ID: 1172922486

View in Genome Browser
Species Human (GRCh38)
Location 20:38496968-38496990
Sequence CTGCTCACATTGAAGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172922486_1172922491 -8 Left 1172922486 20:38496968-38496990 CCATTCTGCTTCAATGTGAGCAG 0: 1
1: 0
2: 0
3: 23
4: 228
Right 1172922491 20:38496983-38497005 GTGAGCAGCAAGGGTGGCGGTGG 0: 1
1: 0
2: 5
3: 50
4: 529
1172922486_1172922492 -7 Left 1172922486 20:38496968-38496990 CCATTCTGCTTCAATGTGAGCAG 0: 1
1: 0
2: 0
3: 23
4: 228
Right 1172922492 20:38496984-38497006 TGAGCAGCAAGGGTGGCGGTGGG 0: 1
1: 0
2: 1
3: 31
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172922486 Original CRISPR CTGCTCACATTGAAGCAGAA TGG (reversed) Intronic
902860148 1:19239410-19239432 CTCCCCACTTTGGAGCAGAATGG + Intronic
902940053 1:19794375-19794397 CTGCTCACAGTTAAGCACAGTGG + Intronic
904724304 1:32535270-32535292 CTACTAAGATTCAAGCAGAAGGG - Intronic
905274520 1:36808338-36808360 CAGCTCACATTCAAGAAGAGGGG - Intronic
907488129 1:54791161-54791183 TTGCTCACATAGAAGCAGCCAGG - Intronic
909976722 1:82054122-82054144 CTCCACACTTTGCAGCAGAAGGG - Intergenic
912296272 1:108473938-108473960 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
916283071 1:163074120-163074142 CTGCTCTCTCTAAAGCAGAAAGG + Intronic
916328109 1:163586053-163586075 TTGCTCTCATTTGAGCAGAAAGG - Intergenic
917485973 1:175454923-175454945 CTGCTCAGATTCAAGAGGAAGGG - Intronic
918146391 1:181759643-181759665 CTGCACACAATGAAGCAGGTTGG - Intronic
919021056 1:192106329-192106351 TTCTTCACATGGAAGCAGAAAGG - Intergenic
919242377 1:194931606-194931628 TTGCCCACATTCAAGCAGAGAGG + Intergenic
922751713 1:228073219-228073241 CTCCTCCCATTGGGGCAGAAGGG + Intergenic
922934605 1:229413355-229413377 CCGCTAAGAGTGAAGCAGAAGGG - Intergenic
923408821 1:233688186-233688208 CTGCTAACGGTGAAGGAGAAAGG + Intergenic
923509093 1:234633940-234633962 GTGCTCACAATAAAGCAGAAAGG - Intergenic
923668597 1:236020629-236020651 CTGCACACACTGAATCACAAAGG + Intronic
923771365 1:236940439-236940461 CTGCTAACATTGGAGCAGGTGGG + Intergenic
924117258 1:240760724-240760746 CTACTCACAAAGAAGCATAAAGG + Intergenic
1065249723 10:23798345-23798367 CTGTCCTCATGGAAGCAGAAAGG + Intronic
1067167148 10:43874363-43874385 ATGTTCTCATGGAAGCAGAATGG - Intergenic
1067784841 10:49238057-49238079 CTGCACACATGGTAGGAGAAAGG - Intergenic
1067905076 10:50282092-50282114 CTGTTCAGATTGAAGTGGAAAGG - Intergenic
1068157411 10:53219885-53219907 CTGCTCACTTGTAACCAGAATGG - Intergenic
1068839169 10:61590944-61590966 CAGCTCACACTGAAGCAGTAGGG - Intergenic
1069715758 10:70520185-70520207 CTTCTCAGACTGCAGCAGAAAGG - Intronic
1071960880 10:90808277-90808299 CTGCTAAGAGTGAAGGAGAAGGG - Intronic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1074045615 10:109835952-109835974 CTTCTAATATTGAAGCAAAACGG + Intergenic
1074767262 10:116708404-116708426 CTGCTCCCCTAGAAGCAGACAGG - Intronic
1078273496 11:9819695-9819717 GTCCTCATATTGAAGGAGAATGG + Intronic
1080558437 11:33438807-33438829 CTGATCACAGAGAAGCAGAAAGG - Intergenic
