ID: 1172930914

View in Genome Browser
Species Human (GRCh38)
Location 20:38585967-38585989
Sequence CTGGGTCAGGGGTAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172930903_1172930914 2 Left 1172930903 20:38585942-38585964 CCCAGGCCTGGCAGGGGACTCCT 0: 1
1: 0
2: 2
3: 50
4: 324
Right 1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG 0: 1
1: 0
2: 1
3: 48
4: 449
1172930897_1172930914 25 Left 1172930897 20:38585919-38585941 CCTCAGGCAAGGCTGCAGGGATA 0: 1
1: 0
2: 2
3: 34
4: 274
Right 1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG 0: 1
1: 0
2: 1
3: 48
4: 449
1172930905_1172930914 -4 Left 1172930905 20:38585948-38585970 CCTGGCAGGGGACTCCTTCCTGG 0: 1
1: 0
2: 3
3: 35
4: 394
Right 1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG 0: 1
1: 0
2: 1
3: 48
4: 449
1172930904_1172930914 1 Left 1172930904 20:38585943-38585965 CCAGGCCTGGCAGGGGACTCCTT 0: 1
1: 0
2: 6
3: 25
4: 335
Right 1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG 0: 1
1: 0
2: 1
3: 48
4: 449
1172930894_1172930914 30 Left 1172930894 20:38585914-38585936 CCTAGCCTCAGGCAAGGCTGCAG 0: 1
1: 0
2: 2
3: 49
4: 444
Right 1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG 0: 1
1: 0
2: 1
3: 48
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172930914 Original CRISPR CTGGGTCAGGGGTAGGAGAC AGG Intronic
900118114 1:1037110-1037132 CTGGGTCCTGGGGAGGAGACAGG + Intronic
900594040 1:3472375-3472397 CTGGGTCATGGGGAGGTGAGGGG + Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
900730460 1:4255580-4255602 AGGGGTCTGGGGTAGGAGAGGGG + Intergenic
900813231 1:4824120-4824142 GTGGGGCAGGGGTAGGGGATGGG + Intergenic
901135417 1:6989911-6989933 CTGGGTCAGAGCAAGGAGAATGG + Intronic
901459065 1:9380770-9380792 CTAGGACACGGGTAGAAGACAGG + Intergenic
901493583 1:9608903-9608925 GTGGGTCGGGGGGAGGAGCCCGG + Intronic
901588618 1:10319751-10319773 CTGGGGTAGTGGTAGGAGAAAGG - Intronic
902361484 1:15944661-15944683 CAGGGGCCGGGGTAGGAGGCCGG + Intronic
902821790 1:18947891-18947913 CTGGCTCAGGGTGAGGAGGCAGG - Intronic
903699838 1:25238968-25238990 CAGGGTCAGAGGTAGGGGACGGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904475447 1:30762057-30762079 CTGGGTTCGGGGCAGGAGACAGG - Intergenic
904606853 1:31702730-31702752 CAGGGTCAGGGGCTGGTGACTGG + Intronic
904942866 1:34177227-34177249 CTGGGCCGGGGGTGGGAGTCGGG + Intronic
905346771 1:37316592-37316614 CCAGGGCAGGGGCAGGAGACTGG - Intergenic
905699196 1:39999257-39999279 CTCGGTTAGGGGCTGGAGACCGG - Intergenic
905751027 1:40464127-40464149 CTGGGTCGGGGGTGGGGGAGGGG - Intergenic
905943594 1:41883779-41883801 CTGGGACAGGGGTCAGCGACAGG - Intronic
906528255 1:46508912-46508934 CTGGGGCAGGGGAAGGAGTGGGG - Intronic
907358249 1:53894085-53894107 CCGGGTCAGGGGAAGGAGTCAGG - Intronic
907747947 1:57233542-57233564 CGAGGTCAGGGGTTCGAGACCGG + Intronic
908540522 1:65117831-65117853 TAAGGTCAGGGGTAAGAGACCGG + Intergenic
909559687 1:76996188-76996210 CTGGCTAAGGGTTAGAAGACAGG - Intronic
909693420 1:78436509-78436531 CTGGGTCTGGGATAGGAAAGTGG + Intronic
909839725 1:80304720-80304742 CTGGGTCAGGAGTAGAAATCTGG - Intergenic
910904534 1:92161046-92161068 CTGTGCCAGGGGTAGGATTCTGG + Intergenic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
911176738 1:94825102-94825124 CTGGGGCAGGGGTGGGACACAGG - Intronic
912265495 1:108152965-108152987 CTGGAGCAGGGTCAGGAGACAGG + Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915467330 1:156105211-156105233 CTGGCTTAGGGATAGCAGACAGG + Intronic
915686086 1:157636255-157636277 CTGGGCCAGGGGTGGGTGACTGG + Intergenic
915918846 1:159959288-159959310 CCTGGTCAGGGGTAAGAGAGAGG - Intergenic
916091338 1:161309908-161309930 CTGGGGCAGGGGCAGGGGCCCGG + Exonic
917265722 1:173218552-173218574 CTGGGGCAGGGATGGAAGACTGG - Intergenic
918202414 1:182279806-182279828 CTGGATCAGGGGGTGGAGAGTGG - Intergenic
918213210 1:182370143-182370165 TTGGGTGAGGGGCAGGGGACAGG + Intergenic
919905457 1:202075507-202075529 CTGGGGTAGGGGCAGGAGCCAGG - Intergenic
920718403 1:208363642-208363664 AAGGGTCAGGGGTAGGAGGAGGG + Intergenic
920761125 1:208784600-208784622 CTGGTTAAGGGGGAGGAGAGGGG - Intergenic
922166311 1:223118330-223118352 TGAGGTCAGGGGTTGGAGACCGG + Intronic
