ID: 1172928339

View in Genome Browser
Species Human (GRCh38)
Location 20:38561730-38561752
Sequence AGAACTTATCTGGCCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172928339_1172928346 28 Left 1172928339 20:38561730-38561752 CCATCTTGGGCCAGATAAGTTCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1172928346 20:38561781-38561803 AGAACATTTAGCAGCATCTTTGG 0: 1
1: 1
2: 18
3: 136
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172928339 Original CRISPR AGAACTTATCTGGCCCAAGA TGG (reversed) Intronic
902352803 1:15870499-15870521 AGAAATTAACTGGGCAAAGAGGG + Intronic
905914744 1:41676815-41676837 AGTAGTCATGTGGCCCAAGACGG + Intronic
910046898 1:82928336-82928358 AGAAGTGATCTAGCCCAATATGG - Intergenic
911945466 1:104101676-104101698 AGAGTTTCTCTGGCCTAAGAAGG - Intergenic
912179390 1:107200064-107200086 AGTACATATCTGGCTAAAGAAGG - Intronic
912334685 1:108851242-108851264 AAAAGTTATGTGGCCCAAGGGGG + Intronic
912344272 1:108950257-108950279 AGACCTTATCAGTCCCATGATGG - Intronic
913968709 1:143397645-143397667 AGAATTTATCTTCCTCAAGATGG + Intergenic
914063088 1:144223244-144223266 AGAATTTATCTTCCTCAAGATGG + Intergenic
914116062 1:144743110-144743132 AGAATTTATCTTCCTCAAGATGG - Intergenic
916691179 1:167191248-167191270 AAAACGAATCTGACCCAAGAAGG + Intergenic
922333861 1:224602878-224602900 AGACCTTTACGGGCCCAAGATGG - Intronic
924035680 1:239934146-239934168 AGTACTTACCTGGAACAAGAAGG - Intergenic
1063378690 10:5570558-5570580 AGGTCTCATCTGGCCCAAGGAGG + Intergenic
1066236850 10:33493414-33493436 AGAACACATCTGGACCAAGGTGG + Intergenic
1072915292 10:99533877-99533899 AGAACTCATCTCACCCTAGAGGG - Intronic
1075560913 10:123467836-123467858 AGAAGTTAGCTAGCCAAAGAAGG + Intergenic
1075603210 10:123786079-123786101 AGGTCATATCTAGCCCAAGATGG - Intronic
1076902264 10:133345607-133345629 AGAACATGTGTGGCCCGAGAGGG + Intronic
1077977267 11:7260985-7261007 TGAAGTTATAGGGCCCAAGAGGG + Intronic
1078244430 11:9561177-9561199 AGAAATCATCTGGGCCAAGGTGG - Intergenic
1084447082 11:69209848-69209870 AGAATTTATCTGGCTCTAAAAGG - Intergenic
1085606706 11:77906628-77906650 AGAACATATCTAGCCTAACAAGG + Intronic
1086206661 11:84266779-84266801 AGAATTTATCTGAGGCAAGAAGG + Intronic
1086862936 11:91946570-91946592 AGAAACCATCTGGCCCAACAGGG + Intergenic
1087224926 11:95588155-95588177 AGAACTTTTCTAGGCAAAGATGG + Intergenic
1089984195 11:122797747-122797769 AGAAGTTAGCTGGGCAAAGAAGG + Intronic
1091289312 11:134428597-134428619 AGGAATTTTCTGGCCCAAGCAGG + Intergenic
1093513327 12:19954829-19954851 AGAACTTATCTGGGCAACAATGG - Intergenic
1093766822 12:22973366-22973388 GGACCTGAGCTGGCCCAAGAGGG - Intergenic
1093904861 12:24678433-24678455 AAATCTTAGGTGGCCCAAGAAGG + Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1096071615 12:48778509-48778531 ATGACTTATCTGGCCCTAGTTGG - Intronic
