ID: 1172925069

View in Genome Browser
Species Human (GRCh38)
Location 20:38526483-38526505
Sequence CTGATGTGTTTGAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172925069_1172925073 22 Left 1172925069 20:38526483-38526505 CCTTTTTTTCTCAAACACATCAG 0: 1
1: 0
2: 3
3: 40
4: 432
Right 1172925073 20:38526528-38526550 ACTTTATATCCCTCCTGCTGGGG 0: 1
1: 0
2: 3
3: 26
4: 156
1172925069_1172925071 20 Left 1172925069 20:38526483-38526505 CCTTTTTTTCTCAAACACATCAG 0: 1
1: 0
2: 3
3: 40
4: 432
Right 1172925071 20:38526526-38526548 TTACTTTATATCCCTCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 158
1172925069_1172925072 21 Left 1172925069 20:38526483-38526505 CCTTTTTTTCTCAAACACATCAG 0: 1
1: 0
2: 3
3: 40
4: 432
Right 1172925072 20:38526527-38526549 TACTTTATATCCCTCCTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172925069 Original CRISPR CTGATGTGTTTGAGAAAAAA AGG (reversed) Intronic
905043878 1:34981203-34981225 CTAATATGTCAGAGAAAAAAAGG + Intergenic
905177058 1:36143397-36143419 CTGGTGTGTTTGAGAAACAGCGG + Intronic
907511577 1:54965292-54965314 GTGGTGTGTTTAAGAAAAAAGGG + Intergenic
909763391 1:79323112-79323134 TTGATGAGTATGAGAGAAAAGGG - Intergenic
910049696 1:82959755-82959777 CTGATGTGAAGGAGAAAAACTGG - Intergenic
910647142 1:89525572-89525594 TTGATTTGTTTGAGAAAGAAAGG + Intronic
911755403 1:101548403-101548425 CTGAAGAGTTTGTGAAAAGAAGG + Intergenic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
912311500 1:108625912-108625934 CTAATGTGTTTAGGAATAAATGG - Intronic
912589511 1:110802169-110802191 CTCACGTATTTGTGAAAAAACGG - Intergenic
913942524 1:125121116-125121138 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
914398983 1:147298358-147298380 GCGAGGTCTTTGAGAAAAAAGGG + Intergenic
916560958 1:165933866-165933888 AAGATGTGCTTGAGAGAAAAGGG - Intergenic
916691814 1:167197241-167197263 CTGAGGTTTTTGAAAACAAAGGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917513275 1:175685825-175685847 ATGGTTTGTTTGAGTAAAAAAGG - Intronic
917648248 1:177049583-177049605 CACATGTTTTTGAGAGAAAAAGG + Intronic
919109860 1:193205206-193205228 CTGATGAGTTTAAAAAAAAAGGG - Intronic
919394902 1:197033865-197033887 CTGAGGTATTTGAGAGAATAAGG + Intergenic
919394915 1:197034222-197034244 CTGATTCCTTTGAGAAAAAATGG - Intergenic
919797241 1:201328328-201328350 CTCCTGTGTTTGAGAAACAATGG + Intronic
920746142 1:208630678-208630700 CTGATGTGGATGAGAAGACAGGG - Intergenic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
921408249 1:214805721-214805743 TTGTTGTGTCTGAGAAAATAGGG - Intergenic
922012600 1:221606243-221606265 TTGTTGTGTTTCAGAAAATAGGG - Intergenic
922935132 1:229416799-229416821 CTGATGTGAAGGAGAAAAACTGG - Intergenic
923213875 1:231831488-231831510 CTGATGTGAAGGAGAAAAACTGG + Intronic
924212105 1:241780551-241780573 TTGATGTGTTAAAGAAAAATAGG - Intronic
924334093 1:242969464-242969486 CTGCTGTGTTTTCAAAAAAAGGG + Intergenic
924377325 1:243426230-243426252 CTCATGTGTTAGACAGAAAAAGG - Intronic
924850079 1:247819415-247819437 GAGATGTGTTACAGAAAAAATGG + Intergenic
924895872 1:248337519-248337541 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1063223260 10:3990957-3990979 CTGATGTGTTGGTGAAAACTGGG - Intergenic
1063264554 10:4433623-4433645 CTGTTGTGTCTCAGAAAATAGGG + Intergenic
1063299142 10:4836198-4836220 CTGAAATGCTTGAGAGAAAAAGG - Intronic
1064268247 10:13842302-13842324 CTCATTTATTTGAGACAAAAGGG - Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1065298357 10:24298401-24298423 CTGATGGGTTTGAGAATTACTGG + Intronic
1065678444 10:28204106-28204128 CTCATGTGTTTAAAAACAAATGG + Intronic
1066487051 10:35856207-35856229 TTGATGTATTGGGGAAAAAAGGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067723367 10:48747389-48747411 CTGATGTCTTTTATAAAATATGG + Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068782605 10:60937722-60937744 CTGTTGTGTTCAAGAAAAAAAGG + Intronic
1069782168 10:70963688-70963710 TGGATGTGTTTGTGACAAAATGG + Intergenic
1069855365 10:71437803-71437825 CTGATGTGTTTCAGCCAAGAGGG - Intronic
1070120004 10:73566815-73566837 GAGATCTGATTGAGAAAAAAGGG + Intronic
1070203447 10:74231371-74231393 CTGATGTGTTCTAGAGAAAAGGG - Intronic
1071151104 10:82635563-82635585 CTTTTGTCTATGAGAAAAAATGG - Intronic
