ID: 1172933861

View in Genome Browser
Species Human (GRCh38)
Location 20:38605159-38605181
Sequence TACCCACAGCTCTCCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172933860_1172933861 -7 Left 1172933860 20:38605143-38605165 CCGGATCTGTTCTGTTTACCCAC 0: 1
1: 0
2: 1
3: 9
4: 191
Right 1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG 0: 1
1: 0
2: 1
3: 26
4: 355
1172933859_1172933861 -6 Left 1172933859 20:38605142-38605164 CCCGGATCTGTTCTGTTTACCCA 0: 1
1: 0
2: 2
3: 23
4: 181
Right 1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG 0: 1
1: 0
2: 1
3: 26
4: 355
1172933858_1172933861 9 Left 1172933858 20:38605127-38605149 CCTTCAGGATGTAAGCCCGGATC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG 0: 1
1: 0
2: 1
3: 26
4: 355
1172933855_1172933861 24 Left 1172933855 20:38605112-38605134 CCAGCAGGACGGCAACCTTCAGG 0: 1
1: 0
2: 2
3: 14
4: 120
Right 1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG 0: 1
1: 0
2: 1
3: 26
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172933861 Original CRISPR TACCCACAGCTCTCCAGCAC TGG Intronic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
900730641 1:4256972-4256994 TAGCCACAGCACTCCAGCCTGGG - Intergenic
901576452 1:10204994-10205016 TAGCCACTGCACTCCAGCCCAGG - Intergenic
902519342 1:17007202-17007224 AGGCCACAGCTCTACAGCACAGG - Intronic
902684667 1:18068155-18068177 TACCCACAGCTCTTTAGCATTGG - Intergenic
902833356 1:19032174-19032196 CACCCACCGCTTTCCAGCAAGGG + Intergenic
903754371 1:25650589-25650611 TAACCAAATCTCTCCAGCAAGGG + Intronic
904164600 1:28545747-28545769 CACCCACTGCACTCCAGCCCGGG - Intergenic
907027214 1:51132203-51132225 GACCATCAGCTCTCCAGCAAAGG + Intronic
907170825 1:52462588-52462610 TCCCAACAGCTCTGCAGGACAGG - Intronic
908916904 1:69138588-69138610 ATCCCTCAGCTCTTCAGCACTGG + Intergenic
909208517 1:72791990-72792012 AACCCACAACTTTCCAGCATGGG + Intergenic
912341736 1:108922961-108922983 TAGCCACTGCACTCCAGCATGGG + Intronic
914756727 1:150566585-150566607 TAGCCACCGCCCTCCAGCATGGG - Intergenic
914757057 1:150568994-150569016 TAGCCACTGCTCTCCAGCATGGG - Intergenic
914861473 1:151389785-151389807 TAGCCACTGCTCTCCAGCTTGGG + Intergenic
914875209 1:151508462-151508484 TAGCCACAGCACTCCAGCCTGGG - Intergenic
914900414 1:151708520-151708542 AACTCACAGCTCTCCAGCAAAGG - Intronic
915075452 1:153304902-153304924 TGTACACAACTCTCCAGCACAGG + Intronic
915132346 1:153704340-153704362 TAACCACTGCACTCCAGCTCGGG + Intergenic
915950958 1:160189759-160189781 AACCCACATCTCTACAGGACAGG + Intergenic
916213523 1:162377115-162377137 TACCCCCAGCCCTCCAGCCCTGG + Intronic
916848899 1:168683283-168683305 TAACAACAGTTCTCCAGCAAGGG - Intergenic
918470051 1:184862346-184862368 TAGCCACAGCACTCCAGCCTGGG - Intronic
918746302 1:188204506-188204528 TTCCCCCATCTCTCCATCACTGG + Intergenic
919220782 1:194625535-194625557 TCGCCACATCTCTCCAGCAAGGG + Intergenic