1099752181 12:86789953-86789975 AGAAATTATCTGGCCCTAAAGGG + Intronic
1102625173 12:114228952-114228974 AGAACATCTCATGCCCAAGATGG - Intergenic
1102662910 12:114545303-114545325 GTAAATTATCTTGCCCAAGATGG + Intergenic
1103412610 12:120723347-120723369 AGAACATATCAGCCTCAAGAAGG + Exonic
1106833961 13:33614111-33614133 AGAGCTGATCTGGCCGAAGAGGG + Intergenic
1108299225 13:49057436-49057458 AGAGTTTATCTGGCATAAGAGGG - Intronic
1116410656 14:44618809-44618831 AGAAAGGATCTGGACCAAGAAGG + Intergenic
1120190930 14:81438422-81438444 AGAACCAAGCTGACCCAAGATGG + Intergenic
1121208590 14:92189372-92189394 AGAACTTCTCTGGCCCCATTTGG + Intergenic
1121482075 14:94286673-94286695 AGAGCTTCTCTGGCTAAAGACGG - Intronic
1121983576 14:98476853-98476875 AGAACTTATCTGTCATAAAAAGG + Intergenic
1122093514 14:99354870-99354892 AGAAAGGATCCGGCCCAAGAAGG + Intergenic
1125856460 15:42954436-42954458 GGAAGTTAACTGGCCCAATAGGG - Intronic
1127848552 15:62892813-62892835 ATAAATTCTCTGGCCCAAGTTGG - Intergenic
1128578287 15:68790982-68791004 AGAACTTCTCTTCCCCAAGGCGG + Intronic
1134272517 16:12745624-12745646 AGAACTTATGTGTACAAAGAAGG + Intronic
1135485276 16:22859585-22859607 AGAACCCCTTTGGCCCAAGAAGG - Intronic
1139331217 16:66192635-66192657 TGAAGCTATCTGGACCAAGAGGG - Intergenic
1141547764 16:84783167-84783189 GGTACTTCTCTGGCTCAAGAAGG + Intergenic
1147427337 17:40352146-40352168 AGATCTTGCCTGGCACAAGAAGG - Intronic
1149202876 17:54208202-54208224 AGAACTTATGTGTACAAAGAGGG + Intergenic
1151047637 17:70940471-70940493 AGAACTCATATGACCCAAGAAGG + Intergenic
1151973939 17:77473924-77473946 AGAACTGCTCTGGAACAAGATGG - Intronic
1155093820 18:22536686-22536708 AGAAGTTTTCTGGCCCCAGCAGG + Intergenic
1156452032 18:37272225-37272247 AGGAACTATCTGGCCCCAGATGG - Intronic
1156762871 18:40614436-40614458 ACAACTTCACTGTCCCAAGAAGG + Intergenic
1156906019 18:42352778-42352800 AGAAGTTCTCTTCCCCAAGATGG - Intergenic
1158890732 18:61869609-61869631 AGAACTTAGCTGATCCAGGAGGG + Intronic
1161205322 19:3037872-3037894 AGCACTTAGTTGGGCCAAGATGG + Intronic
1161293775 19:3509163-3509185 AGAACATAAGTGGCCCAGGAAGG - Intronic
1163767319 19:19170781-19170803 AGCACATATCTGGCCCCAGGAGG - Intronic
1165214933 19:34264204-34264226 GGAACTGAGGTGGCCCAAGATGG + Intronic
1167340194 19:48911075-48911097 GGATCATGTCTGGCCCAAGATGG + Intronic
1167953162 19:53044065-53044087 TGGACTTGTCTGGCCCAGGAAGG + Intergenic
1202702498 1_KI270712v1_random:175115-175137 AGAATTTATCTTCCTCAAGATGG + Intergenic
927508023 2:23627077-23627099 AGTATCTATCTGCCCCAAGAGGG + Intronic
927523647 2:23718507-23718529 AGAACTGACCAGGACCAAGAGGG + Intergenic
927905769 2:26855131-26855153 AGAAATCATCTGGCCCATGCTGG + Intronic