1072108606 10:92296914-92296936 GTGATGTGATTGAGAAAAAGAGG - Intronic
1072614281 10:97039084-97039106 TTGATGTGCTTGTGAAGAAAAGG + Intronic
1072731868 10:97851662-97851684 CTGCTGTGTTGGACAGAAAAGGG + Intronic
1073894141 10:108134736-108134758 CTGAAGTGTGTGAGAGAAGAGGG + Intergenic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074172697 10:110958898-110958920 CTGATGTACTTGAGAACAATTGG - Intronic
1074848554 10:117420430-117420452 CTGATGGTTTTCAGAAAAATGGG + Intergenic
1075214278 10:120518318-120518340 GTGATTTGTTTGATAACAAATGG + Intronic
1075733573 10:124650829-124650851 GAGATGTGTTTGAAAAGAAAGGG + Intronic
1076537920 10:131194744-131194766 CTGATGCTGTTGAGAAAACAGGG - Intronic
1078299443 11:10112127-10112149 CAGATGTGTTTTAGAAATCAGGG - Intronic
1078473300 11:11609321-11609343 CTGAAGTGTTTGAGAAACAGTGG - Intronic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1081204153 11:40255344-40255366 CTGACATGTTTGAGAAACACTGG + Intronic
1081366605 11:42242907-42242929 CTGATGTGTCTGAGAACAGAGGG + Intergenic
1082014471 11:47474269-47474291 CTGATGTGTTTGAAAAAAACAGG - Intronic
1082734091 11:56837468-56837490 CTGAGGTGGTTGAAGAAAAAGGG - Intergenic
1084354561 11:68629006-68629028 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1084718239 11:70887620-70887642 CTTCTGTGTTTGGGAAACAAAGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1085567811 11:77530663-77530685 GTGATGTGTTGTAGAAGAAAGGG - Intronic
1085988348 11:81810843-81810865 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1087911228 11:103755858-103755880 CTTATATGTGAGAGAAAAAAAGG + Intergenic
1088473076 11:110207618-110207640 CTGATTTGTTTAAAAAAAAAAGG - Intronic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1089568306 11:119384721-119384743 CGGATGAGTTTAAGAAAGAATGG + Intergenic
1089701579 11:120247692-120247714 CTCAGGTTTTTGAGATAAAAGGG - Intronic
1089953688 11:122551755-122551777 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1090651251 11:128808191-128808213 ATGATGTGGATGAGAAAAGATGG + Intronic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1091145436 11:133275196-133275218 CATATTTTTTTGAGAAAAAAAGG - Intronic
1092809601 12:12260413-12260435 CTGTTTTGTTTGATATAAAACGG - Intronic
1094342014 12:29423204-29423226 CTGATGAGTCTGAGAGAAAGAGG - Intronic
1095155269 12:38845285-38845307 CTGGTGTGTTAGAGAACAAAAGG - Intronic
1096210646 12:49763112-49763134 CAGATGGGGTTGACAAAAAAGGG - Exonic
1096213353 12:49783833-49783855 CTGATGTGTCTGGCAAAAAGAGG - Intergenic
1096395912 12:51266765-51266787 CTGAATTGTCTGCGAAAAAATGG + Intronic
1097242920 12:57588542-57588564 CTGTTGTGTTTGAAAGAAGAGGG - Intergenic
1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG + Intronic
1097541849 12:60953056-60953078 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1097723076 12:63044835-63044857 CTGATGGGTTTCTGATAAAAGGG + Intergenic
1097808172 12:63988403-63988425 CTGATGGTGTTAAGAAAAAAGGG + Intronic
1097871914 12:64609610-64609632 CTGAAGAGTTTTAGAAAACATGG + Intergenic
1097994180 12:65869574-65869596 CTTATGTATTTAAGAAAGAATGG + Intronic
1098694508 12:73536161-73536183 GTGGTGTGTGTGAGAAGAAATGG - Intergenic
1099772708 12:87082766-87082788 CAGATATGCTTGAGAAATAAAGG - Intergenic
1100977573 12:100138303-100138325 CTGATCTATTTAAGTAAAAAGGG - Intronic
1102270412 12:111529972-111529994 CTGATTTAGTTGAGAAGAAATGG - Intronic
1103048132 12:117755601-117755623 TTGTTGTGTTTCAGAAAATAGGG - Intronic
1103355152 12:120314378-120314400 TTGATTAGTTTGAGAAAAAACGG - Intergenic
1104225399 12:126827800-126827822 GTGATGTGTTGTAGGAAAAAAGG + Intergenic
1104537319 12:129630231-129630253 CGTGTGTGTTTGAGAAAAACAGG + Intronic
1105190315 13:17891095-17891117 TTGATGTCTTTGGGGAAAAAGGG + Intergenic
1107140980 13:36998781-36998803 CTGATGTGGTTAAGCAAATAGGG - Intronic
1107212917 13:37879226-37879248 CTGATGTGTCTGAAGAACAAAGG - Intergenic
1107335194 13:39347224-39347246 CTGATGTGCTCCAGAAAAAGTGG - Intronic
1107817364 13:44256134-44256156 CTGATGGATATGAGACAAAATGG - Intergenic
1108267287 13:48724844-48724866 GTGATGGCTTTGTGAAAAAATGG + Intergenic
1108699528 13:52932108-52932130 CTGGTTTGTTTTAGAAAAACAGG - Intergenic
1108775617 13:53761701-53761723 CTGATGTGTTTGTGTGAAGATGG + Intergenic
