ID: 1172928171

View in Genome Browser
Species Human (GRCh38)
Location 20:38560203-38560225
Sequence CCTTCTATGCAGTAGTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172928171_1172928176 17 Left 1172928171 20:38560203-38560225 CCCTAAAACTACTGCATAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1172928176 20:38560243-38560265 TAAGCAAACAACCATTGTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 245
1172928171_1172928180 29 Left 1172928171 20:38560203-38560225 CCCTAAAACTACTGCATAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1172928180 20:38560255-38560277 CATTGTAAAGGGTGTTAATAGGG 0: 1
1: 0
2: 1
3: 10
4: 153
1172928171_1172928179 28 Left 1172928171 20:38560203-38560225 CCCTAAAACTACTGCATAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1172928179 20:38560254-38560276 CCATTGTAAAGGGTGTTAATAGG 0: 1
1: 0
2: 2
3: 23
4: 304
1172928171_1172928177 18 Left 1172928171 20:38560203-38560225 CCCTAAAACTACTGCATAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1172928177 20:38560244-38560266 AAGCAAACAACCATTGTAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172928171 Original CRISPR CCTTCTATGCAGTAGTTTTA GGG (reversed) Intronic
900264897 1:1752447-1752469 GCTTCCCTGCAGAAGTTTTAGGG + Exonic
901908764 1:12437337-12437359 CTTTCTAATCAGTTGTTTTAGGG - Intronic
902170556 1:14606927-14606949 CTTTTTATGCAGTGGTGTTAGGG + Intronic
908054753 1:60272750-60272772 CCTTGTATGCTGTAGGTTTTAGG + Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
916361064 1:163969540-163969562 CCTTCTACTCTGTATTTTTATGG - Intergenic
917061311 1:171044140-171044162 CCATCTATGCAGTTTTTTAAGGG + Intronic
917784127 1:178433971-178433993 CCTTCTACCCATTACTTTTATGG + Intronic
919008214 1:191927357-191927379 CCTTCTATGCAGTCCTCTCAAGG - Intergenic
921370646 1:214419425-214419447 CCTCCACTCCAGTAGTTTTATGG - Intronic
921957773 1:221001762-221001784 CCTTCTGTTCATTAGTTTTGTGG - Intergenic
922096070 1:222444009-222444031 CCTTTTATAGAGTAGTTTTGGGG - Intergenic
922972520 1:229754879-229754901 CCTGCTAGGCAGGAGTTCTAAGG + Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
923938901 1:238797402-238797424 CCTTCTTTGGAGCATTTTTAAGG - Intergenic
1068087022 10:52386763-52386785 CCCTGTAAGCAGTAGTTTAAGGG + Intergenic
1071804533 10:89102672-89102694 TCTTCGATGCAGCTGTTTTAGGG + Intergenic
1074224001 10:111465965-111465987 CCTTCTCTGCAGTCTTTTTTAGG - Intergenic
1079702381 11:23564949-23564971 CCTACTATGCAGTAGTTTCAAGG - Intergenic
1079843397 11:25431896-25431918 CCTTCTATACAGCAGTTGTCCGG - Intergenic
1079852724 11:25557704-25557726 TCTTCATTTCAGTAGTTTTAAGG + Intergenic
1080735645 11:35011188-35011210 CCCATTATCCAGTAGTTTTAAGG - Intronic
1083091559 11:60204801-60204823 ACATCTATGCAATAGTATTAAGG + Intronic
1086201306 11:84205219-84205241 CCTTCTATTCTGAAGCTTTATGG - Intronic
1088464807 11:110123867-110123889 CCTTCTCTCCAATAGTTCTATGG - Intronic
1088580468 11:111310756-111310778 CCTTTTCTGCACTAGATTTAGGG - Intergenic