922720913 1:227899908-227899930 TTGGGCCAGGGGTAGGAGGCGGG + Intergenic
924554650 1:245108123-245108145 CTGGGTGACGGGTGGGTGACGGG - Intronic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063631738 10:7740329-7740351 ATGGAGCTGGGGTAGGAGACGGG - Intronic
1063635513 10:7778522-7778544 CGAGGTCAGGAGTTGGAGACCGG + Intronic
1064903565 10:20319272-20319294 CTGGGTGGTGGGTAGGAGAATGG - Intergenic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1066011205 10:31195214-31195236 CTGGGACAGACGCAGGAGACAGG - Intergenic
1066073707 10:31849278-31849300 CTGGGTTAGGTGTAGGAGAAGGG - Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1070025664 10:72629123-72629145 CGAGGTCAGGGGTTTGAGACCGG - Intergenic
1070291909 10:75122745-75122767 TTGGGGAAGGGGTAAGAGACGGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070815774 10:79322363-79322385 CTGGGTCAGAGGTCAGGGACTGG - Intergenic
1071777390 10:88804488-88804510 CTGGTTCTGAGGTAGGAGAAGGG + Intronic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074407960 10:113196511-113196533 CTGGGTAAAGGGTAGGATAAAGG - Intergenic
1074967727 10:118507224-118507246 TTAGGTCAGAGGGAGGAGACGGG - Intergenic
1075047126 10:119155050-119155072 CTGGGACAAAGGTAAGAGACAGG - Exonic
1075085833 10:119413880-119413902 CGGGGGCAGGGGTGGGAGTCGGG - Intronic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1075461641 10:122620444-122620466 CTGGGTCAGATGTTGGAGGCTGG + Intronic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1075934474 10:126327581-126327603 GTGGGGAGGGGGTAGGAGACAGG - Intronic
1077055089 11:587676-587698 ATTGGTCAGGGGCAGGAGAGAGG + Intronic
1077336760 11:2008724-2008746 CTGGCTGAGGGAAAGGAGACGGG + Intergenic
1077425492 11:2474039-2474061 CTGGGCCAGCGGTAGGAGGCTGG - Intronic
1077488223 11:2848742-2848764 CTGGGCGAGGGGTTGGAGGCGGG - Exonic
1077695087 11:4386282-4386304 TTGGGATAGGAGTAGGAGACAGG - Intronic
1079088618 11:17464983-17465005 CTGGCTCAGGGTTAGGAAACAGG + Intronic
1081648129 11:44804305-44804327 CAGGGTCAGGAGTTCGAGACCGG - Intronic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1081822071 11:46008512-46008534 ATGGGTCAAAGGTAGAAGACGGG + Intronic
1082853457 11:57785761-57785783 CAAGGTCAGGGGTTTGAGACCGG - Intronic
1083419266 11:62544265-62544287 CAGGGCCAGGGGTGGGACACAGG - Intronic
1083587427 11:63870395-63870417 CTGGGTCAGGGCTAGAATGCTGG - Intronic
1083625376 11:64069488-64069510 CTGGCTCTGGGGTAGGGGAAGGG + Intronic
1083927169 11:65815025-65815047 CTGGTTTAGGGGTGGGAGAGTGG - Intergenic
1084119117 11:67058749-67058771 ATGGGCCAAGGGTGGGAGACAGG - Intronic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1088988466 11:114929760-114929782 CAGGGTCAGGGGTCGGGGAGTGG - Intergenic
1089013730 11:115149882-115149904 CCTGGACAGGTGTAGGAGACTGG + Intergenic
1089430293 11:118418009-118418031 ATGAGTCAGGGGTAGGGGACTGG + Intronic
1089432862 11:118437166-118437188 AAGGGTCAGGGGGAGGAGAGCGG - Intronic
1090185233 11:124734694-124734716 CTGGGTAAGAGGAAGGATACTGG + Intergenic
1091227232 11:133964913-133964935 CTGGGGGTGGGGGAGGAGACTGG + Intergenic
1202819744 11_KI270721v1_random:63906-63928 CTGGCTGAGGGAAAGGAGACGGG + Intergenic
1091883537 12:3999385-3999407 CAGGGTTAAGGGTAGGAGCCAGG + Intergenic
1092123444 12:6060086-6060108 CTCGGCCAGGGTTAGGAGAGTGG + Intronic
1092159605 12:6308940-6308962 CTGGGCCAGGAGCAGGAGACAGG + Intergenic
1092181784 12:6451375-6451397 CTGGCTCAGGGGGAGCAGGCAGG - Exonic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1094709333 12:32945752-32945774 CAAGGTCAGGAGTTGGAGACTGG + Intergenic
1095496468 12:42789731-42789753 TGAGGTCAGGGGTTGGAGACTGG - Intergenic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096149049 12:49297340-49297362 CTCGTTCTGGGGTAGGAGAGTGG - Exonic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1096542748 12:52317415-52317437 CTGGCTCAGGGGAAGGATGCAGG + Intronic
1096591713 12:52664533-52664555 CTGGGTCAGGCTTAGGGGAGAGG - Intergenic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1097088698 12:56488269-56488291 CTGGGGCTGGGGCAGGAGAAGGG + Exonic
1097182375 12:57178788-57178810 CTGGAACAGGGGGAGGAGAGTGG + Intronic
1098018822 12:66134136-66134158 CGCGGTCAGGGGCTGGAGACCGG - Intronic