919630368 1:199954876-199954898 TTCCCTCTGCTCTCCAGCAGGGG + Intergenic
919739416 1:200973167-200973189 TCCCCACAGGGCTCCACCACTGG + Intronic
919814407 1:201428550-201428572 TCCACCCAGCTCTCCCGCACAGG + Intronic
920953918 1:210599958-210599980 TAGCCTCAGCTCCCCAACACAGG + Intronic
921725509 1:218519144-218519166 TACCTACATCTTTTCAGCACTGG + Intergenic
922894322 1:229088608-229088630 TACACACAGCTCTGCCGCACAGG + Intergenic
923098403 1:230793498-230793520 TGCCGACAGCCATCCAGCACCGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924065585 1:240218512-240218534 TACCCACTGCCCTCCAGCCTAGG + Intronic
924434361 1:244025772-244025794 TAACCACTGCTCTCCAGCCTGGG - Intergenic
924519918 1:244796864-244796886 TACCCACTGCACTCCAGCATGGG + Intergenic
924713557 1:246551548-246551570 TAGCCACAGCACTCCGGCAGGGG + Intronic
1063416216 10:5874578-5874600 GACCCCCAGCTTTCCAACACAGG + Intronic
1063685159 10:8229982-8230004 TAGCCACAGCACTCCAGCCAGGG + Intergenic
1063707759 10:8447344-8447366 TCCGCACCTCTCTCCAGCACTGG + Intergenic
1064939386 10:20715513-20715535 TACACACTGCACTCCAGCCCAGG + Intergenic
1065010133 10:21413429-21413451 TCCCCACAGCGTTCCAGCTCTGG - Intergenic
1065423355 10:25572458-25572480 TAGCCACTGCACTCCAGCATGGG + Intronic
1065715313 10:28561260-28561282 CAGCTACAGCTCTCCAGAACTGG + Intronic
1065872524 10:29967654-29967676 TGCCCACAGCACTCCAGCCTGGG + Intergenic
1068518931 10:58058048-58058070 TCACAACAGCTCTCCAGCAAGGG + Intergenic
1068874159 10:61979150-61979172 CACCCAAACCTCTGCAGCACTGG + Intronic
1069864464 10:71493013-71493035 TGCCCACAGCTGTACAGCATGGG - Intronic
1070270963 10:74954501-74954523 TTCCAACAGCTGTCCAGCAATGG - Intronic
1070497768 10:77039927-77039949 GACCCACTGCACTCCAGCCCAGG - Intronic
1071320522 10:84451310-84451332 TAGTCACTGCACTCCAGCACAGG - Intronic
1071766769 10:88675209-88675231 AACCTACAGCACTCTAGCACTGG + Intronic
1073755083 10:106572778-106572800 TACCCAGATCTCTCCAGCACAGG + Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1076110130 10:127853872-127853894 TCCCCACTGCCCTCCTGCACAGG - Intergenic
1081939228 11:46926663-46926685 TAGCCCCTGCTCTCCAGCCCGGG - Intergenic
1082015495 11:47483220-47483242 TTCCCACTGCACTCCAGCCCAGG + Intronic
1082732259 11:56814342-56814364 CACCCAGAGATCTCCAGCACTGG + Intergenic
1082804106 11:57436346-57436368 GACCCACACCTCTCCTGCTCCGG - Intergenic
1083057227 11:59834432-59834454 TGCCCACTGCTCTCCAGCCTGGG - Intronic
1083225209 11:61280786-61280808 TACCCACCTCGCACCAGCACTGG + Exonic
1083479700 11:62936005-62936027 CAGCCACTGCTCTCCAGCATGGG - Intergenic
1083742141 11:64716692-64716714 AGCCCACAGCTCTGCAGCAGAGG + Intronic
1084683303 11:70679571-70679593 GACCCACTTCTCCCCAGCACAGG - Intronic
1085322762 11:75584677-75584699 TAGCCACTGCACTCCAGCCCGGG - Intergenic
1085850196 11:80110449-80110471 TAGCCACACTTCTCCAGCAAGGG + Intergenic
1087437217 11:98136474-98136496 CACACACAGCCCTCCAGCAAAGG - Intergenic