1088829777 11:113525522-113525544 CCTACTATGCAGTAGACTAATGG - Intergenic
1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG + Intronic
1097805767 12:63962740-63962762 AGTTCTATAGAGTAGTTTTAAGG - Intronic
1097985538 12:65779499-65779521 TCTTCCATGCAGGATTTTTAGGG + Intergenic
1099518475 12:83628855-83628877 CTTTCTATGCAGTAATTTACAGG + Intergenic
1101674204 12:106903016-106903038 ACTCCTATGCAGTGGTTTTAGGG - Intergenic
1104873748 12:132018601-132018623 TCGTCTTTGCAGCAGTTTTAGGG + Intronic
1105338033 13:19493024-19493046 CCTACTAAGCAGTATTTTTATGG - Intronic
1106350745 13:28928268-28928290 CTTGCTATGCAGTAGCTTTTTGG - Intronic
1106812418 13:33372619-33372641 CCTTCTGTGGAATAGTTTAATGG - Intergenic
1107357628 13:39584619-39584641 TCTTCTTTGGAGTAATTTTATGG + Intronic
1107601121 13:42013638-42013660 CTTTCTATGGAGTACTTTTAAGG + Intergenic
1112037264 13:95508226-95508248 CCTTATATTAGGTAGTTTTAGGG - Intronic
1114453556 14:22841578-22841600 GCTGCCATGCAGAAGTTTTACGG + Exonic
1117436931 14:55724436-55724458 ACTTCTGTGCAGAAGTTTTCAGG - Intergenic
1119143387 14:72288356-72288378 CCTTCCATTCAGTAGTATTATGG - Intronic
1122595715 14:102889394-102889416 ACTTCTATGCAGTAAATATACGG - Intronic
1123510794 15:20997333-20997355 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123568014 15:21571090-21571112 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123604122 15:22006414-22006436 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123890353 15:24772409-24772431 CCTGCTATACTGTAGTTTTTGGG + Intergenic
1124210443 15:27759280-27759302 CCTTCTTAGCAGTACTTTTAGGG - Intronic
1128070433 15:64792726-64792748 CCCTGTATGCTGTATTTTTATGG - Intergenic
1128983785 15:72204778-72204800 CATTCTATGCAGTGATTTCATGG + Intronic
1202976373 15_KI270727v1_random:298180-298202 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1133495966 16:6317772-6317794 CCTCCTCTGCAATAGTTTTATGG + Intronic
1133670099 16:8010215-8010237 CCTTCTGTTCACTAGTGTTAAGG + Intergenic
1138968031 16:62109909-62109931 CCTTCTATTCAGTAGTTTGAGGG - Intergenic
1149046162 17:52247861-52247883 CCTCCCATGCACTATTTTTAAGG + Intergenic
1152978200 18:245208-245230 CCTTCTTAGCATTAGATTTATGG + Intronic
1152991899 18:371336-371358 ACTTCTATGCAGTAGTCCTCTGG - Intronic
1156297081 18:35802392-35802414 CCTTCTATTTACTAGCTTTATGG + Intergenic
1157241310 18:46012151-46012173 CATTTTTTTCAGTAGTTTTAAGG - Intronic
1157740690 18:50090129-50090151 ACTTATGTGGAGTAGTTTTAAGG - Intronic
1166147033 19:40844976-40844998 CCTTCTAGGCAGGAGTTTGGGGG + Intronic
926513398 2:13810450-13810472 GCTTTTATGCTGTAGTTTGAAGG + Intergenic
926550244 2:14292900-14292922 CCTTGTAAGCAGCATTTTTAAGG - Intergenic
928404341 2:31003209-31003231 CCTTCAATGTTGTAGTTTAATGG + Intronic
928695959 2:33850503-33850525 CCTTCTTTCAGGTAGTTTTATGG - Intergenic
928871052 2:35980016-35980038 CCATCTATATAGTAGATTTAAGG - Intergenic
930329086 2:49959670-49959692 CAATCTATGCAGTAGTTGTAGGG + Intronic
931492547 2:62764467-62764489 CCTACTGTGCATTATTTTTAGGG + Intronic
