 20:38492635-38492657 GTGAACTAAAAAGTAAATACAGG - Intronic
1175151773 20:56940603-56940625 CTGACCTAGAAAGAAAATACAGG - Intergenic
1176334478 21:5583317-5583339 GTGAACTAAAAGGTAAAAGAGGG + Intergenic
1176393279 21:6237631-6237653 GTGAACTAAAAGGTAAAAGAGGG - Intergenic
1176404681 21:6351856-6351878 GTGAACTAAAAGGTAAAAGAGGG + Intergenic
1176432476 21:6637248-6637270 GTGAACTAAAAGGTAAAAGAGGG - Intergenic
1176468140 21:7078543-7078565 GTGAACTAAAAGGTAAAAGAGGG + Intronic
1176491701 21:7460321-7460343 GTGAACTAAAAGGTAAAAGAGGG + Intergenic
1176508941 21:7678062-7678084 GTGAACTAAAAGGTAAAAGAGGG - Intergenic
1177230004 21:18307386-18307408 GTGAACTAGAGAGTAAAATCTGG + Intronic
1177313923 21:19431905-19431927 GAGTACTAAAAAGAAAATCCAGG - Intergenic
1178483426 21:33000737-33000759 TTAAACTAAAAATAAAATACAGG - Intergenic
1178872514 21:36388121-36388143 CTGAACTAAAAAGCATATCCAGG - Intronic
1179310616 21:40192621-40192643 ATGATCTAAAAAGGTAATACGGG - Intronic
1180679920 22:17618380-17618402 TTAAATTAAAAAGTAAATAAAGG + Intronic
1181794515 22:25295349-25295371 GTGAACGGATAAGTAAATATGGG - Intergenic
1182230581 22:28834832-28834854 GTCAATTAAAAATTAAATATTGG - Intergenic
1182978353 22:34644767-34644789 GAAAAATAAAAAGTAAATTCTGG - Intergenic
1183471796 22:38012380-38012402 TCAAACTAAAAAGTAAAAACAGG - Intronic
1183901379 22:41008631-41008653 TTTAATTAAAAAATAAATACTGG + Intergenic
949551962 3:5119185-5119207 GTAAACTAAAAATAAAATCCTGG + Intergenic
949630426 3:5920013-5920035 GTAAACTAAAAATAAAATCCTGG - Intergenic
949780702 3:7684381-7684403 ATGAGCTACAAAGTAAATAGTGG + Intronic
951292872 3:20895060-20895082 GTTAATTAAAAAATAAATAAAGG + Intergenic
952251466 3:31659998-31660020 TTGAACTAGAAAGAAAATATTGG + Exonic
952469474 3:33631085-33631107 GAGAGCTAAAAAGGTAATACAGG + Intronic
952893033 3:38056639-38056661 TTGAAATAAAAAGTAAAAACAGG + Intronic
953573825 3:44096765-44096787 GTAGACTAAGATGTAAATACAGG + Intergenic
954992693 3:54854829-54854851 GTCAAGCAAAAAGTAAATTCGGG + Intronic
956074375 3:65489080-65489102 GTGAACTAAGAAGAGATTACTGG + Intronic
956251789 3:67241546-67241568 GAGAACTGAAAAGTGAATAAAGG - Intergenic
956496377 3:69830872-69830894 GTAATCTGAAAAGAAAATACAGG - Intronic
957443206 3:80280095-80280117 GTGAATTAATAAATAAATAAAGG - Intergenic
957682426 3:83454163-83454185 GTATATTAAAAAGAAAATACAGG - Intergenic
957757906 3:84514521-84514543 GAAAACTAAAAAAGAAATACTGG - Intergenic
959921482 3:111872987-111873009 TTGAACTAAAAAGAAAAAATGGG + Intronic
960016512 3:112895570-112895592 GTTAATTAAAAAGGAAAAACTGG + Intergenic
962016317 3:131444151-131444173 AGGAACTGAAAAGCAAATACTGG + Intergenic
962419149 3:135212819-135212841 GAGAAGGAAAAAGAAAATACAGG - Intronic
962632486 3:137293365-137293387 GTGAATGAATAAATAAATACAGG + Intergenic
963363918 3:144310467-144310489 TTGAACCAAAAAGTAAAGAAAGG - Intergenic
964790257 3:160447618-160447640 GTGAATTAAAACTTAAAAACTGG - Intronic
965016025 3:163157774-163157796 GTAAATCAAAAAGTAAACACGGG + Intergenic
965107224 3:164372241-164372263 ATAAACTGAAAAGTAAAGACTGG + Intergenic
965440230 3:168703641-168703663 TTGAACTAAAAAATAATTAAAGG + Intergenic
968640834 4:1713594-1713616 GTAAACTAAAAATAAAATCCTGG + Intergenic