1089282023 11:117381381-117381403 TCCCCAGAGCTCACCAGCACTGG - Intronic
1089704503 11:120267945-120267967 TTCACATAGCTCTCCAGGACTGG - Intronic
1089847664 11:121471151-121471173 TCCCCACGTCTCTCCAACACAGG - Intronic
1090787492 11:130062827-130062849 TAGCCACAGCACTCCAGCCTGGG + Intergenic
1092112336 12:5972501-5972523 TAACCACAGCTGTTCAGGACGGG + Intronic
1092748481 12:11695732-11695754 CACCCCTAGGTCTCCAGCACTGG - Intronic
1094175082 12:27533043-27533065 TAGCCACTGCTCTCCAGCCTGGG - Intronic
1095205606 12:39436481-39436503 TAGCCACAGCACTCCAGCCTGGG - Intronic
1095587246 12:43862921-43862943 TACGCACTGCACTCCAGCCCGGG + Intronic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1096398456 12:51285412-51285434 TACCCACTGCACTCCAGCCTGGG + Intronic
1096978141 12:55712054-55712076 TTCACTCACCTCTCCAGCACTGG + Intronic
1097662348 12:62445088-62445110 TTCACACAGCTCTCCAGTAATGG - Intergenic
1098193502 12:67976095-67976117 TCACAACAGCTCTCCAGCAAGGG - Intergenic
1099210546 12:79782580-79782602 TGTCCAGAGCTCTCCAGTACAGG - Intronic
1100675015 12:96856949-96856971 TACTCACAGTTCTGCAGGACTGG + Intronic
1102767170 12:115443506-115443528 TATCTACAGATCTGCAGCACGGG + Intergenic
1103946311 12:124528643-124528665 CACCCTCATCTCTCCAGCAGAGG + Intronic
1105679185 13:22707832-22707854 TAGCTACAGCTCTCCAAAACTGG - Intergenic
1105715027 13:23055148-23055170 TCCCCACTGCACTCCAGCATGGG - Intergenic
1106325048 13:28680931-28680953 TACCCACTGCACTCCAGCCTGGG - Intergenic
1106457113 13:29937193-29937215 TAACCACAGTTCACCAGCCCAGG + Intergenic
1107323904 13:39219461-39219483 TAGCCACTGCTCTCCAGCCTGGG + Intergenic
1108031241 13:46231856-46231878 TTGCCACAGCTCTCCAGCCTGGG - Intronic
1108237536 13:48423878-48423900 TAGCCACAGCACTCCAGCCTGGG + Intronic
1108385673 13:49897171-49897193 TAGCCACCGCACTCCAGCACAGG - Intergenic
1108887758 13:55209388-55209410 TTGCCACTGCACTCCAGCACGGG - Intergenic
1110205767 13:72911144-72911166 TACCCACTGCACTCCAGCCTGGG + Intronic
1110209172 13:72952481-72952503 TCACAACAGCTCTCCAGCAGTGG - Intronic
1110606046 13:77433981-77434003 TAGCCACAGCACTCCAGCCCGGG - Intergenic
1110849217 13:80225004-80225026 TGCTCACTGCTCTCCAGCCCGGG - Intergenic
1111915108 13:94352377-94352399 TATCCTCAGCCCTCCAGCAATGG - Intronic
1112434377 13:99381214-99381236 TACACACAGGTCACCAACACAGG - Intronic
1112780155 13:102891731-102891753 AAGCCACAGCACTCCAGCCCGGG - Intergenic
1113755937 13:112810902-112810924 TAGCCACTGCTCTCCAGCCTGGG + Intronic
1115040038 14:28912825-28912847 TACACACAGCTATCCAGCTTGGG - Intergenic
1115659268 14:35475630-35475652 TCCCCACTGCACTCCAGCCCAGG - Intergenic
1117942874 14:60987739-60987761 AACCCACAGCTCCCCTCCACTGG + Intronic
1118264379 14:64280497-64280519 TACCCACAGGTCTGAACCACAGG + Intronic
1119135448 14:72214216-72214238 CACCCACTGCTCTCCAGCCTGGG - Intronic
1120612129 14:86655043-86655065 TACCCAGCACTCTCCAACACAGG + Intergenic