1100878639 12:98992042-98992064 ATGGGGCAGGGGTAGGTTACAGG + Intronic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103026080 12:117575151-117575173 CTGGGGCATGGGTAGGAGTTGGG - Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103621517 12:122189988-122190010 TTGGGTCAAGGGTAGGACAGGGG + Intronic
1104335862 12:127894378-127894400 CTGGCTTAGGAGTAGGAGACTGG - Intergenic
1107822743 13:44300954-44300976 CTGGGAGAGGGCCAGGAGACGGG + Intergenic
1107864946 13:44694473-44694495 TTTGGTCTGGGGTAGGAGCCAGG - Intergenic
1108068462 13:46603289-46603311 CAGGGTCAGGAGGAGGAAACTGG - Intronic
1110238185 13:73237968-73237990 CTAGGGCAGGGGAAGGAGCCCGG + Intergenic
1110350048 13:74496163-74496185 CTGGGTCAGGGGGTGGTGACAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110906367 13:80895673-80895695 ATGGATGAGGGGTAAGAGACAGG + Intergenic
1112618031 13:101025768-101025790 GTTGTTCAGAGGTAGGAGACCGG - Intergenic
1112635350 13:101211343-101211365 TAGGGTTAGGGGTAGGAAACAGG + Intronic
1112966735 13:105205929-105205951 CTGCGCCAGGGGTAGGACACAGG - Intergenic
1113199676 13:107852880-107852902 ATCGGTCAGAGGTAGGAAACAGG + Intronic
1114030350 14:18573049-18573071 CAGGGTCAGGGGTCAGAGTCAGG + Intergenic
1114405932 14:22456042-22456064 CTGGTTCAGGGGCTGGAAACTGG + Intergenic
1114615390 14:24065327-24065349 CTTGGGGTGGGGTAGGAGACTGG - Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116442192 14:44966087-44966109 GTGGGTCAGGAGTTTGAGACAGG - Intronic
1118058425 14:62107479-62107501 CAGGGTTAGGGGTTGGAGAATGG + Exonic
1118091774 14:62489072-62489094 CGAGGTCAGGAGTTGGAGACCGG + Intergenic
1118495536 14:66304967-66304989 CTGGGGCAGGGTTGGGGGACTGG + Intergenic
1119686610 14:76637630-76637652 CTGGGTGAGAGGAAGAAGACTGG + Intergenic
1119776695 14:77253474-77253496 CTGGGTATGGGGAAGGAGATGGG + Intronic
1120059085 14:79960519-79960541 ATGGAGCAGGGGGAGGAGACAGG + Intergenic
1121269988 14:92631563-92631585 GTGGGTCTGGGGTGGGACACAGG + Intronic
1121422109 14:93823604-93823626 CTGGGGCTGGGGCAGTAGACAGG + Intergenic
1122922307 14:104885110-104885132 CTGGGCCAGAGGCAGGAGCCAGG - Intronic
1123998336 15:25734150-25734172 CGGGGTCCGGTGCAGGAGACGGG - Intronic
1124627933 15:31320024-31320046 CTGGGTCAAAGGTCAGAGACAGG - Intergenic
1125310306 15:38372018-38372040 CTGGGGCTGGGGTAGGGGAATGG - Intergenic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1126163575 15:45635139-45635161 CTGGGCCAGCGGAGGGAGACTGG + Intronic
1126666165 15:51077790-51077812 CTTGGGCAGGGGGAGGAGCCTGG + Intronic
1126687198 15:51258670-51258692 CTGGCGCAGGGGTTGGAGATGGG - Intronic
1127959259 15:63878915-63878937 CTGGGTCAAGCGGAGGAGGCAGG + Intergenic
1128061214 15:64737029-64737051 CTGGGACAGGGGTGGGAGCGGGG - Intergenic
1128087838 15:64897997-64898019 CTGGGTCAAGGGTAGAAGCAGGG - Intronic
1128146417 15:65334648-65334670 CTGGGTGAGGAGTCTGAGACCGG + Intronic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1129253860 15:74323006-74323028 CTGGAGCAGGGGTAGGAGCGGGG - Intronic
1129354924 15:74983881-74983903 CTAAGTGAGGGGTTGGAGACCGG + Intronic
1129703686 15:77782683-77782705 CTGGGGAAGGGGTTGGAGAGTGG - Intronic
1130844002 15:87727122-87727144 CTGGGTCATGGGAAGAATACAGG - Intergenic
1130986994 15:88851107-88851129 GAGGGTCAGGGGTGGGAGGCTGG - Intronic
1131433551 15:92405313-92405335 CAGGGTCTGGGGAAGGAGAAGGG + Intronic
1131450179 15:92532860-92532882 CTGGTTTAGGGGTAGGCAACAGG - Intergenic
1132408591 15:101560263-101560285 CTGGGCCAGGGGTAGGGAAGGGG - Intergenic
1132567441 16:629976-629998 CTGGGTCAGAGGTCAGACACAGG + Intronic
1132641047 16:978732-978754 GTGGGGCAGGGATGGGAGACAGG + Intronic
1132712828 16:1276910-1276932 CGGGGTCAGGGGTGGGGGCCAGG + Intergenic
1132892800 16:2212585-2212607 CTGGGGTAGGGGTTAGAGACTGG - Exonic
1132978410 16:2721552-2721574 CCGGGTCGGGGGTGGGAGGCGGG + Intergenic
1134213430 16:12297125-12297147 CAGGGTTAGGGGTCGGAGGCTGG + Intronic
1135214355 16:20551955-20551977 CATGTTCTGGGGTAGGAGACAGG - Intronic
1135760298 16:25132629-25132651 ATGGGACAGGGGTGGGAGACAGG - Intronic
1136130786 16:28219644-28219666 CTGGGTCAGGAGTTTGAGACCGG + Intergenic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1136773258 16:32858760-32858782 CTGGGTCAGGGCCAGGACAAAGG - Intergenic
1136897357 16:34002759-34002781 CTGGGTCAGGGCCAGGACAAAGG + Intergenic