969387668 4:6866159-6866181 GTGAAATACAAAGTACATAAAGG - Intronic
969578368 4:8049391-8049413 GTAAACCAAAAATTAAATGCTGG + Intronic
972509313 4:39752706-39752728 TTGAACTCAATAGTAAATAGAGG + Intronic
973002794 4:44972666-44972688 GTGAATTACAAAGAAAATATTGG - Intergenic
974066621 4:57084103-57084125 GTTAACTAAAAAATAAAGACTGG + Intronic
974901294 4:68001750-68001772 GTGAAATAAAAAGAAAATCCAGG - Intergenic
975357942 4:73430339-73430361 GTGAACTAAGACATCAATACGGG - Intergenic
975932581 4:79543288-79543310 GTGAATGAATAAGTAAATAGTGG - Intergenic
975945694 4:79703603-79703625 TTGAACTAAATAATAAACACAGG + Intergenic
977377971 4:96232511-96232533 TTGAACTAATAAGCAAATATAGG + Intergenic
978611280 4:110543642-110543664 GTGAATTAAAAAAAAAATAGAGG - Intronic
978687736 4:111467579-111467601 GTTAATTAAAAAGGAAATCCTGG - Intergenic
978974136 4:114847528-114847550 GTGAACTAGAAATTAAATTCAGG + Intronic
979443918 4:120788002-120788024 GTTGACTAAAGAGTAAAAACAGG + Intronic
979752056 4:124291064-124291086 GTGAATTAAAAAGAAAAAAAAGG - Intergenic
979922266 4:126513472-126513494 ATGAAATAAAATGTAAATTCAGG - Intergenic
980687407 4:136246917-136246939 CACAATTAAAAAGTAAATACTGG - Intergenic
981468633 4:145102786-145102808 GTGAACTAAAAAGATAAGAATGG + Intronic
982260768 4:153492313-153492335 GTGAACTAAAAAGAAAAAATTGG - Intronic
982923710 4:161307932-161307954 GTGAACTAAATAAAAAATAGAGG + Intergenic
983236459 4:165185679-165185701 GTGACCAGAAAAGTAAAGACGGG + Intronic
983609543 4:169627279-169627301 GTGAGGTAAAAAGTCAATACAGG - Intronic
984519778 4:180787887-180787909 GTGAACTACAACCTAAATAGAGG - Intergenic
984645710 4:182217559-182217581 GCGAATTAAAGAGTTAATACCGG - Intronic
984754633 4:183313824-183313846 GAGAACTGAAAAGTACATCCGGG + Intronic
986861417 5:11931269-11931291 TTGAACTATGAAGAAAATACTGG + Intergenic
988056974 5:26110049-26110071 GTGAAATAACAAGTTAAGACTGG + Intergenic
988690024 5:33562511-33562533 CTGAACTAAAAAAAAAAGACAGG + Intronic
989130078 5:38098717-38098739 TTAAATTAAAAAGTAAATAATGG + Intergenic
989771271 5:45149011-45149033 ATGAACTAAAAAATAAACAAAGG + Intergenic
990928936 5:61064346-61064368 GAGAATTAATAAGGAAATACTGG + Intronic
991219904 5:64201499-64201521 ATGAACTAGAAAGTAATTAATGG + Intronic
991586011 5:68202556-68202578 GTAAAATAAAAAATAAATCCAGG - Intergenic
991774395 5:70070586-70070608 GTAAACAAAAAAGTAAAGTCTGG - Intronic
991853690 5:70946011-70946033 GTAAACAAAAAAGTAAAGTCTGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992155320 5:73949734-73949756 GTGAACTGAAAAGGAAATTGGGG + Intergenic
992920660 5:81514266-81514288 GAGGACAAAAAAGTAAATAAGGG + Intronic
995036894 5:107544268-107544290 CTGAACAAAACAGTAAATGCTGG + Intronic
995588022 5:113669622-113669644 ATCAACTAAAAAGTAGATAAAGG + Intergenic
996342078 5:122450515-122450537 GTGAACTAAAAAGAAGATGAAGG - Exonic
996598636 5:125234595-125234617 GTGGAATAAAAAGTAACTAGAGG - Intergenic
996611440 5:125384979-125385001 GTGACCTAAAAAATAATTTCTGG - Intergenic
996980714 5:129490613-129490635 GTGAAATATAGAATAAATACTGG + Intronic
997299810 5:132794755-132794777 GATAACTAAATAGTAAATAATGG + Intronic