1121649511 14:95547463-95547485 TGCCCTCAGCTCACCTGCACTGG - Intergenic
1121706919 14:96003060-96003082 TTGCAACAGCTCTCCAGCAGGGG + Intergenic
1122293819 14:100693939-100693961 TACCCACCCCTCCCAAGCACTGG + Intergenic
1122851950 14:104538820-104538842 TAGCCACTGCACTCCAGCCCGGG - Intronic
1123449901 15:20352971-20352993 AACCCACTGCACTCCAGCCCGGG - Intergenic
1124106792 15:26745615-26745637 TACCCACACCCCTCCTCCACTGG + Intronic
1127502379 15:59566562-59566584 TAGCCACAGCACTCCAGCCTGGG - Intergenic
1129334136 15:74842532-74842554 TACCTACTGCACACCAGCACCGG + Intronic
1130560113 15:84951381-84951403 GACCCACTGCACTCCAGCTCAGG + Intergenic
1130948190 15:88565152-88565174 TAGCTACAGCACTCCAGCCCGGG - Intergenic
1131075078 15:89490346-89490368 GACCCACAGCTCTCCCACACTGG - Intronic
1131213285 15:90516254-90516276 TAGCCACTGCTCTCCAGCCTGGG + Intergenic
1131616256 15:94019971-94019993 TAGCCATAGCTCTCCAGCCTGGG - Intergenic
1132439205 15:101841949-101841971 GCCCCACAGCCCTCCAGCCCTGG + Intergenic
1133387205 16:5379413-5379435 GAGCCACAGCTCTCCACCCCAGG - Intergenic
1134284871 16:12852048-12852070 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1134390061 16:13811268-13811290 CACCCACAGCACTCCAGCCTGGG + Intergenic
1136111630 16:28067126-28067148 GAACCACAGCACTCCAGCCCGGG + Intergenic
1137635381 16:49981531-49981553 TAGCCACAGCACTCCAGCCAGGG + Intergenic
1138006405 16:53341828-53341850 GAGCCACTGCTCTCCAGCCCAGG + Intergenic
1138573938 16:57894556-57894578 TAACCACTGCACTCCAGCCCAGG + Intronic
1138693365 16:58789479-58789501 TACCCACTGCACTCCAGCCTGGG - Intergenic
1138832409 16:60390508-60390530 GCACCACAGCTCTCCAGCATGGG + Intergenic
1139251328 16:65499259-65499281 TACCAACAGCTCACCAGAGCTGG - Intergenic
1139419006 16:66837050-66837072 TAGCCACTGCTCTCCAGCCTGGG - Intronic
1139559218 16:67730998-67731020 TACCCTCTGCTCCCCACCACTGG - Intronic
1140073100 16:71670233-71670255 TACACTCAGATCTCCAGCCCAGG - Intronic
1140913281 16:79472880-79472902 TACCCAAATCTCTCCAGGACAGG - Intergenic
1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG + Intergenic
1141538786 16:84701978-84702000 TAACCACAGCACTCCAGCCTGGG - Intronic
1141562520 16:84878986-84879008 AATCCACAGGTCTCCAGCCCAGG - Intronic
1142169203 16:88611688-88611710 AACCCAGAGCTCTCCAACGCAGG + Intronic
1142654759 17:1384159-1384181 CAGCCACTGCTCTCCAGCATGGG + Intronic
1143386704 17:6535223-6535245 TGCCCTCTGCTCTCCAGCCCAGG - Intronic
1144473291 17:15563294-15563316 TACCCACAGCCCTCCACTCCCGG + Intronic
1144569931 17:16391035-16391057 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1144620606 17:16816108-16816130 TACCCACAGCCCTGCACCAGTGG - Intergenic
1144885036 17:18452039-18452061 TACCCACAGCCCTGCACCAGTGG + Intergenic
1144923191 17:18781426-18781448 TACCCACAGCCCTCCACTCCCGG - Intronic
1145147183 17:20492338-20492360 TACCCACAGCCCTGCACCAGTGG - Intergenic