931573572 2:63696492-63696514 CCTTCTCTCCAGTAGTATTGAGG + Intronic
933200204 2:79439211-79439233 CATTCAATGCAGTATTTTTTAGG + Intronic
933469562 2:82704136-82704158 CCTGCTATGCACTAGTTCTAGGG + Intergenic
933832535 2:86222594-86222616 CCCTCTTTGCAGTGGTTTCAAGG + Intronic
934760759 2:96855198-96855220 CCTTCAATGTTGTTGTTTTAAGG - Intronic
938816928 2:134914400-134914422 CCTTCTATCCCGTTTTTTTACGG + Intergenic
940010566 2:149050400-149050422 GCTTCTGTGCAGTATTTTGATGG - Intronic
942066864 2:172279703-172279725 TCTTCTGTTCAGGAGTTTTAGGG - Intergenic
942854868 2:180532972-180532994 TCTACTATGCATTAGATTTAGGG + Intergenic
943362452 2:186937339-186937361 CCTTCTCAGCATAAGTTTTAGGG + Intergenic
943920153 2:193696789-193696811 CTTTCTTAGCAGTAGTTTTCTGG - Intergenic
944559627 2:200923064-200923086 TCACATATGCAGTAGTTTTAGGG + Intronic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
947063006 2:226187998-226188020 CCTTCTATGGAGTAGTTCCAAGG + Intergenic
1169310762 20:4537777-4537799 CTTGCTATGCAGAAGTTTTTGGG - Intergenic
1171527999 20:25830829-25830851 ACATCTAGGCAGTCGTTTTAAGG - Intronic
1171548827 20:26025051-26025073 ACATCTAGGCAGTCGTTTTAAGG + Intergenic
1172272483 20:33662565-33662587 CCTTGTATGCAGAAGTCCTAGGG + Intronic
1172477043 20:35246927-35246949 TCCACTATGCAGCAGTTTTACGG + Exonic
1172928171 20:38560203-38560225 CCTTCTATGCAGTAGTTTTAGGG - Intronic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1173238744 20:41273975-41273997 CATTCTATGATGTAATTTTAAGG + Intronic
1176735547 21:10542888-10542910 CCTACTAAGCAGTTTTTTTATGG + Intronic
1177284730 21:19035257-19035279 CCTTCTATGAAGTCATTTTAAGG - Intergenic
1182192018 22:28471220-28471242 CCTTCCATGTAGTACCTTTATGG + Intronic
1182457865 22:30463378-30463400 CCTTCTCTACAGTGGTATTAAGG + Intronic
1183533610 22:38380544-38380566 CCTACTAAGCAGTTTTTTTATGG - Intronic
950172297 3:10847368-10847390 CTTTCTAAACAGTACTTTTAAGG + Intronic
951674968 3:25228417-25228439 CCTTTTCTTCAGTAATTTTATGG + Intronic
954841886 3:53518554-53518576 CCATCAAAGCAGTAGTTCTAGGG + Intronic
957484784 3:80845332-80845354 CCTTCTATACCATATTTTTATGG + Intergenic
957906728 3:86567098-86567120 CCTTGGATGCAGAAATTTTAGGG + Intergenic
960357014 3:116665828-116665850 TCTTTTATGCTGTATTTTTATGG - Intronic
967376237 3:188804868-188804890 CCTTCTTTTCATTAGTTTTCTGG + Intronic
967962632 3:194938246-194938268 GCTTCTATGCAGATGTTTTCTGG + Intergenic
970235567 4:13955032-13955054 CCTTCTATGTTGTATTTTTGGGG - Intergenic
972005280 4:34094944-34094966 GCCTCTATGCAGTATTTTCAAGG - Intergenic
972166365 4:36289606-36289628 CTTTCTATTAAGTAGTTTTTAGG - Intronic
974375737 4:61073736-61073758 CTTTCTTTCCAGTAGTTTTCAGG + Intergenic
975450829 4:74524436-74524458 CCTTCAATGCAAAAGTTTGAAGG - Intergenic
980528741 4:134022811-134022833 CCATATATGCAGGAGTTTTGGGG + Intergenic
983461643 4:168031222-168031244 TCTTTTATGCTGTATTTTTATGG - Intergenic
986418171 5:7549369-7549391 CCTTCTGAGCAGAAGCTTTAGGG - Intronic