998240433 5:140437766-140437788 GTGAATAAAGAAATAAATACAGG - Intronic
998622889 5:143813516-143813538 CTGAACTGAAAAGTAAAAAATGG + Intronic
998646866 5:144071675-144071697 GTGAAAGAAAAAATAACTACAGG - Intergenic
998830618 5:146154475-146154497 GTCAATTAAAAAATGAATACAGG + Intronic
1000727832 5:164793578-164793600 GTAAACAAAAAAATAAATAAAGG + Intergenic
1002951693 6:1819266-1819288 GAGAAATAAAAAGTTAATGCAGG + Intronic
1004002639 6:11609477-11609499 GTGAACAAATAAGCAAATAGGGG + Intergenic
1004080197 6:12384705-12384727 TTGAAGTAAAAAGTAAATATGGG - Intergenic
1004113349 6:12743136-12743158 GTGAACTAACAAGTAATCTCTGG - Intronic
1005165439 6:22914923-22914945 GTAAACAGAAAAGGAAATACTGG - Intergenic
1006532818 6:34671642-34671664 GGAAACTAAAAAGGAAGTACTGG - Intronic
1006600400 6:35221765-35221787 ATGAACTAAAAGTTAAATAATGG + Intronic
1007571266 6:42892655-42892677 GAGACATAAAAAATAAATACAGG + Intergenic
1007855946 6:44857644-44857666 ATCGACTAAAAAGTAAAAACTGG - Intronic
1009244848 6:61224165-61224187 GTAAATGAAAAAGTAAATAAAGG + Intergenic
1010623765 6:78110375-78110397 GTGAAATAAAAATTAAACAATGG + Intergenic
1011154672 6:84316661-84316683 GTGAACTAATAAGCAAATTTTGG - Intergenic
1012402693 6:98857205-98857227 GTGACCTACAAATTATATACAGG - Intergenic
1012603656 6:101130848-101130870 GTAAACTAAAAAGGAAAGGCAGG + Intergenic
1012694595 6:102362884-102362906 GTGATCAAAAAGGTAAATACTGG + Intergenic
1012982092 6:105841555-105841577 GTTAATTATATAGTAAATACTGG - Intergenic
1013513788 6:110867362-110867384 ATAACATAAAAAGTAAATACAGG + Intronic
1014044291 6:116866499-116866521 GTTAACTGAAAAGACAATACAGG + Intergenic
1014306722 6:119752331-119752353 GAAAACTAAAAAATAAATTCTGG - Intergenic
1014356015 6:120411211-120411233 GTGAAGTAAAAGGTAAACAGTGG - Intergenic
1014706349 6:124752088-124752110 GTGAAATAAAAAGTAAAGCTAGG - Intronic
1016652298 6:146476250-146476272 GTGCACTAAAAAGGAAAAACAGG + Intergenic
1018016871 6:159720348-159720370 CTGTATTAAAAAGTACATACAGG - Intronic
1019992570 7:4702644-4702666 GTGAACTAAACAATGAATGCTGG - Intronic
1020663315 7:11008190-11008212 GTAAACTGAAAAATAAATAGGGG - Intronic
1020981619 7:15076591-15076613 GTGAACTGAAGGGTAAATAATGG - Intergenic
1021371294 7:19851157-19851179 CAGAACTAAAAAGTAAATTTAGG + Intergenic
1021551192 7:21872780-21872802 ATGAACTCAAAAGGAAATAAGGG - Intronic
1022648396 7:32252655-32252677 GAGAACTAAAAAATCAATCCAGG + Intronic
1028175809 7:87657201-87657223 ATGAGGTAAAAAGTAAATCCAGG - Intronic
1028802803 7:94986156-94986178 TTTAACTAAAAAGAAAATAATGG - Intronic
1029446211 7:100614165-100614187 GGGCAGTAAAAAGTAGATACAGG + Intronic
1030437022 7:109535162-109535184 GTGGACAAATAAGGAAATACTGG - Intergenic
1031212122 7:118842867-118842889 ATGAACAAACAAATAAATACAGG - Intergenic
1032271931 7:130416962-130416984 GTTACCTAAAAAGAAAATAAGGG + Exonic
1032687498 7:134250386-134250408 GTGAACAAAAAAACAAAAACTGG - Intronic
1033602790 7:142900567-142900589 GTGTAATAAAAAGAAAATATAGG + Intergenic
1033870414 7:145747636-145747658 GAGAAATAAAAATTAAACACAGG + Intergenic
1034947399 7:155271877-155271899 GTGAACTGTAAAGTCACTACTGG - Intergenic
1036926387 8:12909788-12909810 ATGAACTAAAAAGAAAATTTGGG + Intergenic