1108782761 13:53856829-53856851 CTATTGTATTTCAGAAAAAAAGG - Intergenic
1108868840 13:54957391-54957413 CAGAAGAGTTTGAGAAAAAGTGG + Intergenic
1109430579 13:62229159-62229181 ATGATGTGTTTGACAAAGAGAGG + Intergenic
1109777621 13:67062825-67062847 CTAATATGTTTCAGAAAAATAGG + Intronic
1109871714 13:68341899-68341921 CTGATGGTTTTAAAAAAAAATGG - Intergenic
1110132824 13:72028268-72028290 CTGATGGGTTTAGGAGAAAAAGG - Intergenic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1110243388 13:73293705-73293727 ATGATGTGATTGGGAAAAAATGG - Intergenic
1110538787 13:76684203-76684225 CTGATGTTTTTAATAAAAATAGG - Intergenic
1110795659 13:79634539-79634561 ATGAAGTGATTAAGAAAAAAAGG + Intergenic
1111027126 13:82542725-82542747 CTAATGTGTTTTAGACACAAGGG - Intergenic
1112297559 13:98201612-98201634 CTCAGGTGTTTGAGTAGAAAAGG + Intronic
1112699353 13:101987495-101987517 TTGCTATGTTTTAGAAAAAAGGG - Intronic
1112748576 13:102555407-102555429 GTGAGGTCTTTGAGAATAAAGGG + Intergenic
1113187340 13:107703690-107703712 CAGATGCGTTTGAAAATAAATGG - Intronic
1113334014 13:109360823-109360845 CTGTTGATTTTGGGAAAAAAGGG + Intergenic
1113339338 13:109406717-109406739 CTAATGTGTTTGTGGAAAGAGGG - Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1114177811 14:20339185-20339207 CTGGTATGTTTGAGACAAAGTGG + Intergenic
1114882730 14:26806814-26806836 CTGATGTTGTTGACAAGAAAGGG - Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115334751 14:32233950-32233972 CTGATTGGTTTGAAAAATAATGG - Intergenic
1115483235 14:33883263-33883285 CTGAGGTGTTTAAAAATAAAGGG + Intergenic
1116744681 14:48802326-48802348 CGGAAGTGTTTGAGAAAGATTGG + Intergenic
1117356529 14:54929025-54929047 CTGATTTGTTTCAGATAACAAGG - Intergenic
1119987338 14:79152829-79152851 TTTATGTGTTTGTGAAGAAAAGG + Intronic
1120539255 14:85734255-85734277 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1123883588 15:24699538-24699560 TTGATGTGTTTGAAAAGAACTGG + Intergenic
1124137601 15:27048556-27048578 CTTAGGTGTCTGAGAAAAACAGG + Intronic
1124997316 15:34736335-34736357 TTAATTTGTTTAAGAAAAAAGGG - Intergenic
1125632898 15:41162455-41162477 ATGAAGGGTTTGGGAAAAAAAGG + Intergenic
1126409591 15:48358591-48358613 CTGCTGTGTTTAAACAAAAATGG + Intergenic
1128259682 15:66224248-66224270 CTGATGTGTGTGTGGATAAAAGG + Intronic
1128554262 15:68620230-68620252 TTAATGTGTTTTAGGAAAAAAGG + Intronic
1128928897 15:71685818-71685840 CTCATGAGTAAGAGAAAAAAAGG + Intronic
1129159812 15:73740943-73740965 CTGCTGTGTTTGAGAGACAGGGG - Intronic
1131859337 15:96636008-96636030 CTGATGATTTTGAGATAAACTGG + Intergenic
1132322981 15:100940629-100940651 CTGATGTCTTGGAGAGAAACAGG - Intronic
1134845047 16:17433107-17433129 CAGCTGTGTTAGAAAAAAAAAGG + Intronic
1134862271 16:17571102-17571124 ATGATGTCTTTGAGAAGAGAAGG - Intergenic
1136109333 16:28054815-28054837 CAGATGTCTTTAAAAAAAAATGG + Intronic
1136696025 16:32082960-32082982 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1136796519 16:33026214-33026236 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1137837671 16:51608667-51608689 CTTATCTGTTTGAATAAAAAGGG + Intergenic
1138838503 16:60468593-60468615 GTCATGTGATTGAGAAGAAAAGG + Intergenic
1140788548 16:78367411-78367433 CTGATGAGTTGAAAAAAAAATGG - Intronic
1144489517 17:15696604-15696626 CTGATCTCTTTGAGAAATACAGG - Intergenic
1144911451 17:18685353-18685375 CTGATCTCTTTGAGAAATACAGG + Intergenic
1146118440 17:30165314-30165336 CAGATGTGTATGTGTAAAAATGG + Intronic
1147021327 17:37536206-37536228 CTGATATCTGTGAGAAACAATGG + Intronic
1147216543 17:38902554-38902576 CTGAAGTGTTTTGGAAAATAGGG + Intronic
1147710363 17:42459066-42459088 CTGACGTCTTCGAGATAAAATGG + Intronic
1149669822 17:58397224-58397246 TTGCTGTGTTTCATAAAAAATGG - Intronic
1149928960 17:60730727-60730749 GTGACTTGTTAGAGAAAAAAAGG + Intronic
1150926587 17:69538923-69538945 CCGATGTGTTAAAAAAAAAATGG + Intronic
1151410331 17:73921644-73921666 CTTATGTGATTCAGAAGAAATGG + Intergenic
1153122568 18:1747454-1747476 CTGAAGTGTTTAAAAAGAAAAGG + Intergenic
1153315170 18:3714334-3714356 TGGCTGTGTTTGAGAAACAATGG - Intronic
1153676404 18:7459757-7459779 CTGATGTGCTCAAGAAAAGATGG - Intergenic
1155084922 18:22448739-22448761 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