1137438484 16:48478208-48478230 CTGAGTCAGGAGTTTGAGACCGG + Intergenic
1137553692 16:49456897-49456919 CTGGGTCAGGAGTAGGTCCCAGG - Intergenic
1137896000 16:52213553-52213575 CTGGGTTTGGGGTAGGACATAGG - Intergenic
1138235648 16:55380185-55380207 CTGGGTCAGGGAGAGCAGAGGGG - Intergenic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1140354896 16:74297157-74297179 CTGGGGCAGGGGCGGGAGGCTGG - Intronic
1141463370 16:84191436-84191458 CTGGGGCAGGGGCCGGAGTCGGG + Exonic
1141576639 16:84968134-84968156 CAGGGGCCGGGGGAGGAGACGGG + Intergenic
1141819019 16:86432334-86432356 GAGGGTCAGAGGTGGGAGACGGG + Intergenic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203075680 16_KI270728v1_random:1120870-1120892 CTGGGTCAGGGCCAGGACAAAGG - Intergenic
1142486567 17:251347-251369 CTGGGAATGGGGGAGGAGACTGG - Intronic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1142593834 17:1020027-1020049 CTGGGCCAGGGGTCGACGACTGG + Intronic
1142681512 17:1551876-1551898 CTGGGTGACGGTGAGGAGACTGG + Intronic
1143327459 17:6108863-6108885 CCCTGTCAGGGGTAGGAGAGAGG - Intronic
1143351401 17:6290859-6290881 ATTGGCCAGGGGTAGGAGCCAGG - Intergenic
1143517924 17:7429292-7429314 CTGGGCCAGGGATAGGAGAAAGG - Intergenic
1143518143 17:7430167-7430189 CTGGGACAGGCATAGGAGCCTGG - Intergenic
1143906980 17:10216792-10216814 CCGGGGGAGGGGGAGGAGACAGG - Intergenic
1145710667 17:26971355-26971377 CGAGGTCAGGAGTTGGAGACTGG + Intergenic
1146403549 17:32519036-32519058 CTTGGTGAGAGGGAGGAGACGGG - Intronic
1146593622 17:34150896-34150918 CAAGGTCAGGAGTACGAGACCGG + Intronic
1146790068 17:35746002-35746024 CTTGGACAGGGGTTGGAGAACGG + Exonic
1146795023 17:35774654-35774676 TTGGCTCAGGGGTGGGAGAAGGG - Intronic
1148150941 17:45396178-45396200 CTGGGGCAGGGGTTGGGGACGGG + Intronic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149232148 17:54546951-54546973 CTGGGGCAGGGGTGGGAAAATGG - Intergenic
1149467893 17:56893900-56893922 CTGGGTCAAGGGCAGGACAGAGG + Intronic
1149996261 17:61407535-61407557 CTGGGCCAGGAGGAGGACACGGG - Intronic
1150124694 17:62628327-62628349 CTGGGGCAGAGCGAGGAGACTGG - Intronic
1150138144 17:62707040-62707062 CTGGGTCTGGGGTGAGGGACAGG - Intronic
1150790642 17:68198361-68198383 CTGGGTCAGGGTTGGGATGCGGG - Intergenic
1151703542 17:75755412-75755434 CTGGGGCTGGGGCAGGAGAGGGG + Intronic
1151973460 17:77471032-77471054 CTGGGGCAGGGCCTGGAGACGGG + Intronic
1152242576 17:79168025-79168047 CTGGGTGAGGGGTGGGTAACTGG + Intronic
1152580027 17:81161776-81161798 CAGGGTCAGGGTTGGGAGCCGGG + Intronic
1152637623 17:81436580-81436602 CTGGGGCGGGGGTAGGGGAGTGG - Intronic
1152743650 17:82029496-82029518 CTGGGCCAGGGACAGGAGAACGG + Intronic
1154415528 18:14173637-14173659 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1154498974 18:14984872-14984894 TAGGGTCAGGGGTTGGAGACAGG - Intergenic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1156367819 18:36446034-36446056 CTGGGTTAGGCTTTGGAGACAGG + Intronic
1156485352 18:37462187-37462209 CTGGGTCAGGGGTGGGCAAATGG - Intronic
1157114190 18:44847699-44847721 ATGGGACTGGGGTAGGAGAAGGG + Intronic
1157825685 18:50809969-50809991 GTGGGGCAGGGGTTTGAGACAGG + Intronic
1158353411 18:56589135-56589157 TTGGGTTAGGGGCAGGAGATGGG + Intergenic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160522106 18:79513679-79513701 CTGGGTCAGAGGGAGGAGACCGG - Intronic
1160748667 19:723368-723390 AGGGGTGAGGGGTGGGAGACAGG - Intronic
1161698867 19:5784407-5784429 CTGGGTCTGGGGGATGATACAGG + Exonic
1162337429 19:10070612-10070634 CTGGGGCAGAGGGTGGAGACTGG - Intergenic
1162968803 19:14168044-14168066 GTGGGTCAGGGGTGGGTGGCAGG - Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163082034 19:14951016-14951038 CAAGGTCAGGAGTTGGAGACCGG + Intronic
1163233971 19:16020476-16020498 CTGGGGCGGGGGTGGGGGACAGG + Intergenic
1163320517 19:16572084-16572106 CTGGGTCCGGGGCCCGAGACGGG + Exonic
1163544381 19:17932529-17932551 CTGGGGCGGGGCTAGGAGAGGGG - Intergenic
1163784528 19:19267926-19267948 GTGGGTCAGGGAAGGGAGACTGG + Intronic
1164616132 19:29667713-29667735 CTGTGTCCGGAGTAGGAGAGAGG + Intronic
1165069736 19:33248415-33248437 CTGGGTCTGCGGTAGGACAAGGG + Intergenic
1165175391 19:33925740-33925762 CTGGGTGAGGGATAGGAGGAAGG + Intergenic