1081323056 11:41714648-41714670 CTACTCAAATGGAAGCAAAAGGG + Intergenic
1081356613 11:42121593-42121615 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
1081690190 11:45072766-45072788 CTGCTCACTTGGGAGCAGAGGGG + Intergenic
1084141884 11:67237264-67237286 ATGATGAGATTGAAGCAGAAAGG + Intronic
1084613509 11:70219180-70219202 CTGCTAAGAGTGAAGAAGAAGGG + Intergenic
1084736509 11:71108832-71108854 CTGCTCACAGCGAAGCCTAAGGG + Intronic
1086560134 11:88158212-88158234 CTGCCAAGATTGAATCAGAAAGG + Intronic
1086745120 11:90415905-90415927 CTGCCCACACTTAAGCAGAGAGG - Intergenic
1087381181 11:97407172-97407194 CTGCTCACATTGCAGAAGGAAGG - Intergenic
1087385983 11:97469533-97469555 TTGCTTAAATTGAAGCAGAATGG - Intergenic
1087399790 11:97651324-97651346 CTGCCCACCTTGGAGGAGAAAGG + Intergenic
1087757822 11:102073558-102073580 GTGCTCAGATGGAAGCAGCATGG + Intronic
1090004366 11:122988015-122988037 TTTCAAACATTGAAGCAGAAAGG + Intergenic
1091235315 11:134018224-134018246 CTGCTCACAGTGACGCAGCCCGG - Intergenic
1092258771 12:6941402-6941424 CTGCTGACATCGGGGCAGAAAGG - Exonic
1092997282 12:13962349-13962371 CTTCTCCCATGGAAACAGAAGGG + Intronic
1094294516 12:28889240-28889262 CTGCTCACACTCAAGAGGAAGGG + Intergenic
1094362618 12:29646375-29646397 CTGCTAACATTGAAACATAAAGG - Intronic
1095192642 12:39275116-39275138 CAGCTCACATTGAAGGAGCTAGG + Intergenic
1095515498 12:43000698-43000720 CAGCCCAGATTGAAGCGGAAAGG + Intergenic
1097327051 12:58288882-58288904 CTTCTCACATTGTAGCAAAGTGG - Intergenic
1098628853 12:72704280-72704302 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1098654013 12:73006627-73006649 CTGCTAAGGTTGAAGGAGAAGGG + Intergenic
1100379695 12:94049965-94049987 CTGCCCACATTCAAGGGGAAGGG + Intergenic
1100478699 12:94957485-94957507 CTACTCTCTTTGAAGCACAAAGG - Intronic
1100867334 12:98870750-98870772 ATGCTGACATAGATGCAGAAGGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101432556 12:104638653-104638675 CTGCTAACTTTGCAGAAGAATGG + Intronic
1106956539 13:34943541-34943563 CTTCTCACATTTCAGCAGCACGG - Intronic
1107075354 13:36317325-36317347 CTGCTAAGAGTGAAGGAGAAGGG - Intronic
1110503849 13:76261245-76261267 CTCTTCACAGTGCAGCAGAAGGG - Intergenic
1113276346 13:108734958-108734980 CTGCACACATGGTAGGAGAAAGG + Intronic
1115836653 14:37413404-37413426 TTGCTCACCTTGAAGATGAAAGG - Intronic
1116010865 14:39350349-39350371 TTGCTCAAATTGAAGCTTAATGG + Exonic
1120522783 14:85544162-85544184 CTGCTCAGAGTAAGGCAGAAAGG - Intronic
1121689502 14:95866114-95866136 TTGCTCACATTCAAGAAGAAGGG - Intergenic
1126519694 15:49578178-49578200 CAGCTCAAGTTGGAGCAGAAAGG - Intronic
1126800384 15:52292794-52292816 CTGCTCAAATTGAAGGTGGAAGG + Intronic
1126942577 15:53782246-53782268 CTCTTCACATTGCAGCAGAAAGG + Intergenic
1127553675 15:60066212-60066234 CTGCTCACAGTGGCGCAGATGGG - Intergenic
1128079556 15:64848164-64848186 ATGAACACATGGAAGCAGAATGG + Intronic
1129602404 15:77007915-77007937 CTGCAGTCACTGAAGCAGAAGGG + Intronic
1130057097 15:80536068-80536090 TTGCTGGCATTGAAGCAGCATGG + Intronic
1130356578 15:83137466-83137488 TTGCTCACACTGAAACATAAGGG - Exonic
