ID: 1172931561

View in Genome Browser
Species Human (GRCh38)
Location 20:38589759-38589781
Sequence CTGGATAGAAGCACACTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172931561_1172931563 -5 Left 1172931561 20:38589759-38589781 CCCACAAGTGTGCTTCTATCCAG No data
Right 1172931563 20:38589777-38589799 TCCAGAGAACACATTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172931561 Original CRISPR CTGGATAGAAGCACACTTGT GGG (reversed) Intergenic
No off target data available for this crispr