1165856051 19:38879717-38879739 GTGGGTCAGGGGCAGGAGCAGGG + Intronic
1166118756 19:40672211-40672233 ATGGGCCAGGGAAAGGAGACAGG - Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166250841 19:41569950-41569972 CTGGGCCAGGGGGAGGAGCAGGG - Intronic
1166300045 19:41908081-41908103 CTGGGGCTGGGGAAGGAGACTGG + Intronic
1166338147 19:42121590-42121612 CTGGTCCAGGGGTAGCAGGCAGG - Intronic
1166379812 19:42350089-42350111 CTGGGGCAGGGGTCAGAGTCTGG - Intronic
1167124525 19:47540051-47540073 CTGGGTCGGGGGCTGGAGTCAGG - Intronic
1167249323 19:48392142-48392164 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167249336 19:48392177-48392199 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276689 19:48544036-48544058 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276740 19:48544182-48544204 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167279144 19:48556407-48556429 ATGAGTCAGGGTTAGCAGACGGG + Intronic
1167508738 19:49884567-49884589 TTGGGTCAGGGGTGGGACACAGG + Intronic
1167659098 19:50785604-50785626 CAGGGTCTGAGGTAGGAGAGTGG - Intergenic
1167748844 19:51368102-51368124 CCGGGTTGGGGGCAGGAGACGGG - Intronic
1168253546 19:55154927-55154949 CTGGGTCTGAGGGAGGAGAAGGG + Intronic
1168489387 19:56795434-56795456 CTGGGCCCGGGGTAGGATAGCGG - Intronic
925069551 2:956051-956073 CAGGGTCAGGGGTAGGGGCAGGG - Intronic
925222067 2:2149938-2149960 CTGGGTCAGGGCATGGAGAGTGG - Intronic
925769380 2:7267353-7267375 ATGGGACAGGGGTCGGAGATGGG + Intergenic
925819267 2:7783550-7783572 CTGGATGAGGGGAAAGAGACAGG + Intergenic
925946620 2:8870025-8870047 CAGGGTCTGTGGTGGGAGACTGG - Intronic
927179872 2:20437482-20437504 CTGGGTCAGGAATGGGATACTGG - Intergenic
927650810 2:24912649-24912671 CTGGGCCAGGGGTGGGTAACTGG - Intronic
928127311 2:28625656-28625678 TAGGGTCGGGGGAAGGAGACTGG - Intronic
928996475 2:37297394-37297416 CTGGGTATGGGGTAGTATACAGG - Intronic
929033912 2:37672647-37672669 CTGGGGAAGGAGTAGGCGACAGG + Intronic
929925375 2:46202881-46202903 CTTGGGCAGGGCTAGGAGAAGGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931883702 2:66593037-66593059 GTGGCCCAGGGGTTGGAGACTGG - Intergenic
932210729 2:69927559-69927581 CAGGGTCCCAGGTAGGAGACTGG - Intronic
932539133 2:72633243-72633265 CTGGGATAGGGGTAGGAGGTTGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934651334 2:96092761-96092783 CTGGGACAGGCTTAGAAGACAGG + Intergenic
938497938 2:131812959-131812981 TAGGGTTAGGGGTTGGAGACAGG - Intergenic
941612329 2:167677067-167677089 CTGGGTGAGGGGTAGGAAAAAGG + Intergenic
943395467 2:187327941-187327963 CTGGGTAATGAGTAGAAGACTGG + Intergenic
946875706 2:224127605-224127627 CTGGTTCATGGGTAGGACACAGG - Intergenic
947660923 2:231867165-231867187 CTAGGTCAGGAGTTCGAGACTGG - Intergenic
948502398 2:238405126-238405148 CTGGGAAGGGAGTAGGAGACAGG + Intergenic
948757947 2:240170032-240170054 CTGGGGCAGAGGTGGGAGAAGGG - Intergenic
948845426 2:240680668-240680690 CTGGGTCAGGGGCAGCAGCTTGG + Intronic
948848435 2:240694211-240694233 CTGGGTCAGGGGCAGCAGCTTGG - Intronic
1170576742 20:17668805-17668827 CTGGGACAGGGGTAGGGGTGCGG - Intronic
1170625386 20:18026354-18026376 GTGGGTCTGGGGTAGGAATCAGG + Intronic
1170898126 20:20435004-20435026 CTGGGCATGGGGTAGGACACAGG - Intronic
1172094621 20:32454599-32454621 CCGAGGCAGGGGCAGGAGACAGG - Intronic
1172765973 20:37351077-37351099 CTGAGTCAGGGATAGATGACCGG + Intronic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173022062 20:39274984-39275006 TGGGGTGAGGGGTAGGAGATAGG - Intergenic
1173043716 20:39489961-39489983 CTGGCTCAGTGGGAGGAGAGAGG + Intergenic
1174475844 20:50795163-50795185 CTGGGGCCGAGGTAGGGGACGGG + Exonic
1174745214 20:53055333-53055355 CAGGTTCAGAGTTAGGAGACAGG + Intronic
1175100455 20:56575387-56575409 CTGGGTCCGAGGAAGGAGGCAGG - Intergenic
1176115312 20:63429515-63429537 CTGGGGCAGAGGGAGGACACGGG - Intronic
1176176497 20:63728831-63728853 CTGACTCAGGAGTAGGAGCCAGG + Intronic
1176278365 20:64286977-64286999 CGGGGTCAGGGGTCGGGGTCAGG + Intronic
1176857792 21:13985631-13985653 CTGGGTCAGGGCCAGGAGCAAGG - Intergenic
1176866798 21:14058558-14058580 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1177412555 21:20749245-20749267 CTGAGGGAAGGGTAGGAGACAGG - Intergenic