1130884881 15:88084448-88084470 CTGCTTCCAATGAAGCAGAATGG - Intronic
1131056023 15:89375661-89375683 CTGCACAGATGGAAGCTGAAAGG - Intergenic
1135674805 16:24406332-24406354 CTCATCACATTGACACAGAACGG + Intergenic
1137370831 16:47904304-47904326 CTGGACACACTGAAGCAGAAAGG - Intergenic
1137390610 16:48078345-48078367 CAGTTCACATTGAAGCAGGGAGG - Intergenic
1138804721 16:60079726-60079748 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1139384047 16:66552749-66552771 CCTTTCACACTGAAGCAGAAGGG - Exonic
1139635435 16:68255642-68255664 GTGCTCACATTCAAACAGAGCGG - Intronic
1140653530 16:77115220-77115242 GGGCCCTCATTGAAGCAGAATGG + Intergenic
1140779112 16:78277579-78277601 AAGCTCACACTGAAGCAGATTGG - Intronic
1141411121 16:83833811-83833833 CAGCCCACATCTAAGCAGAAGGG - Intergenic
1143994075 17:10991672-10991694 CTGCCCAAATTGAAGTGGAATGG - Intergenic
1148439784 17:47705977-47705999 CTTCTCACAGTGAAACAGACAGG - Intronic
1150413305 17:64965273-64965295 GTGCTGACATTCAAGCTGAAAGG - Intergenic
1150983071 17:70165642-70165664 AGGCTCACATTGATGGAGAAGGG + Intergenic
1151149057 17:72067986-72068008 TTGTTGACATTGAAGCAGAAGGG - Intergenic
1151245596 17:72792222-72792244 TTGCACACAGTGAACCAGAAGGG + Intronic
1153370491 18:4309935-4309957 CCACTCACACTGAAGCAGAGCGG - Intronic
1153660434 18:7321013-7321035 CTGCTCACATGAAAGGACAAGGG + Intergenic
1154135357 18:11773030-11773052 CTGCTGAGAGTGAAGCACAAAGG - Intronic
1156530805 18:37813421-37813443 CTGCTCACATTGAATGAGGGTGG - Intergenic
1158256113 18:55550891-55550913 TTGGTCACATTGAAGCAGGGAGG - Intronic
1158414258 18:57235599-57235621 CTGCTCCCATTGTATCTGAAGGG - Intergenic
1159002250 18:62984773-62984795 ATGCACACAGTGAAGCAGGAGGG - Intergenic
1159284267 18:66328848-66328870 CAGTTCACATTGAGGCAGGATGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160491381 18:79338741-79338763 ATGTTCTCATTGAAGCCGAAAGG + Intronic
1167180101 19:47896676-47896698 ATGCTCACGTTGAAACAGAGTGG + Intergenic
1168006571 19:53494699-53494721 CTGCTAAAATTGAAACAAAAAGG + Exonic
925820401 2:7794201-7794223 CTGCTCACAGAGCAGGAGAAAGG - Intergenic
930745379 2:54877654-54877676 CTGGTAACATTTAAGCATAAGGG + Intronic
931236656 2:60418328-60418350 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
932295645 2:70621573-70621595 CTGCTAAGAGTGAAGGAGAAGGG - Intronic
932338860 2:70947037-70947059 CTGCCCACATTGAATCACACAGG + Intronic
934053469 2:88231006-88231028 CTGCTGACACTGAACCAGCAGGG + Intergenic
935122649 2:100196320-100196342 CTGCTGACAGTGAACAAGAAAGG - Intergenic
935285471 2:101560425-101560447 CTGCTACCATGGAAGCAGCATGG - Intergenic
935382637 2:102467992-102468014 CTGCTCAGAGTGAAACAGAGGGG - Intergenic
935541461 2:104353807-104353829 CAGCTCCCATTAAGGCAGAATGG + Intergenic
938924604 2:136027395-136027417 CAGCTCACAATGAACCAGGATGG + Intergenic
940700044 2:157029197-157029219 GTGCTCACATGGTAGAAGAATGG - Intergenic
940865552 2:158814365-158814387 CTGCCAACATTCTAGCAGAATGG - Intronic
940904378 2:159155719-159155741 TTGCTCAGTTTGAAGCAGAGAGG + Intronic
940928983 2:159404154-159404176 ATGGTAACATTAAAGCAGAAAGG - Intronic