1155580659 18:27301980-27302002 CTTATTTGTGTGAGAGAAAAAGG + Intergenic
1156711608 18:39953573-39953595 CTGTTGTGTTTCAAAAAATAGGG + Intergenic
1156941492 18:42772445-42772467 TTTATGTGCTTGAGAACAAAAGG - Intronic
1157627312 18:49061403-49061425 CCGGTGTGTTTGAGAATAAGAGG + Intronic
1159492438 18:69154727-69154749 TTGATGTATTTCAGAAAAAGAGG + Intergenic
1159526961 18:69604599-69604621 TTAAAGTGTTTGAGAAATAAAGG + Intronic
1160190348 18:76709801-76709823 CTCACGTGATTGAGAATAAACGG + Intergenic
1162569115 19:11460579-11460601 CTGGTGTGTTTGGGAAAAATGGG - Intronic
1165500690 19:36186883-36186905 CTAAGGTGTTTGAAAATAAAAGG + Intronic
1165608650 19:37131155-37131177 CTGAAGTGTTTTAGGAAAAGTGG + Intronic
1166611486 19:44203049-44203071 CTGAGGAGTTTGGGAAAAATTGG + Intergenic
1167825515 19:51969518-51969540 CTGAGGTGTCTGATATAAAATGG + Intronic
1168466785 19:56608834-56608856 TTCATGTGGTTGAGATAAAATGG + Intronic
1202646875 1_KI270706v1_random:150436-150458 CAGAAGAGTTTGAGAAGAAATGG - Intergenic
926014758 2:9440634-9440656 CTAATGTGTTTGAAAACAAAGGG - Exonic
926254688 2:11181108-11181130 CTGAAATATTTGAGTAAAAAAGG - Exonic
926512741 2:13802801-13802823 CTGATGTCTTTATGAAAAGATGG + Intergenic
926631958 2:15144611-15144633 GTGATGTGTTCGATAAAAAGTGG - Intergenic
926711152 2:15882113-15882135 ATGATGTGTTTTAGAACAAGAGG + Intergenic
926972506 2:18480957-18480979 CTGAGGAATTTGAGAAAAGAGGG + Intergenic
927301305 2:21518963-21518985 CTGATTTACTTGAGAAATAAAGG - Intergenic
927330629 2:21859323-21859345 TTGATGTGTAGGAGAAAATAAGG + Intergenic
928796290 2:35024871-35024893 CTTATGTGTGTTGGAAAAAAAGG + Intergenic
928943244 2:36749259-36749281 GTGATGGGTTGGAGAAAAATGGG + Intronic
929305618 2:40357959-40357981 CTGATGTGTTTGTATAAAAAGGG + Intronic
929427698 2:41860837-41860859 ATCAATTGTTTGAGAAAAAAAGG - Intergenic
929457790 2:42078226-42078248 GGGATGTGATGGAGAAAAAAAGG + Intergenic
930053468 2:47234719-47234741 CTGACCTCATTGAGAAAAAAAGG - Intergenic
930369598 2:50486524-50486546 CTGTTGTGTTAGAGAAAGAATGG + Intronic
931258054 2:60591377-60591399 CTGAAGAGTTTGAGTAAAATTGG - Intergenic
931263851 2:60643153-60643175 ATGTTGTGTTTGACCAAAAATGG - Intergenic
931499853 2:62854540-62854562 TTGTTGTGTCTGAGAAAATAAGG + Intronic
932643074 2:73470514-73470536 CTATTGTGCTTGGGAAAAAAAGG + Intronic
933361895 2:81297448-81297470 CTGATAAGTTTGGGTAAAAATGG - Intergenic
933750668 2:85600595-85600617 CTCATGTGTGTGAGAGAGAAGGG + Intronic
933764977 2:85701063-85701085 CTGAAATGATTCAGAAAAAAAGG + Intergenic
933982777 2:87566905-87566927 CTGGTGTTTTGGGGAAAAAATGG - Intergenic
934095493 2:88598842-88598864 CTGATGTATTTAAGAGTAAAGGG + Intronic
934162718 2:89267747-89267769 CTGATTTCATTGAGAAGAAATGG - Intergenic
934204557 2:89914777-89914799 CTGATTTCATTGAGAAGAAATGG + Intergenic
936418416 2:112341250-112341272 CTGATGTGTGTGACAAAAGCTGG + Intergenic
937866386 2:126754408-126754430 CTGATGTGTTTGGCAAACAAGGG - Intergenic
938548367 2:132355681-132355703 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
939510247 2:143095973-143095995 CTCATGTGTTGGAGAATAAGAGG + Intronic
940562121 2:155312182-155312204 CTCATGTGTTGGAGAATAAGAGG - Intergenic
940912186 2:159218552-159218574 GTGATGTGTTGGGGAAAAATGGG + Intronic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
940993559 2:160122383-160122405 CTAATGTGTTGAGGAAAAAAAGG - Intronic
940997367 2:160164269-160164291 ATGATATGTTTGAGAAATGAAGG + Intronic
941558722 2:167017423-167017445 CTGATGAGTGTGAGGAGAAAGGG - Intronic
941695607 2:168548062-168548084 TTTATGTGTGTGCGAAAAAAGGG + Intronic
942464544 2:176194124-176194146 CTGATGTATTTTGGAAAGAAGGG + Intergenic
942911825 2:181253011-181253033 CAGATCTGTCTGAGCAAAAAGGG + Intergenic
942959379 2:181811744-181811766 AAGATGTTTTTGAGAATAAAAGG + Intergenic
943284124 2:185975400-185975422 ATGATGTGTAAGAGAAAACAAGG - Intergenic
943319270 2:186427467-186427489 ATGGTGGGTATGAGAAAAAAAGG + Intergenic
943506508 2:188767091-188767113 CTGATGAGTAAGAGAGAAAAGGG - Intronic
943642721 2:190376651-190376673 CTGAAGTGTTTTGGAAATAATGG - Intergenic
944199862 2:197095061-197095083 CTGATTAGTTGGAGAAATAATGG - Intronic
944627643 2:201588634-201588656 CTGATGTGCTTCAAAAACAATGG + Intronic
945227531 2:207547488-207547510 CTCATTTTTTTAAGAAAAAAAGG - Intronic