1037036394 8:14173644-14173666 CTTAACTAAAAAGCCAATACTGG + Intronic
1039677225 8:39682612-39682634 TAGAACTAAAAAGAAATTACTGG - Intronic
1039728744 8:40252086-40252108 GTCAAATAAAAAAAAAATACAGG - Intergenic
1039744678 8:40413576-40413598 GTGAAATAACAAACAAATACAGG - Intergenic
1040710738 8:50185673-50185695 GTGAACTTTAAAGTAAAAAAAGG - Intronic
1042013463 8:64278511-64278533 AAGAATTAAAAGGTAAATACTGG - Intergenic
1043658193 8:82699607-82699629 TTGAACTGAAAAGCAAATACTGG - Intergenic
1043764385 8:84111314-84111336 GGGAGCTAAACACTAAATACAGG - Intergenic
1044454398 8:92375826-92375848 GTTAACTACAAAGGAAATGCTGG - Intergenic
1045422547 8:102030578-102030600 GGTAACCAAAAAGTAAATAAGGG + Intronic
1046260042 8:111756283-111756305 CTGAAATAAAAGGTAAATATAGG - Intergenic
1046377689 8:113408547-113408569 CTGATCTAAAAAGAAAATAAAGG + Intronic
1046480132 8:114805996-114806018 GAGAACTAAAAAGGAAACATGGG + Intergenic
1046637727 8:116690820-116690842 TTTAAATAAAAAGTAAAAACAGG + Intronic
1050599397 9:7235255-7235277 GGGAACTAAAAAGTTAATTCTGG + Intergenic
1050782478 9:9354960-9354982 GTGGACAAAAAAGAAAATAAAGG + Intronic
1051667434 9:19478224-19478246 GTGGGTTAAAAAGTACATACTGG + Intergenic
1051722361 9:20050880-20050902 CTGAACTAAAAAATAATTAAAGG + Intergenic
1051804824 9:20980700-20980722 GTGATCTAAAAAGTAAAATCTGG - Intronic
1052152663 9:25137835-25137857 GAGAACAAAAAAGAAACTACAGG + Intergenic
1052171662 9:25405750-25405772 CTGAACTTAAAATTAAATAAGGG - Intergenic
1052182159 9:25543073-25543095 GAGAACTACAAAGCAAATTCTGG - Intergenic
1053509011 9:38671351-38671373 GTAAATTAAAAAATAAATTCAGG + Intergenic
1056372244 9:85968181-85968203 ATGAACTAGAAAGAAAATACTGG - Intronic
1056996141 9:91461305-91461327 TTTAACTAAAAAATAAATTCAGG + Intergenic
1058223864 9:102336783-102336805 GTGAACTTGAATGTAAATAACGG - Intergenic
1059978655 9:119745164-119745186 GTGATATAAAAAGAAAATATAGG + Intergenic
1062653146 9:137588818-137588840 GTGAAGTGGAAAGTAACTACAGG + Intronic
1203427154 Un_GL000195v1:51601-51623 GTGAACTAAAAGGTAAAAGAGGG - Intergenic
1203439059 Un_GL000195v1:171464-171486 GTGAACTAAAAGGTAAAAGAGGG + Intergenic
1186006089 X:5074092-5074114 GTCAATTAAAAAGAAAATAAAGG + Intergenic
1186758277 X:12696153-12696175 ATGAACAAATAAGTAAATAAAGG - Intronic
1187655908 X:21473686-21473708 ATAACCTAAAAAATAAATACTGG - Intronic
1189130681 X:38495054-38495076 AAGTACTAAAAAGTAAATATTGG - Intronic
1192984167 X:76379088-76379110 GTGAACTTTAATGTAAATTCTGG + Intergenic
1193266294 X:79474012-79474034 GTGACCTAAAAAGTTCAAACTGG + Intergenic
1193682211 X:84536056-84536078 GTCAATTAAAAAGTAAAAAGTGG + Intergenic
1194735205 X:97504648-97504670 GTGAAAGAAACAGTAAGTACAGG - Intronic
1195453231 X:105038906-105038928 GTTAAGTAAAAAGTGAATTCAGG - Intronic
1195569381 X:106381696-106381718 GAGCTCCAAAAAGTAAATACTGG - Intergenic
1195638730 X:107150255-107150277 GTGAACAGAAAAATAAATACAGG + Intronic
1196654559 X:118203501-118203523 GGTAAATAAAAAATAAATACAGG - Intergenic
1197240467 X:124117875-124117897 ATGAACAAAAAATTAACTACAGG + Intronic
1199323003 X:146463187-146463209 GTGAAGTAAAAAGAAAACCCAGG - Intergenic
1199618914 X:149681739-149681761 GGTAACTAAAAAGTTAATACAGG + Intergenic