941598834 2:167513413-167513435 TTGTTCACATTAAAGCAAAATGG - Intergenic
942335738 2:174883576-174883598 CTGCTCATATTGAAGCATATGGG - Intronic
942339794 2:174931898-174931920 CTGGTCAGGCTGAAGCAGAATGG + Intronic
943141251 2:183984734-183984756 TTGCTCTCTTTGAAGCACAATGG + Intergenic
944528904 2:200648896-200648918 CAGCTCCCATACAAGCAGAAGGG + Intronic
946671293 2:222107086-222107108 TTGTTCACAGAGAAGCAGAAAGG - Intergenic
947135296 2:226971389-226971411 GTCATCACAGTGAAGCAGAACGG + Intronic
949069589 2:242016070-242016092 CTGCCCGCATTGAGGCAGCAGGG - Intergenic
1169909440 20:10635522-10635544 TTGCTCACTTTGGAGCAGACAGG + Intronic
1170027439 20:11905355-11905377 CTGGTCAAATTGAAATAGAATGG - Intronic
1170313970 20:15023432-15023454 CTAATCACATAGAAGCAGCACGG + Intronic
1170757482 20:19217219-19217241 CAGCCCACGTTGAAGGAGAAGGG + Intronic
1172922486 20:38496968-38496990 CTGCTCACATTGAAGCAGAATGG - Intronic
1173129361 20:40374517-40374539 CTGCTCACACTCAAGGGGAAAGG - Intergenic
1176906057 21:14503057-14503079 CTGCTCACACTCAAGGAGAGGGG - Intronic
1178889863 21:36512068-36512090 CTGCTCACATAGGAGCATCAGGG - Intronic
1179785705 21:43728604-43728626 CTGCTCACAGCGAGGCAGACAGG - Intronic
1180989247 22:19924415-19924437 CCTTTCACACTGAAGCAGAAGGG + Intronic
1183613583 22:38927564-38927586 CTGGGCAGATTGGAGCAGAACGG + Intergenic
1184338742 22:43873588-43873610 CTCTTTACATGGAAGCAGAAAGG - Intergenic
949734031 3:7149827-7149849 CTGATTACATTGAATCACAATGG + Intronic
955482683 3:59405197-59405219 CCGCTTACATTGCAACAGAAAGG + Intergenic
957072648 3:75578955-75578977 CTGAACCCATTGAAGCAGCACGG - Intergenic
957969749 3:87367395-87367417 CAGCTCACATTAAAGGGGAAAGG - Intergenic
958994628 3:100889813-100889835 CTCCTCAAAATGTAGCAGAAAGG + Intronic
960287471 3:115845613-115845635 CTGCCCACATGAAAGCAGAAAGG - Intronic
960844679 3:121994752-121994774 CTGCTCAGAGTGAAGGAAAAAGG + Intronic
960933300 3:122876589-122876611 CTGCTCACCTTGAGTGAGAAAGG + Intronic
961995719 3:131239931-131239953 CAGTTCTCATTGAAGCTGAATGG - Intronic
963652872 3:148006438-148006460 TTGCTCACATTCAAGAAGAGAGG - Intergenic
963684117 3:148415305-148415327 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
965030778 3:163364199-163364221 ATGCTCACACTGTAGCAGCAAGG - Intergenic
967496025 3:190145541-190145563 CTGCTAAGAGTGAAGAAGAAGGG - Intergenic
968828107 4:2914554-2914576 CTCCTCACTGTGGAGCAGAAGGG - Intronic
969197785 4:5576869-5576891 GAGCTCACACTGTAGCAGAAAGG - Intronic
974892661 4:67900354-67900376 CTGCCTACTTGGAAGCAGAAGGG + Intergenic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
976070518 4:81234924-81234946 CTGCTCAGTTTGCTGCAGAATGG - Intergenic
976222934 4:82772656-82772678 TTTCTCACATGGAGGCAGAAAGG + Intronic
977013159 4:91659485-91659507 CTGCTAACAGTGAAGGAGAAGGG + Intergenic
977724538 4:100280166-100280188 CTGCTCAGATTGAAGGAGAGTGG + Intergenic
979142408 4:117193670-117193692 CTGCTCACACTGAAAGAGACCGG - Intergenic
979146413 4:117253060-117253082 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