945578908 2:211567879-211567901 CTGATGAGTGGGATAAAAAAGGG + Intronic
945760338 2:213905922-213905944 TTGGTGTGTTTGAGAAACACAGG + Intronic
946165436 2:217860757-217860779 TTGATGTGTATTGGAAAAAAAGG - Intronic
946975824 2:225148977-225148999 CTGCTGAGTTTGAGAACAAGAGG - Intergenic
948703471 2:239775210-239775232 CTGATGTGGGTGAGAAAAGAAGG + Intronic
1169305545 20:4487244-4487266 GAGATGCTTTTGAGAAAAAAGGG - Intergenic
1169311447 20:4544818-4544840 CGGAAGAGTTTGAGAAAAAATGG + Intergenic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1170362030 20:15556873-15556895 TTGATGTGTGTTAGGAAAAAGGG + Intronic
1170548056 20:17451882-17451904 CTGATGTGTTTCACAATAAATGG - Intronic
1171877237 20:30588457-30588479 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1173619356 20:44424815-44424837 GTGTTGTGTTTGAGAAAGAAGGG + Intronic
1174188991 20:48726662-48726684 CTGAGTTGTTGGGGAAAAAAAGG + Intronic
1174939437 20:54908582-54908604 CTGATGAGGATGAGAAGAAATGG + Intergenic
1175438033 20:58968329-58968351 CTGAAGTGAAAGAGAAAAAAGGG + Intergenic
1175474357 20:59260121-59260143 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175474550 20:59262155-59262177 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175751373 20:61500186-61500208 CTGTTGTGTTTGTCAAATAATGG + Intronic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1176604992 21:8822338-8822360 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
1176908781 21:14537181-14537203 CTGGTGTGTTTGAGAAGCAGTGG - Intronic
1177119891 21:17125920-17125942 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1177776433 21:25572284-25572306 AGGTTGTGTTTGAGAACAAAAGG + Intergenic
1177858821 21:26428919-26428941 CTAAGGTTTTTGAGAAACAAAGG + Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178940415 21:36900803-36900825 CTGAGATGTTAGAGAAAACAGGG + Intronic
1180347283 22:11713943-11713965 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
1180355035 22:11832030-11832052 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
1180383215 22:12160301-12160323 CAGAAGAGTTTGAGAAGAAATGG - Intergenic
1182800335 22:33026838-33026860 CTGATGTTGTTGAGAAAACGTGG + Intronic
1182883901 22:33756984-33757006 CTGAGATGTTAGAGAAAGAAAGG + Intronic
1203324737 22_KI270738v1_random:3372-3394 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
949378624 3:3419084-3419106 CTGGTGAGTATGAGAAGAAAAGG + Intergenic
949818222 3:8085309-8085331 ATGAAGTGTTGGAGAAATAAGGG + Intergenic
950632424 3:14291620-14291642 CTGTTGTGTTTCAGGAAATAGGG - Intergenic
950921710 3:16701378-16701400 CTTATATGTTTGTGAAATAAAGG - Intergenic
951137087 3:19117333-19117355 CTGCTAGGTTTGAGAAAAACAGG - Intergenic
953292689 3:41682205-41682227 TTGATGTATTTGATAAAACATGG - Intronic
955039179 3:55298246-55298268 CTTTTGTGTCTGGGAAAAAAGGG + Intergenic
956520351 3:70096886-70096908 CTGGTGAGTTTGAGAAACACTGG + Intergenic
956554471 3:70503302-70503324 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
957172264 3:76752691-76752713 CTGAAGTGTTTGAGGAAAACTGG + Intronic
958898425 3:99856658-99856680 GTGATGTTTTTGAAAAAATAAGG - Intronic
959140127 3:102475816-102475838 TTCATGTGTCTGAAAAAAAATGG + Intronic
960382717 3:116984272-116984294 CTGTTGTGTCTCAGAAAATAGGG - Intronic
961171415 3:124800396-124800418 CTGATGTGTCTGGGAGAAAGTGG + Intronic
962165310 3:133041294-133041316 GTAATGTGCTTGAGAAAAGAAGG + Intronic
962507778 3:136065641-136065663 CTAATTTGATTAAGAAAAAAGGG + Intronic
963685813 3:148432339-148432361 GTGATGTCTTTGAGAAGAAAAGG + Intergenic
964125145 3:153227964-153227986 CTGATGTGAAGGAGAAAAACTGG + Intergenic
964299913 3:155276252-155276274 CTGATGTGAAGGAGAAAAACTGG + Intergenic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
965078286 3:164004753-164004775 CTGATTTATCTGAGAAAAGAAGG + Intergenic
965888279 3:173476877-173476899 ATTATGTGTTGGAGAAAGAAGGG + Intronic
966682429 3:182656960-182656982 CAGATTTGTGTGGGAAAAAATGG + Intergenic
967117433 3:186354643-186354665 ATGATGTGTAAGAGAAAAGAAGG - Intronic
968558024 4:1259527-1259549 CTGAAGCGTTTGAGAAGAATCGG + Intergenic
969488027 4:7483013-7483035 CTGATGTCCTTATGAAAAAAAGG + Intronic
970769068 4:19588324-19588346 CTGATTTGCTTGAGAAAGCAAGG + Intergenic
970853749 4:20631580-20631602 CTGATGTGAAGGAGAAAAACTGG + Intergenic