1177779417 21:25607171-25607193 CGGGGCCAGGGGTCGGAGCCAGG - Intronic
1178637389 21:34316225-34316247 CAGGGTTGGGGGTAGGGGACTGG + Intergenic
1179344852 21:40546908-40546930 CTGGGGCTGGGGTGGGAGCCTGG + Intronic
1179789340 21:43747465-43747487 CTGGGTCAGTGGTTGAAGTCAGG + Intronic
1180285661 22:10742214-10742236 CTGGGACCGGGGCAGGTGACCGG + Intergenic
1180454465 22:15500106-15500128 CAGGGTCAGGGGTCAGAGTCAGG + Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180537040 22:16403052-16403074 CAGGGTCAGGGGTCGGGGTCAGG - Intergenic
1180881778 22:19209375-19209397 CTGGGCCGGGGGTAGGACATGGG + Intronic
1181164411 22:20975782-20975804 CAGGGTCAAGGGTGGGAAACAGG + Intronic
1182072803 22:27475466-27475488 CTGGTTCAGAGGTGGGAGAGGGG + Intergenic
1182457541 22:30461484-30461506 CAGGGGGAGGGGGAGGAGACAGG + Intronic
1182692768 22:32175586-32175608 CTGGACCAGGGCTAGGAGAAAGG - Intergenic
1183095430 22:35549147-35549169 CCGGGGCAGGGGCAGGAGCCTGG - Intronic
1183313578 22:37124876-37124898 CTGGGTCAGATTCAGGAGACAGG - Intergenic
1183428051 22:37750242-37750264 CTGGGCCAGGGCTGGGAGATTGG - Intronic
1183984760 22:41563279-41563301 CTGGGGGAGGGGGAGGAGCCAGG + Intronic
1183985619 22:41568683-41568705 CTCAGGCAGGGGCAGGAGACAGG - Intronic
1184046588 22:41976260-41976282 CTGGGTCTAGTGGAGGAGACAGG - Intronic
1184058566 22:42068149-42068171 CTGGGTCAGGGGAAGTACAGGGG + Intronic
1184149031 22:42627958-42627980 CTGGCACAGGGGTTGCAGACAGG - Intronic
1184491065 22:44809372-44809394 CTGGACCAGGGGTGGGAGAATGG - Intronic
1184574431 22:45350886-45350908 CAGGCACAGGGCTAGGAGACTGG - Intronic
1184698379 22:46151727-46151749 CTGGGTCAGGGCAAGGACACGGG + Intronic
1185213912 22:49587616-49587638 CTCAGTCAGGGGTGGGAGCCAGG - Intronic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
950421703 3:12903413-12903435 CCTGGCCAGGGGCAGGAGACAGG + Intronic
952931512 3:38364515-38364537 CTGGGTCGGGGGTGGGTGATGGG - Intronic
954197290 3:49004284-49004306 CTGGAGCAGGGGGAGAAGACTGG + Intronic
954611083 3:51944907-51944929 CTGGGTGAGGGGTGAGAGGCAGG + Exonic
955295744 3:57733380-57733402 CAAGGTCAGGAGTTGGAGACTGG + Intergenic
957889153 3:86332653-86332675 CTGAGTCAGGAGTATGAGAGTGG + Intergenic
959095539 3:101951395-101951417 GTGGGGCAGGGGTAGGGGAGTGG + Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
960385024 3:117012514-117012536 ATGGGTCAGGGGTCGGAGCTGGG - Intronic
960433685 3:117600221-117600243 GTGAGACAGGGGGAGGAGACAGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960962902 3:123084499-123084521 CGGGCTCAGAGGGAGGAGACAGG - Intronic
961404221 3:126667371-126667393 CTGGGACAGGGGTGGGAGATGGG - Intergenic
961543638 3:127617427-127617449 CTGGGGCTGGGGTGGGACACAGG + Intronic
961593270 3:127996516-127996538 CTGGGCTGGGGGTGGGAGACAGG + Intergenic
961939743 3:130624729-130624751 CTTGGTCAGGGGTCGGGGGCAGG + Intronic
962358286 3:134713652-134713674 CTTGGTCTGGGGTATGAGATTGG + Intronic
962988470 3:140557439-140557461 CAGGCTTAGGGGTAGGAAACAGG + Intronic
966088054 3:176094271-176094293 CCTGTTGAGGGGTAGGAGACTGG + Intergenic
967119599 3:186371185-186371207 CTGCGTCAGGTGTGGGAGAATGG + Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968862658 4:3184894-3184916 CTGGGGCAGGGGGAGTAGGCAGG + Intronic
969472899 4:7400147-7400169 CTGGGGATGGGGTAGGAGCCGGG - Intronic
969871860 4:10109703-10109725 CTGGGTGGGGAGTAGGAGAGGGG - Intronic
970318689 4:14854515-14854537 CTGGCTCTAGGGTAGGAGGCAGG - Intergenic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
970896884 4:21114054-21114076 CTGAATCAGGGATAGGAAACAGG - Intronic
973398225 4:49615530-49615552 GTGTGTCAGGGGCAGAAGACAGG + Intergenic
973554383 4:52067478-52067500 CTGGGTCAGGGGAAAGTGACAGG - Intronic
977077035 4:92467617-92467639 CTAGAACAGGGGTAGGGGACAGG + Intronic
977531806 4:98209162-98209184 CTAGGCCAGGAATAGGAGACAGG - Intergenic
977621521 4:99142830-99142852 CAGGGTTGGGGGTAGGAGAGAGG + Intronic
980501333 4:133658056-133658078 ATGGATTAGGTGTAGGAGACAGG + Intergenic
981636446 4:146886331-146886353 CTGAGTCAGTGGGAAGAGACAGG - Intronic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
981913109 4:150005273-150005295 ATGGGACAGAGGTAGGAGTCTGG - Intergenic
981961445 4:150544529-150544551 GGGGGTCAGGGATAGGAGAAGGG - Intronic