979824666 4:125218209-125218231 CTTCTCACATGGCAGCAGCAAGG - Intergenic
983098352 4:163593348-163593370 CTGCATACATTGAAGTAAAAAGG + Intronic
984186353 4:176548211-176548233 CTGTTGACATTGAAGCAAGATGG - Intergenic
984512132 4:180692454-180692476 CTCTTCACATGGCAGCAGAAAGG + Intergenic
984887696 4:184465270-184465292 CTCCACACATGGAGGCAGAAAGG + Intronic
986582897 5:9283609-9283631 CTGCTCACATTCAAGGGGAGGGG + Intronic
987499554 5:18690654-18690676 CTCCTCATATTGAAGAAAAAAGG - Intergenic
987714314 5:21547070-21547092 ATGCTCACATTGAAACATAAGGG + Intergenic
990719398 5:58676461-58676483 TTGCCCACATTGGAGCACAATGG - Intronic
990980187 5:61595502-61595524 TTGCTCCCATTTAAGCAAAAAGG + Intergenic
992620606 5:78588924-78588946 CTTAGCACATTGAAACAGAATGG - Intronic
993103505 5:83571143-83571165 ATGCTCAAATTGACCCAGAAAGG + Intronic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
993732216 5:91435964-91435986 TTGTTCAGATTGAAGGAGAATGG + Intergenic
994506066 5:100644352-100644374 ATGCACACAATTAAGCAGAAAGG + Intergenic
996612849 5:125404504-125404526 CTGCTCTGAGTGAAGCATAAGGG - Intergenic
996862417 5:128082543-128082565 CTGCTTATATAGAAACAGAAAGG - Intergenic
1002075677 5:176707014-176707036 TTCCTCACATGGCAGCAGAAAGG + Intergenic
1003501980 6:6710508-6710530 CTGCTCAGTTTGAAGTAGATTGG + Intergenic
1003541763 6:7024402-7024424 CTGCCCACACTCAAGGAGAAGGG + Intergenic
1004105995 6:12668134-12668156 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1004106028 6:12668255-12668277 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1005205336 6:23396720-23396742 GTGCACACATGGAAGCAGGAAGG + Intergenic
1006212328 6:32407044-32407066 CTGCTGACAATGAAGCAGTCAGG - Exonic
1007916808 6:45568871-45568893 CTCCTCACATTCAAGGAGAGGGG + Intronic
1009002414 6:57735009-57735031 ATGCTCACACTGAAACATAAGGG - Intergenic
1009051827 6:58284326-58284348 TTCTTCACATTGCAGCAGAAAGG - Intergenic
1009981807 6:70734973-70734995 CTTCTCCCAGTGAAGCAAAAGGG - Intronic
1010935956 6:81861623-81861645 GTGCTCACACAGAAGCAGGAAGG + Intergenic
1011168167 6:84474868-84474890 CTGTTCACTTTGAGACAGAAGGG - Intergenic
1011544071 6:88465478-88465500 TGGCTCACATTCAAGGAGAAGGG + Intergenic
1012286621 6:97397863-97397885 GTGCTCAAATTGAAGCATAAAGG - Intergenic
1012394533 6:98780926-98780948 TTGCTCTCATTGAAAAAGAAAGG - Intergenic
1013614933 6:111834197-111834219 CTGGTTCCATTGAAGGAGAAGGG + Intronic
1014336093 6:120139470-120139492 CTGTTGACTTTGAAGTAGAAGGG + Intergenic
1014794224 6:125706685-125706707 CCGCTAACAGTGAAGGAGAAGGG + Intergenic
1015515266 6:134077167-134077189 CTGCCCACACTCAAGAAGAAGGG + Intergenic
1017802434 6:157909442-157909464 CTACTCACGTGGGAGCAGAAGGG + Intronic
1018623339 6:165752355-165752377 TCGCTCACTTTGATGCAGAATGG - Intronic
1019416594 7:930331-930353 CAGCTAACATTGCAGCAGAAAGG + Intronic
1019992326 7:4701006-4701028 CTGCTCACAGTGGAGCAGACTGG + Intronic
1021405195 7:20259104-20259126 CTGCTCATATTGAAACAACATGG - Intergenic
1021474924 7:21050091-21050113 CTGCTCAGATTCAAGGAGAGAGG + Intergenic
1021794975 7:24245401-24245423 CAGCTCAAATTCAAGAAGAAGGG + Intergenic