971120815 4:23702881-23702903 ATGGTGGGTTGGAGAAAAAAGGG - Intergenic
971508437 4:27392923-27392945 CTGATTTGTATGACAAATAAAGG - Intergenic
972595251 4:40524259-40524281 CTCATTTGTATGAGAAAATAGGG - Intronic
972808088 4:42551276-42551298 CTCATCTGTTTTAGAAAAAGAGG + Exonic
973373130 4:49268600-49268622 CAGAAGAGTTTGAGAAGAAATGG - Intergenic
973387872 4:49526499-49526521 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
973929052 4:55771266-55771288 CTGATTAGTTTAAGAACAAAAGG + Intergenic
974173740 4:58298465-58298487 ATTATGCATTTGAGAAAAAATGG - Intergenic
975054398 4:69910919-69910941 TTCAAGAGTTTGAGAAAAAATGG + Intergenic
975069409 4:70114932-70114954 TTGAGGTGTGAGAGAAAAAACGG - Intergenic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
976212932 4:82690189-82690211 CTGAGGTATTTGGGAATAAAGGG + Intronic
976261765 4:83152168-83152190 CTGAAGTATTTAAGAGAAAAGGG + Intergenic
976497101 4:85742476-85742498 TTTAAGTGTTTGAGAAAAAAAGG + Intronic
979500604 4:121435493-121435515 CTGATGGCTTTGAAAAAAATGGG - Intergenic
980636484 4:135511101-135511123 CTGATGTGTTTGGGGAGGAATGG + Intergenic
980721490 4:136701939-136701961 GTGATCAGATTGAGAAAAAAAGG - Intergenic
982015400 4:151148485-151148507 ATGATGTGTTTAAGAGCAAATGG - Intronic
982186085 4:152801368-152801390 TTGGTGTGTTTGAGAAACAGTGG + Intronic
982196991 4:152926489-152926511 CTGATGTGATGAAAAAAAAAGGG + Intergenic
982361800 4:154526437-154526459 CTGATGTGTATAATTAAAAATGG + Intergenic
982396418 4:154920137-154920159 CTGATGTGAAGGAGAAAAACTGG + Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
982933147 4:161434929-161434951 CTGATGAGTATGGGAAGAAAAGG + Intronic
983461514 4:168029943-168029965 CTGTTGTGTATGTGTAAAAACGG + Intergenic
984322499 4:178211512-178211534 CTGATGTGAAGGAGAAAAACTGG - Intergenic
984339851 4:178443123-178443145 CTGATGTATTGGAGGAAAATAGG + Intergenic
984855759 4:184194740-184194762 CTGATGTCTGTGAGATACAATGG + Intronic
987227467 5:15858088-15858110 CTAATGTGAATAAGAAAAAAAGG - Intronic
987591736 5:19937394-19937416 CTGATGTGTGTGAGGCACAATGG + Intronic
989264698 5:39459260-39459282 AAGATGTGTTTGAGCAAGAAGGG - Intronic
990485950 5:56259369-56259391 CTCATTTGTTTGAGAAATATGGG + Intergenic
990687779 5:58326603-58326625 CTGATGTGTTTGGACAAAGATGG + Intergenic
991311389 5:65246766-65246788 CTGATGTATTCTAGAAACAATGG - Intronic
991696857 5:69281081-69281103 CTGCTGTGTATGAAAACAAATGG - Exonic
992135638 5:73741252-73741274 CTGCTGTGTTATAGAAACAAAGG + Intronic
993664667 5:90681175-90681197 CTAATTTGTTTTAGAAAGAAAGG - Intronic
994390829 5:99191522-99191544 TTGATGTGTATAAGAATAAAAGG - Intergenic
994712101 5:103278459-103278481 CTGTTTTGTTTAAGAAAAATAGG - Exonic
995207697 5:109501248-109501270 CTGAAGTGTGTGAGACAAGAGGG - Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
995997641 5:118320739-118320761 TTGAGGAGTTTGTGAAAAAAGGG + Intergenic
997213579 5:132092864-132092886 CTCAGGTGTTTGAGAAATATGGG - Intergenic
998247961 5:140526077-140526099 CAAATGTGTTTGGGAAAAAAAGG + Exonic
998732282 5:145093350-145093372 CTCATGAGTTTGAGACAAGATGG + Intergenic
1000217043 5:159169579-159169601 CTGATGAATTTTAGAAGAAATGG - Intronic
1000607243 5:163338277-163338299 CTGATGAGTAGGAGAAAAACTGG - Intergenic
1000695679 5:164378803-164378825 CTGATGAGACTGTGAAAAAAGGG - Intergenic
1000861122 5:166457363-166457385 CTCAGATCTTTGAGAAAAAAGGG - Intergenic
1002189379 5:177470797-177470819 CTGATGTGGTTGAGAAGCACTGG - Intronic
1003348708 6:5295401-5295423 CTTAGGTGTTTGAGTCAAAAGGG + Intronic
1003427518 6:6007487-6007509 CTGCTGGGTTGGAGAAAAAGAGG - Intronic
1003570941 6:7256165-7256187 CTGATATGAGCGAGAAAAAATGG - Intergenic
1003774243 6:9341441-9341463 TTGCTGTCTGTGAGAAAAAAAGG + Intergenic
1005162349 6:22878520-22878542 TTGATGTGTTTAATAACAAAGGG + Intergenic
1007518162 6:42429819-42429841 CTGAAGTGTTTTGGAAGAAAAGG + Intronic
1008113758 6:47522098-47522120 CTGATGAGTTTCATATAAAAGGG + Intronic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008233651 6:49016357-49016379 CTGGTGTTTTTATGAAAAAATGG + Intergenic
1008466960 6:51842139-51842161 CTGATCTGACTGAGAAAAAAAGG - Intronic
1008694558 6:54019435-54019457 CTGGTATCTCTGAGAAAAAATGG - Intronic
1008729797 6:54467693-54467715 CTGATGAGGTTGGGAAGAAAAGG + Intergenic