982061551 4:151609196-151609218 CTGGGTCAGAGGTAGAACAGTGG - Intronic
984743106 4:183186651-183186673 CTGGGGTAAGGGCAGGAGACTGG + Intronic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985722388 5:1496553-1496575 CAGGTTCAGGGGCAGGAGAGAGG + Intronic
985792195 5:1935331-1935353 CTGGGTCTGGTGTAGGAGGATGG - Intergenic
985821598 5:2164259-2164281 CTGGGGCAGGCGTGGGTGACGGG - Intergenic
988466478 5:31496981-31497003 CTGGGTCATGGTTAGGACAGTGG - Intronic
990181931 5:53170789-53170811 CTAGGTGAGGGGGAGGAGAAGGG - Intergenic
991669983 5:69037880-69037902 CGGGGTCAGGAGTTCGAGACCGG + Intergenic
993066512 5:83105382-83105404 CTGGGGCAGAGGAAGGAGATTGG + Intronic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
995227394 5:109716936-109716958 CGGGGTCAGGGGTGGGGGAAGGG - Intronic
997413440 5:133707537-133707559 CTGGGTCAGGAACAGGAGCCTGG + Intergenic
998148615 5:139744680-139744702 CTGGGTCTGGGGCAGGAGCGGGG - Intergenic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
1000260827 5:159586976-159586998 ATGGGTCTGGGGCAGGTGACTGG - Intergenic
1001317319 5:170653042-170653064 CTGGGTCGGGGGAAGGAGCGAGG + Intronic
1001540574 5:172534843-172534865 CTGGATCAGGGGTGGGCGAAAGG - Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002514468 5:179746962-179746984 CTGTTTCAGGGGTAGGCGGCTGG - Intronic
1002518525 5:179776702-179776724 CGGGGACAGGGGTGGGAGACGGG - Exonic
1003616640 6:7660557-7660579 CTGGGTCACTGGTAGGAAAGGGG - Intergenic
1005958801 6:30682470-30682492 CTGGCTCAGGAATAGGAGATAGG - Intronic
1006365783 6:33614373-33614395 CTGGGGCCGGGGAAGGGGACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006839447 6:37019119-37019141 CTGGGTCAGGGAGAGGGGAAAGG - Intronic
1007400517 6:41600010-41600032 CTGGGGCCGGGGTGGGAGACTGG - Exonic
1007585197 6:42984942-42984964 CTGGGCCGGGGGTAAGAGAAGGG - Intronic
1007751883 6:44076052-44076074 CGGGGACAGGGGGAGGAGAGGGG + Intergenic
1009751757 6:67885180-67885202 CTGGGTCAGGGATAGGGAAAAGG + Intergenic
1011763969 6:90599023-90599045 CTGAGTGAGGGGCTGGAGACTGG + Intergenic
1011787448 6:90862734-90862756 CTGGGTTAGGGGTTGGACAAAGG - Intergenic
1014453506 6:121610402-121610424 CGGGGTCAGGGGTAGGGGTGTGG - Intergenic
1015559421 6:134498451-134498473 CTGGGTGAGGAGGAGGACACTGG + Intergenic
1015971902 6:138750938-138750960 ATAGCTCAGGGGTAGGAGAAAGG - Intronic
1016201302 6:141412773-141412795 CTGGGTTAGAGATAGGAGTCTGG - Intergenic
1016870007 6:148807562-148807584 GCAGGTCAGGAGTAGGAGACAGG + Intronic
1020066259 7:5190501-5190523 CGGGGTCGGGGGTCGGAGTCGGG + Intronic
1020089068 7:5327877-5327899 CAGGGTCAGTGGCAGGAGACAGG + Intronic
1023412963 7:39905639-39905661 CTGGGTCAGGAGTTTGAGACTGG - Intergenic
1023819727 7:43973866-43973888 CTGGGGCAGGCGTAGAACACTGG + Intergenic
1023880553 7:44318084-44318106 CTGGGCAAAGGGTAGGAGTCTGG - Intronic
1024442934 7:49442769-49442791 CTGGGTGGGGGGTGGGAGAGGGG - Intergenic
1024461280 7:49662088-49662110 ATGGTTCAGAGGAAGGAGACAGG - Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1024980960 7:55157117-55157139 AGGGGACAGGGGTAGGTGACAGG + Intronic
1025205245 7:56989269-56989291 CAGGGTCAGTGGTGGGAGACAGG - Intergenic
1025666693 7:63587665-63587687 CAGGGTCAGTGGTGGGAGACAGG + Intergenic
1026929410 7:74215529-74215551 CAGGGTTAGGGGCAGGACACTGG + Intronic
1029371637 7:100154565-100154587 CTGTCTCAGGGGTTGGGGACAGG - Exonic
1029528525 7:101109994-101110016 CTGGGTTGGGGATAGGGGACAGG + Intergenic
1029748000 7:102527319-102527341 CTGGGGCAGGCGTAGAACACTGG + Intergenic
1029765949 7:102626414-102626436 CTGGGGCAGGCGTAGAACACTGG + Intronic
1032373629 7:131386226-131386248 CAAGGTCAGGGGTTTGAGACCGG - Intronic
1032501075 7:132400378-132400400 CTGGGTGACAGGTAGGAGACAGG - Intronic
1035613029 8:981077-981099 CAGGGTCTGGGGCAGGGGACAGG - Intergenic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037901515 8:22692026-22692048 CTGGGGCCGGGGTAGGTGAAGGG - Intronic
1039631306 8:39114397-39114419 CTGGGTCAGGTGTAGGAACCAGG + Intronic
1039695312 8:39904410-39904432 CTGGGTCAGGAGTTTGAGACCGG - Intronic
1040466903 8:47703869-47703891 GTGTGTCAGGGAGAGGAGACGGG + Intronic
1041326546 8:56672316-56672338 CTGGGTCAGAGTTAGGGAACTGG + Intergenic
1041711152 8:60895664-60895686 CTGGCTCAGGGGCACAAGACTGG - Intergenic