986595962 5:9422239-9422261 CCTTCAATGCAGATGTTATAGGG + Intronic
989444665 5:41513177-41513199 ACTTCTATGCTGCAGTTTTGAGG + Intergenic
990696593 5:58424959-58424981 CCATGTCTTCAGTAGTTTTAGGG - Intergenic
994442050 5:99820009-99820031 CCTTCTTTGGACTAGTTTCAGGG - Intergenic
994673088 5:102785722-102785744 CCTTATATTCAATACTTTTATGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
999043657 5:148444681-148444703 TCATCCATGCAGTATTTTTAAGG - Intergenic
1004115776 6:12766273-12766295 CCTTCTATGAATTAATTGTAAGG - Intronic
1010435055 6:75820140-75820162 CCTTCTATGCCATAAATTTAGGG - Intronic
1011415687 6:87117944-87117966 CCTTTTCTGAAATAGTTTTATGG + Intergenic
1011520828 6:88203780-88203802 CCTTCTATACAGTTTTTTGAGGG - Intergenic
1016716190 6:147232973-147232995 CCTTCTAAGAAGTAGTTTACTGG - Intronic
1017313184 6:152998688-152998710 ACTTCTAGGAAATAGTTTTATGG + Intronic
1017519391 6:155188056-155188078 CCTTCTATGCCGAGGTTTTGAGG + Intronic
1019093376 6:169558839-169558861 CCTGCTATGCTGTGGATTTATGG - Intronic
1020830084 7:13084565-13084587 ACTTCTATTAAGGAGTTTTAAGG - Intergenic
1027186685 7:75976213-75976235 TCTTCTATTAAGTATTTTTACGG + Intronic
1030222870 7:107115884-107115906 ACTTCTAGGCAGAAGCTTTAGGG + Intronic
1030496190 7:110303890-110303912 GCTTCTATTCAGTACTATTAGGG + Intergenic
1034106159 7:148491704-148491726 CCTTCTATGTAGTTGTTATCTGG + Intergenic
1036473952 8:9076302-9076324 TCTTCTGTACCGTAGTTTTAGGG - Intronic
1036988108 8:13559661-13559683 AATTCTATGTAGTAGTTTTCAGG + Intergenic
1038497749 8:28016202-28016224 CCTTTTCTGCAGTAGGTTAATGG - Intergenic
1040353679 8:46594246-46594268 TCTTCTGTGGGGTAGTTTTAAGG - Intergenic
1040698992 8:50038448-50038470 CCTCCTGTGCAGTGGGTTTAAGG + Intronic
1040801642 8:51348873-51348895 CATTCTGTGCTGTAGTGTTATGG - Intronic
1044092192 8:88015702-88015724 CCTTCTATGTTATAGTTCTAGGG - Intergenic
1044721285 8:95150732-95150754 CCTTATCTTCAGTATTTTTAGGG + Intronic
1048136045 8:131747403-131747425 TCATCTATGCAGTGGTGTTAGGG - Intergenic
1049912497 9:282804-282826 GCTTCTACTCACTAGTTTTACGG + Intronic
1053421606 9:37983421-37983443 GCTGCCATGCAGTACTTTTAAGG - Intronic
1053552717 9:39101132-39101154 CCTCCTTTCCAGTAGTTTGATGG + Intronic
1053816832 9:41921296-41921318 CCTCCTTTCCAGTAGTTTGATGG + Intronic
1054107091 9:61064978-61065000 CCTCCTTTCCAGTAGTTTGATGG + Intergenic
1054613766 9:67266147-67266169 CCTCCTTTCCAGTAGTTTGATGG - Intergenic
1186984300 X:14995232-14995254 CCTAGTATGAAGTAGTTTTAGGG - Intergenic
1188774671 X:34199687-34199709 CCTACAATGCAGTAGTACTAAGG + Intergenic
1191213608 X:57913767-57913789 ACTTCTATGCAATAGTTTACTGG - Intergenic
1194420663 X:93669437-93669459 CATCCTATGTAGAAGTTTTAAGG + Intergenic
1194546697 X:95244136-95244158 CCTTCAATCCAGTTTTTTTAGGG - Intergenic
1196205264 X:112932308-112932330 CCTTATATAAAGCAGTTTTAAGG + Intergenic
1198539447 X:137621186-137621208 CCTTATAAGCAGTAATTTTAAGG + Intergenic
1202061752 Y:20896422-20896444 CATCATATGCAGTGGTTTTAAGG - Intergenic