1010085159 6:71908601-71908623 CTGAGGTGTTACAGACAAAACGG + Intronic
1010287331 6:74094330-74094352 CTTATGTGCCTGATAAAAAATGG - Intergenic
1010696851 6:78985899-78985921 CTCATTTATTTGTGAAAAAAAGG - Intronic
1010995365 6:82525681-82525703 CTGCTTTGTTTGGGAGAAAATGG + Intergenic
1011729935 6:90251210-90251232 CTGAGGTTTTTAGGAAAAAATGG - Intronic
1011942327 6:92857658-92857680 CTGAGGTTTAGGAGAAAAAATGG - Intergenic
1012580631 6:100865743-100865765 ATGATGTTTTTCAAAAAAAAGGG + Intronic
1012767033 6:103380551-103380573 TTTGTGTGTTTAAGAAAAAATGG + Intergenic
1013139566 6:107318637-107318659 CTCATGTTTTTAAGAAATAATGG - Intronic
1014519229 6:122419411-122419433 CTGATGTTTGTGAGAGATAAGGG + Intronic
1014985961 6:128009944-128009966 CAGATGGTTTTGAGAAAGAAAGG - Intronic
1015029219 6:128574188-128574210 CTGCTGAGTTTAAGAAGAAAAGG - Intergenic
1015069524 6:129074594-129074616 TTGTTGTCTTTGAGAGAAAATGG + Intronic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1015552216 6:134423568-134423590 CTGATGAGTTTAAGAAAAGTTGG + Intergenic
1016249607 6:142024717-142024739 CTGTTTGTTTTGAGAAAAAATGG - Intergenic
1016322100 6:142857639-142857661 CTGAAGTTTTGGAGAAAAACAGG - Intronic
1016831931 6:148442584-148442606 CTGGCCTGTTTGAGAATAAATGG + Intronic
1017266996 6:152458757-152458779 CTGATGTTTTTGTTTAAAAAGGG + Exonic
1017896796 6:158686944-158686966 CTGATGTGTTCCGGAAAAAGTGG + Intronic
1018081137 6:160260153-160260175 CTGATGTGTGAGAGCAGAAAGGG - Intronic
1018952166 6:168386286-168386308 CTGAAGTGTGTGAGAGAACATGG + Intergenic
1019141186 6:169944738-169944760 ATACTGTGTCTGAGAAAAAAAGG - Intergenic
1020540783 7:9459558-9459580 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1020556849 7:9681068-9681090 CTGAATTGTCTAAGAAAAAAAGG + Intergenic
1020691800 7:11364496-11364518 CTCATTTGTTTGAGAGAAGATGG + Intergenic
1020883698 7:13796036-13796058 CTGATTAATTTCAGAAAAAAAGG - Intergenic
1021081045 7:16365354-16365376 CAGCTGTGTTTGTGAAATAATGG + Intronic
1021126588 7:16857821-16857843 TTGATGAGTCAGAGAAAAAAAGG - Intergenic
1022488419 7:30798338-30798360 GTGCTGTGTTAGAGAAAGAAAGG + Intronic
1023159985 7:37287829-37287851 TTGGTGTGTTAGAGAACAAAAGG - Intronic
1023708858 7:42970525-42970547 ATGATCTGTTTAAGAACAAAAGG - Intergenic
1024391024 7:48812670-48812692 CTGATATTTATTAGAAAAAATGG + Intergenic
1024834929 7:53505597-53505619 CTCCTGTGTTGGAGAATAAAAGG + Intergenic
1025320628 7:58089581-58089603 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
1026851706 7:73728068-73728090 ATGATGTGTTTGAGAAAACTAGG - Intergenic
1027336598 7:77157528-77157550 CTGATGTGTATTACAAAACAAGG + Intronic
1027387589 7:77673819-77673841 AGGATGTTTTTAAGAAAAAACGG + Intergenic
1027415759 7:77972844-77972866 CTGATGTGTCAGATAATAAAAGG - Intergenic
1027501428 7:78956745-78956767 CTGATGTATTACATAAAAAACGG - Intronic
1028170009 7:87584817-87584839 GTGATATCCTTGAGAAAAAATGG - Intronic
1031026527 7:116685841-116685863 CTGAGGCATGTGAGAAAAAAAGG - Intronic
1031354891 7:120778423-120778445 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1032023148 7:128421312-128421334 CTGCTGTGTTTTAGAACAGAGGG + Intergenic
1032297614 7:130655478-130655500 CTGATCTGTGTGTGTAAAAAAGG - Intronic
1032554717 7:132819908-132819930 CTGAAGTGCATGAGAAAAGATGG + Intronic
1033594618 7:142849173-142849195 AAGATGTGATTGAGAAAAAGTGG - Intergenic
1033741646 7:144280598-144280620 CTCATGTTTGTGAGAAGAAAGGG - Intergenic
1033752255 7:144369016-144369038 CTCATGTTTGTGAGAAGAAAGGG + Intronic
1033957362 7:146867653-146867675 CTGATGAGGTTGTGAAGAAAAGG - Intronic
1034310864 7:150086526-150086548 TTAATGTGTTTGAGAAAGCAGGG - Intergenic
1034546299 7:151791604-151791626 CACATGTGTTGGAGATAAAAAGG + Intronic
1034795982 7:154014108-154014130 TTAATGTGTTTGAGAAAGCAGGG + Intronic
1035647830 8:1242231-1242253 CTGATGTGTTTGTGGAAGAGGGG + Intergenic
1037397309 8:18456672-18456694 CTCATGTGTTTGAAAATATATGG + Intergenic
1039153967 8:34534708-34534730 GTGATGTGTTTCATAAAAGAGGG - Intergenic
1039880677 8:41623658-41623680 CTGATGTTTTAGAGAAGCAATGG - Exonic
1040899102 8:52399773-52399795 CTGTTGTGGTTGGAAAAAAATGG + Intronic
1041308948 8:56494560-56494582 CTGAATTGTTTTAAAAAAAATGG + Intergenic
1041498934 8:58518644-58518666 CTTTTGTGTTTGATTAAAAATGG + Intergenic