1021902009 7:25295060-25295082 TTCCTCACATTTAAGAAGAATGG + Intergenic
1022686615 7:32603144-32603166 CAGCCCACATTTAAGGAGAAGGG + Intergenic
1023579309 7:41664299-41664321 CTACTCATATTGCAGCAGCAGGG - Intergenic
1024851323 7:53720545-53720567 CTTCTCCCATAGCAGCAGAACGG + Intergenic
1026734969 7:72943471-72943493 CTGCTCACGTTGAAGGCAAACGG - Exonic
1028631488 7:92939431-92939453 CTGGTGAAATGGAAGCAGAATGG + Intergenic
1031821116 7:126502868-126502890 CTGTTCCCATAGAAACAGAAAGG - Intronic
1032718898 7:134534679-134534701 CTGACCACATTGAAGCAGAGAGG + Intronic
1032931579 7:136678369-136678391 CTGCTCCAATAGAGGCAGAAGGG - Intergenic
1039016911 8:33159884-33159906 CTGATCAAATAGAAGCAGAGTGG - Intergenic
1041248511 8:55912043-55912065 CTGCTCAAATGGAAGGAGAGAGG + Intronic
1041348388 8:56924571-56924593 CTGCTCACCTTAAAGAAGGAAGG + Intergenic
1042369126 8:67970823-67970845 CTGCTAACATAGCAGCAGAAAGG + Intronic
1042748951 8:72137323-72137345 CTGGTCACCTAGAAACAGAATGG - Intergenic
1043925849 8:86036282-86036304 GTGATGAAATTGAAGCAGAAAGG + Intronic
1046239477 8:111471849-111471871 CTGCTCAGATTCAACAAGAAAGG + Intergenic
1047365596 8:124208452-124208474 CAGCCCACATTCAAGCAGAAGGG + Intergenic
1047958872 8:129996429-129996451 TGGCACACAGTGAAGCAGAATGG + Intronic
1047973746 8:130109302-130109324 CTGCTCACTTGTAAGCACAAGGG + Intronic
1053006389 9:34607661-34607683 GGGCTCACATTGTAGTAGAATGG - Intergenic
1055581518 9:77711363-77711385 GTGCTGACATAGAGGCAGAAAGG - Intergenic
1055647481 9:78374844-78374866 CTGCTCATATTGAGGAGGAAAGG - Intergenic
1056522230 9:87411887-87411909 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1056652354 9:88477050-88477072 CTGCCCACAGTGAAGCACGAGGG - Exonic
1057705964 9:97395368-97395390 CTGCTGAAATGGCAGCAGAATGG + Intergenic
1058161484 9:101574816-101574838 TTGTTCACATTGCAGCAGCAGGG - Intronic
1058367950 9:104232750-104232772 TTCCTCACATTGCAGCAGCAAGG + Intergenic
1058664702 9:107301032-107301054 CTGCTAACATTAAGTCAGAAAGG - Intronic
1060483683 9:124033472-124033494 CTGCTCTCAAGGAATCAGAATGG + Intergenic
1186543500 X:10425182-10425204 CAGCCCACACTGAAGAAGAAAGG - Intergenic
1187027755 X:15453966-15453988 CTGCTTTGGTTGAAGCAGAAGGG + Intronic
1188297828 X:28471499-28471521 ATCCTCACATGGAAGAAGAATGG + Intergenic
1190414784 X:50170215-50170237 CAGCCCACACTCAAGCAGAAGGG - Intergenic
1193190349 X:78563492-78563514 CTCCTCACAGTGCAGCACAAAGG - Intergenic
1194594122 X:95836656-95836678 CTGGTCACATTTATGCAGAGCGG + Intergenic
1194962016 X:100246869-100246891 GCTCTCACATGGAAGCAGAAGGG + Intergenic
1196072852 X:111544805-111544827 CTGCTCAGAGTGAAGGAGAAGGG - Intergenic
1196165322 X:112531525-112531547 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1197932866 X:131713001-131713023 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1199773588 X:150991267-150991289 CTGCTCTGGTTGAAGCAGTAAGG - Intergenic
1200166774 X:154041245-154041267 CATCACACGTTGAAGCAGAAAGG + Intronic
1200561129 Y:4705002-4705024 ATGCTCACATAGAAACAAAATGG - Intergenic
1200943963 Y:8813336-8813358 CTGTGAACATTGAGGCAGAAAGG + Intergenic