1043659817 8:82724655-82724677 CTGGGTGAAGGTTAGAAGACAGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1045040452 8:98219042-98219064 CAGGATCAGGGGTAGGAGTGAGG + Intronic
1047253346 8:123197107-123197129 CTGGGGCAGGGGTGGCAGAAGGG + Intronic
1047614602 8:126553927-126553949 CTGGGACAGAGGAAGAAGACGGG + Exonic
1048131846 8:131706267-131706289 CTTGGTCATGGGTAGCACACAGG - Intergenic
1048632911 8:136263651-136263673 CTGGGTGAAGGGTACGAGACAGG + Intergenic
1048865348 8:138756819-138756841 CTCGGGCAGGGATGGGAGACAGG - Intronic
1049359069 8:142203285-142203307 CTGGGACAGGGGTAGGGGCAGGG + Intergenic
1049609751 8:143549230-143549252 GAGGGTCAGTGGTAGGAAACCGG - Intergenic
1049761885 8:144335507-144335529 CTGGGTCAGGGAGAGGAAGCAGG - Intronic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1052743150 9:32413682-32413704 CTGGGTAAGGGGTGGTAGAGTGG + Intronic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053101835 9:35377730-35377752 CTGGGCTATGGGGAGGAGACTGG + Intronic
1054351220 9:64017874-64017896 CAGGGTCAGGGGTTGGGGTCTGG + Intergenic
1055190788 9:73521178-73521200 CGAGGTCAGGGGTTTGAGACAGG - Intergenic
1055646192 9:78363670-78363692 CTGAGTTAGGGGTCAGAGACAGG - Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1056101474 9:83304239-83304261 TTGGGTCTGGGGTAGGATGCAGG + Intronic
1056220710 9:84448310-84448332 CAGAGTCAGAAGTAGGAGACAGG + Intergenic
1056468306 9:86880441-86880463 CTGGGTAACGTGTAGGACACGGG - Intergenic
1057048337 9:91902941-91902963 CAGGGTCTGGGGGAGGAGATGGG + Intronic
1057068469 9:92075922-92075944 CTGGGTCAGGGACAGGAAAAAGG - Intronic
1057225290 9:93289653-93289675 CTGGGTCAGGGGCCGGAGCCCGG + Intronic
1057316105 9:93969382-93969404 CTGGGGCTGGGGGAGGAGGCTGG + Intergenic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1057563034 9:96143495-96143517 CAAGGTCAGGGGTTCGAGACAGG - Intergenic
1059683218 9:116606310-116606332 TGGGGGCAGGGGTAGGAGACAGG + Intronic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060204468 9:121674421-121674443 CTGGGTGTGGGCTGGGAGACTGG + Intronic
1060493625 9:124102307-124102329 CCAGGCCAGGGGTAGGACACAGG - Intergenic
1060724085 9:125995882-125995904 CTGGGTCCTGAGTAGGAGCCTGG + Intergenic
1061044485 9:128157468-128157490 CTGGGACAGGGGCAGGACAGGGG - Intergenic
1061208114 9:129176059-129176081 CTGGGTAAGGGGTGGGGGGCGGG - Exonic
1061668800 9:132176346-132176368 CAGGGGCAGGGGAAGGAGATGGG - Intronic
1061953296 9:133948468-133948490 CCAGGTCAGGGGCAGGCGACTGG + Intronic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1062396712 9:136355540-136355562 CTGGGGGAGGGGTAGCCGACAGG + Intronic
1062561604 9:137144673-137144695 TGGGGACAGGGGTGGGAGACAGG + Intronic
1185764557 X:2715133-2715155 CTGGGTGAGGAGCGGGAGACAGG - Intronic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189715898 X:43865905-43865927 CTAGGTCAGGGGTGGGAGGGAGG + Intronic
1190030085 X:46963674-46963696 CTGGGGCAGTGGTAGGAGGTAGG + Intronic
1190290622 X:48989754-48989776 CAGGGGCAGAGCTAGGAGACTGG - Intronic
1191060077 X:56285840-56285862 TGGGGTCAGGGGTAGGGGAGGGG + Intronic
1192332468 X:70187451-70187473 CTAAGCCAGGGTTAGGAGACTGG + Intronic
1192631867 X:72783368-72783390 CAAGGTCAGGGGAAGGAGCCGGG + Intronic
1192649842 X:72937433-72937455 CAAGGTCAGGGGAAGGAGCCGGG - Intronic
1193648181 X:84094080-84094102 CTGGGTTAGTAATAGGAGACTGG + Intronic
1195311092 X:103632567-103632589 CTGGGTCTGGCGTAGAAAACGGG - Intergenic
1196940018 X:120766341-120766363 CTGGGTCAGGGGTTGGGGCAGGG + Intergenic
1197153988 X:123250122-123250144 CTGGGGCAGGGGTAGCAGGGAGG + Intronic
1197221828 X:123921758-123921780 CAAGGTCAGGAGTTGGAGACTGG - Intergenic
1197715244 X:129701750-129701772 CTGGGCCAGGGGTTGGTCACTGG - Intergenic
1197892835 X:131282968-131282990 CTGGGTGACTGGTAAGAGACGGG - Exonic
1198175245 X:134148397-134148419 CTGGTTCTGAAGTAGGAGACAGG + Intergenic
1198815082 X:140580814-140580836 CTGGCTCAGGGGTAGCTGAAGGG - Intergenic
1199365909 X:146982821-146982843 CTGGGTAAGGGGTAAGACAATGG - Intergenic
1199982435 X:152928368-152928390 TCAGGTCAGGGGTGGGAGACCGG + Intronic
1199987073 X:152960175-152960197 CTGGGTCAGGGGAGGGATATAGG + Intronic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1202583697 Y:26404789-26404811 CTGGGTCAGGGCTAGGAACAAGG + Intergenic