ID: 1172925853

View in Genome Browser
Species Human (GRCh38)
Location 20:38534372-38534394
Sequence CTCTTTCTGATAGGATCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172925849_1172925853 -2 Left 1172925849 20:38534351-38534373 CCTTTTTCTGTTGTCACTGCCCT 0: 1
1: 0
2: 1
3: 44
4: 399
Right 1172925853 20:38534372-38534394 CTCTTTCTGATAGGATCGACAGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172925853 Original CRISPR CTCTTTCTGATAGGATCGAC AGG Intronic
903102834 1:21047923-21047945 CTCTGTCTGAAAGGATGGAGGGG + Intronic
904319517 1:29687665-29687687 TTCTTTCTGGTTGGATAGACAGG + Intergenic
904980088 1:34492688-34492710 CTCTTTCTAATAGGATCGTGAGG + Intergenic
905989882 1:42327287-42327309 CTCTTTCTGCTAGGATAGTTGGG - Intronic
909665886 1:78132928-78132950 CTCTTTCTCATAGGCTTTACAGG - Intronic
911624941 1:100112988-100113010 CACTTTCTGATAGGATTGTTAGG - Intronic
915075296 1:153303666-153303688 CTCATTCTGATGGGATGGAGAGG + Intronic
921479878 1:215651952-215651974 CCCTTGCTGATAGGATTGCCAGG + Intronic
924608420 1:245554521-245554543 CTCTTTCTGATAGCAACTTCTGG - Intronic
1075781694 10:125021471-125021493 CTCATTCTGCTAGGCTAGACTGG - Intronic
1081450554 11:43167351-43167373 CTATTTCTGTTTGGACCGACTGG - Intergenic
1097228217 12:57491924-57491946 TTCTGTCTGGTAGGATAGACAGG + Intronic
1102585541 12:113920302-113920324 CTCTTTCTGGTGGGGTAGACAGG - Intronic
1103146521 12:118599771-118599793 CTCTTTCTGATGGGCTGGTCAGG - Intergenic
1106638074 13:31552674-31552696 GTATTTCAGATAGGATAGACAGG - Intergenic
1107984248 13:45761266-45761288 GCCTTTCTGATAGTATCCACTGG - Intergenic
1112363931 13:98741160-98741182 CTTTTTCTGATTGGATTGAGTGG - Intronic
1113047557 13:106171950-106171972 TTATTTCTGATAGGATCTTCAGG - Intergenic
1125163612 15:36677041-36677063 CTCTTTCTCATAGGATACAATGG - Intronic
1127305228 15:57699156-57699178 CTCTTTCTGATTGGAGAAACAGG - Intronic
1130148926 15:81296638-81296660 CTCTTTATGATAGGAACAAAAGG - Intronic
1131322580 15:91409000-91409022 CTCCTGTTGATAGAATCGACCGG + Intergenic
1140789582 16:78378282-78378304 TTCTTTCTGATAGGATTCGCAGG - Intronic
1144336789 17:14278573-14278595 GGCTTTCTGATAGAATGGACAGG + Intergenic
1160511112 18:79454031-79454053 CGTTTTCTGATGGGATCGTCTGG + Intronic
1162221598 19:9181896-9181918 TGCTTTCTGATAGGATTCACTGG - Intergenic
925857923 2:8148583-8148605 CTCTTTCTGATATTATCAAGTGG + Intergenic
932000733 2:67882046-67882068 CTAATTCTGATAGGATTCACTGG + Intergenic
1172925853 20:38534372-38534394 CTCTTTCTGATAGGATCGACAGG + Intronic
1180920476 22:19519129-19519151 CTCTTTCTGAAGGGATCGCAGGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
952462947 3:33548656-33548678 TTTTTACTGATAGGATTGACAGG + Intronic
952943020 3:38457726-38457748 CACTTCCTGATGGGATAGACAGG - Intronic
961096080 3:124158039-124158061 ATCTTTCTCCTAGGATAGACTGG + Intronic
962646956 3:137449731-137449753 ATCTCTCAGATAGGATCTACAGG - Intergenic
970341903 4:15116012-15116034 CTGTTTTTGATAAGATAGACAGG - Intergenic
977401356 4:96536483-96536505 CTCTTTCTTCTAGGATGGAGGGG - Intergenic
983442655 4:167807150-167807172 CACTTTCTGATAGGTTTGAATGG - Intergenic
999033625 5:148321462-148321484 TTCTCTGTGATAGGATGGACTGG + Intronic
1000665586 5:163992285-163992307 CTCTTCCTGGTAGGATAAACAGG + Intergenic
1007762868 6:44143816-44143838 CTATTTCTGATGGGATAGACAGG + Intronic
1016402001 6:143690940-143690962 CTCGTTCTGATAGGATCCTGGGG + Intronic
1027877405 7:83788175-83788197 CTCTTTCTGATATTATCAATGGG + Intergenic
1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG + Intronic
1050157328 9:2681265-2681287 CTCTTTCTTATAGGTTTGATGGG - Intergenic
1051754482 9:20382915-20382937 CTATTACTGATAGGATGGGCAGG - Intronic
1056321893 9:85442992-85443014 CTTTATCTGACAGGATGGACAGG - Intergenic
1192888769 X:75365738-75365760 CACTTTCTGATAGGCTCAGCAGG + Intergenic
1198238983 X:134764716-134764738 CTATTTCTGATAGGATAGTGAGG + Intergenic
1198632146 X:138652276-138652298 CTCTTTCATATAGGATGGTCAGG - Intronic