929695595 2:44112683-44112705 ATGAATTATCTGTCCCAAGAAGG - Intergenic
932909536 2:75791384-75791406 AAAAATTATCTGGACCAAAATGG + Intergenic
932980991 2:76666768-76666790 AGACCTTATATAGCCCATGACGG + Intergenic
934173409 2:89558568-89558590 AGAATTTATCTTCCTCAAGATGG + Intergenic
934283724 2:91632921-91632943 AGAATTTATCTTCCTCAAGATGG + Intergenic
936249065 2:110853308-110853330 AAGAATTATCTGGCCCAAAATGG + Intronic
938106510 2:128534740-128534762 AAAACTGATCAGGCCCAAGGAGG + Intergenic
940029586 2:149247398-149247420 AGAACTGACCAGCCCCAAGAAGG + Intergenic
940609917 2:155977398-155977420 GCAACTTAGCTGGTCCAAGAGGG + Intergenic
940710117 2:157152738-157152760 GGATTTTATCTGGCCCAAAATGG + Intergenic
941719986 2:168802439-168802461 AGAACTGCTCTGGGTCAAGACGG - Exonic
942394822 2:175536017-175536039 AGCAATCATCTGGCCCTAGATGG - Intergenic
943748708 2:191488787-191488809 ACAACTTATCTGGTCCCAGAAGG - Intergenic
945648469 2:212531241-212531263 AACACTTATCATGCCCAAGACGG + Intronic
945916879 2:215713775-215713797 ACATCTTCTCTGGCCCAAGATGG + Intergenic
945964539 2:216172128-216172150 ACAACTCGTCAGGCCCAAGATGG - Intronic
947399667 2:229718442-229718464 AGAACTGTTCTGGCCAAAGTAGG - Intergenic
1168995222 20:2128202-2128224 AGAACTGCTCTGGCAAAAGAGGG + Intronic
1170416371 20:16147165-16147187 AGCACTTCTCTGGACCCAGATGG - Intergenic
1172022258 20:31923254-31923276 AGAATTTTTCTGAACCAAGAAGG - Intronic
1172928339 20:38561730-38561752 AGAACTTATCTGGCCCAAGATGG - Intronic
1177181939 21:17753742-17753764 AGAATTTCTCTTGCCCAAGGTGG + Intergenic
1178268017 21:31162874-31162896 TGAACTTATCTGGAACATGAAGG - Intronic
1178717438 21:34978991-34979013 AGAACCTACCTGGCCCAGGATGG - Intronic
1184399127 22:44263476-44263498 GGAACCTATCTGGGGCAAGATGG + Intronic
1184580870 22:45416660-45416682 AGAGCTTATCCTGGCCAAGATGG - Intronic
952984171 3:38762844-38762866 AGAACCTATCAGGCCACAGAGGG + Intronic
953925016 3:46978436-46978458 AGAAGTTTTCTGGGCCCAGAGGG - Intronic
954727483 3:52626056-52626078 AAAACTTATCAGGCAAAAGAAGG - Intronic
955587533 3:60497199-60497221 AGTAGTTATCTGGTCCAAAATGG + Intronic
955826870 3:62956926-62956948 AGTACTTAGCTGCCCCAAGTGGG + Intergenic
956408716 3:68955960-68955982 GGGAATTATCTGGCCCAAAATGG + Intergenic
957392536 3:79595748-79595770 AGAGCCTATGTTGCCCAAGATGG + Intronic
969152929 4:5185888-5185910 AGAACAAAAATGGCCCAAGATGG - Intronic
969827266 4:9767382-9767404 AGAATTTATCTTCCTCAAGATGG + Intergenic
970980047 4:22085763-22085785 ACAACTTATCTGAACCAAAATGG + Intergenic
971180078 4:24322045-24322067 AGAACATAGCTTCCCCAAGAAGG + Intergenic
972600902 4:40571727-40571749 AGAACTTATCTGGCTGGACACGG + Intronic
976434815 4:85004972-85004994 AGAGCTAATTTGGCCAAAGATGG - Intergenic
978440807 4:108731354-108731376 AGAATTTATTTGGCCTCAGAAGG - Intergenic