1042248670 8:66733852-66733874 CTGATTTATTTGAAAACAAAGGG + Intronic
1042749777 8:72145637-72145659 CTTATTTATTTGAGAAAAACAGG - Intergenic
1042828382 8:73001029-73001051 CTGATGTGTGAAATAAAAAAAGG + Intergenic
1043192188 8:77239472-77239494 CTGATGAGTTTGGAAAAAAATGG + Intergenic
1043848417 8:85188358-85188380 CAGAAGTGTTTTACAAAAAATGG - Intronic
1044212303 8:89563893-89563915 CTAATGAGTTTGAAAAGAAAGGG + Intergenic
1044478889 8:92661558-92661580 CCAATGTGTCTGACAAAAAATGG + Intergenic
1045039528 8:98208856-98208878 CTTGTGTGATTGATAAAAAATGG - Intronic
1045135264 8:99210333-99210355 GAGATGTGTTTGAGAATATAGGG - Intronic
1048163240 8:132039705-132039727 CTGTTGTGGTTGAGAAATAAGGG - Intronic
1048400980 8:134070379-134070401 CTAATTTGTTTCAGAAAAAATGG - Intergenic
1050259257 9:3823928-3823950 CTGAAGGGTTTGGGAAAACAGGG + Intergenic
1050387841 9:5110030-5110052 CTCATGTGTTGGAGGAAAAGAGG - Intronic
1050876714 9:10648236-10648258 TTGATGTTTTTGAGAATAAAAGG + Intergenic
1050879964 9:10687313-10687335 CTGAACTCTCTGAGAAAAAATGG - Intergenic
1051140635 9:13975502-13975524 CTTACTTCTTTGAGAAAAAAAGG - Intergenic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1051543299 9:18245536-18245558 ATTATGGGGTTGAGAAAAAATGG + Intergenic
1052032984 9:23649349-23649371 ATGATGTGTTTAATAATAAACGG - Intergenic
1052684674 9:31740140-31740162 ATAATGTATATGAGAAAAAAGGG - Intergenic
1053752526 9:41271023-41271045 CAGAAGAGTTTGAGAAGAAATGG - Intergenic
1054258053 9:62835355-62835377 CAGAAGAGTTTGAGAAGAAATGG - Intergenic
1054351758 9:64023434-64023456 CAGAAGAGTTTGAGAATAAATGG + Intergenic
1055205107 9:73720411-73720433 CTGATGTTTTTGGGAAATTATGG + Intergenic
1055225747 9:73992539-73992561 CTGATGAGGTTGTGGAAAAAAGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055882035 9:81013446-81013468 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1058414472 9:104771862-104771884 CTGGTGAGGTTGTGAAAAAAAGG - Intronic
1059664304 9:116431365-116431387 ATGATGTGGTTGCAAAAAAATGG + Intronic
1059750157 9:117239991-117240013 ATGATGTTTTTGACATAAAATGG - Intronic
1061604962 9:131702574-131702596 CTGATGTGCTTGAGAGTAACTGG + Intronic
1061884767 9:133585927-133585949 CAGATGTGTTTGTGGAGAAAAGG - Intronic
1061964130 9:134003683-134003705 CAGATGTGTCTGAGAAACAGAGG + Intergenic
1202800725 9_KI270719v1_random:173023-173045 CGGAAGAGTTTGAGAAGAAATGG + Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1185503475 X:616183-616205 CTGATGTCTTTGGGGGAAAAGGG - Intergenic
1186271000 X:7887988-7888010 CTGTTGTCTTTCAGAATAAAAGG - Intergenic
1186739599 X:12503647-12503669 CTGCTGTGGTTGATAAGAAAGGG - Intronic
1188196957 X:27247137-27247159 TTGATGTATTAGTGAAAAAAGGG - Intergenic
1188837355 X:34974879-34974901 CTGATGCATTAGAGAAGAAAGGG + Intergenic
1191612132 X:63128371-63128393 CTGATGTGACAGAGATAAAAAGG - Intergenic
1192585057 X:72312829-72312851 CTTCTGTGTTTAAAAAAAAAGGG + Intergenic
1194594794 X:95844049-95844071 TTAATGTGTTAGAGAAATAATGG + Intergenic
1194661028 X:96628667-96628689 CTGATGTGAAGGAGAAAAACTGG - Intergenic
1194873456 X:99160528-99160550 CTGATGTGAAGGAGAAAAACTGG + Intergenic
1194923116 X:99792396-99792418 ATAAAGTGTTTGAGAAATAAGGG - Intergenic
1195118121 X:101720280-101720302 CTGATGTCTTTGTCAAATAAAGG + Intergenic
1195237616 X:102917395-102917417 CTGATGTGTTTAAAAGAAGACGG + Intergenic
1195606943 X:106816466-106816488 CTGATGGGTTTGGGGATAAAAGG - Intronic
1195740614 X:108061408-108061430 GTGCTGTGTTTGAGCAGAAATGG - Exonic
1195778648 X:108436843-108436865 CCAATGTGTTTATGAAAAAATGG - Intronic
1195818969 X:108921794-108921816 CTGTTGTGTCTCAGAAAATAGGG - Intergenic
1196818042 X:119680576-119680598 CTGAGGAGTTTGGGAAAGAAGGG + Intronic
1196991156 X:121330188-121330210 GTGATGTTTTTGTGAAAGAAGGG + Intergenic
1197232703 X:124022416-124022438 CTAATGTGTTTTAGTAAATAAGG - Intronic
1198337529 X:135681266-135681288 CTGATGTTTTTCAGCAAACAAGG - Intergenic
1199145105 X:144356215-144356237 TTGTTGTGTTTCAGAAAACAGGG + Intergenic
1199840404 X:151641183-151641205 TTGATGTGTTTGTGGAAAACTGG + Intronic
1200783415 Y:7237344-7237366 CTTCTGTGTGTGAGAAAAGAGGG - Intergenic
1201153652 Y:11109987-11110009 CAGAAGAGTTTGAGAAGAAATGG + Intergenic
1201370650 Y:13259374-13259396 GTTATGTGTTTCAGAAAAAACGG - Intronic