986757353 5:10850602-10850624 AGAATCTACCTGGCCCAACATGG - Intergenic
992887352 5:81171781-81171803 AGAAATTGTCTGGGGCAAGAAGG - Intronic
992991241 5:82285896-82285918 AAATATTAACTGGCCCAAGATGG + Intronic
995254941 5:110035325-110035347 AGCACTTATCAGTCCCTAGATGG - Intergenic
1002175015 5:177396796-177396818 AGAACTGCTCTGGACCACGAAGG - Exonic
1002925306 6:1602277-1602299 AGAAGAGAGCTGGCCCAAGATGG - Intergenic
1003066346 6:2906439-2906461 ACACAATATCTGGCCCAAGAGGG + Intergenic
1005618705 6:27600389-27600411 TGAACTTATCTGGCTCAAGCAGG + Intergenic
1006809478 6:36810644-36810666 AGAACTTTCCAGACCCAAGATGG - Intronic
1012464091 6:99497909-99497931 AGAAATTATCTGGGCAAAAAGGG - Intronic
1013103635 6:107008395-107008417 AGCACTTTGCTGGGCCAAGATGG + Intergenic
1014697461 6:124641321-124641343 AACATTTATCTGGACCAAGAAGG + Intronic
1015190824 6:130470361-130470383 AGTTCTCATCTGGCTCAAGAAGG + Intergenic
1016608125 6:145958452-145958474 TGAACAAAACTGGCCCAAGAAGG + Intronic
1017785090 6:157749840-157749862 AGAACTGATATGGCCAAAAAAGG + Intronic
1018440713 6:163810049-163810071 AGAACTTAACTGGCCCCTTATGG - Intergenic
1023427010 7:40048346-40048368 AGAACTTTTCTGGCTAAAGTTGG + Intronic
1025859293 7:65311472-65311494 TAAATTTATCTGACCCAAGATGG - Intergenic
1027700931 7:81469498-81469520 AGCACTTATCAGGCCAGAGAAGG - Intergenic
1029977260 7:104846579-104846601 AGAAAGTAACTTGCCCAAGATGG + Intronic
1030670758 7:112333688-112333710 AGAAATTATCTCACCTAAGAAGG - Intronic
1031490666 7:122383877-122383899 AGAACAAATTTGGCCCAAGTAGG + Intronic
1033557537 7:142501813-142501835 AGATCTTACCTGCCCCAAGTAGG - Intergenic
1033799536 7:144883628-144883650 AGAAAGTATTTTGCCCAAGATGG - Intergenic
1033957700 7:146872136-146872158 ATAATTTAACTGGCCCAAAAGGG - Intronic
1034912301 7:155006836-155006858 AGAAATTATCTTCCCCAAAATGG + Intergenic
1037031154 8:14107455-14107477 AGAACTTAACTGGACTATGATGG - Intronic
1043515344 8:80990287-80990309 AGGACTCCTCTGGCCCAAGCAGG - Intronic
1050531217 9:6591275-6591297 AGGAGTTATCTAGACCAAGATGG - Intronic
1054881140 9:70146291-70146313 AGAACTTCTCTGCCCCAACTGGG - Intronic
1055454838 9:76462428-76462450 AGAATTTAACTGGCCAAAAATGG - Intronic
1060475309 9:123982546-123982568 GGAGCTTATTTTGCCCAAGAGGG - Intergenic
1060623435 9:125088854-125088876 AAGACTTATTTGGCCCAAAATGG - Intronic
1060817545 9:126643085-126643107 AGATCTTATCAGGCCCCTGATGG - Intronic
1060994116 9:127866637-127866659 ACACCTGATCTGGCCCAAGCTGG - Exonic
1186435544 X:9539927-9539949 AGGACTTATTTGGCTCTAGATGG + Intronic
1186580737 X:10815261-10815283 AGAACTTAACTGACCCCAAAGGG + Intronic
1186876061 X:13819377-13819399 AGAACTTTTCTGGCCAAAAATGG - Intronic
1188665727 X:32818640-32818662 AGGAGTTAACTGGGCCAAGAAGG + Intronic
1195737653 X:108030394-108030416 AGGACTTATCTGACCCAATAGGG + Intergenic