1145265815 17:21379164-21379186 CACCTGCAGCTCTGCAGCACTGG + Intronic
1145362080 17:22220819-22220841 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1146859706 17:36286368-36286390 TAGCCACTGCACTCCAGCATGGG - Intronic
1147000837 17:37360631-37360653 TAGCCACTGCACCCCAGCACTGG + Intronic
1147090030 17:38090455-38090477 TAGCCACTGCACTCCAGCATGGG - Intergenic
1147107181 17:38230066-38230088 TAGCCACTGCACTCCAGCATGGG + Intergenic
1147652227 17:42069196-42069218 GCTACACAGCTCTCCAGCACAGG - Intergenic
1147927056 17:43952780-43952802 CACACACAGCCCTCCAGCCCAGG + Exonic
1148171714 17:45526479-45526501 TAGCCACTGCTCTCCAGCCTGGG - Intergenic
1148237294 17:45977281-45977303 TCCCCACCGCTGGCCAGCACAGG - Intronic
1148277659 17:46319924-46319946 TAGCCACTGCTCTCCAGCCTGGG + Intronic
1148299866 17:46537779-46537801 TAGCCACTGCTCTCCAGCCTGGG + Intronic
1148364308 17:47042070-47042092 TAGCCACTGCTCTCCAGCCTGGG + Intronic
1148422344 17:47558470-47558492 TAGCCACTGCACTCCAGCATGGG - Intronic
1148584168 17:48765577-48765599 TATCCACTGCTCTCCAGCCTAGG - Intronic
1149271736 17:54986585-54986607 TAGCCACAGCACTCCAGCTTGGG + Intronic
1149597296 17:57871967-57871989 TAGCCCCAGCTCTGCAGCAAAGG - Intronic
1150010956 17:61503295-61503317 TTGCCACTGCTCTCCAGCATGGG - Intergenic
1150290975 17:63981841-63981863 TCACCACAGCTTTCCAGCATTGG + Intergenic
1150402638 17:64871517-64871539 TAGCCACTGCTCTCCAGCCTGGG - Intronic
1152448558 17:80361479-80361501 TACCCACCGCACTCCAGCCTGGG + Intronic
1153731566 18:8018248-8018270 TAGCCACAGCACTCCAGCCTGGG + Intronic
1154312193 18:13276049-13276071 GACCCACTGCACTCCAGCATGGG - Intronic
1154984270 18:21533945-21533967 TAGCCACTGCACTCCAGCATGGG - Intronic
1156339936 18:36201618-36201640 TACCCACTGCACTCTAGCCCTGG + Intronic
1156497113 18:37533185-37533207 AACTCAAAGCTCTCCAGCAATGG - Intronic
1157734919 18:50038936-50038958 AAATCACAGCTCTCAAGCACTGG + Intronic
1157941041 18:51929550-51929572 TTTCCACAGATCTCTAGCACAGG - Intergenic
1159194637 18:65096794-65096816 GACCCACTGCTCTCCAGCCTGGG + Intergenic
1160213405 18:76903541-76903563 TGCCCACAGCTCTCCATTCCCGG - Intronic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160554695 18:79717717-79717739 AACCAACAGCTGTCCAGCAAGGG - Intronic
1160691688 19:463349-463371 TGCTGACAGCTCTCCAGCCCAGG + Exonic
1160835063 19:1120932-1120954 GCCCCACTGCTCTCCAGCCCAGG - Intronic
1161820338 19:6526891-6526913 TACCCACTGCACTCCAGCCTCGG + Intergenic
1162299112 19:9834416-9834438 TACCCACAGTTCCCCAACTCTGG + Intergenic
1162407377 19:10483345-10483367 TAACCACTGCACTCCAGCATGGG - Intergenic
1162474865 19:10893860-10893882 AACCCACTGTTCTCCAGCCCTGG - Intronic
1163968864 19:20773400-20773422 AAGCCACAGCCCTCCAGCATTGG + Intronic
1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG + Intergenic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1166130884 19:40744834-40744856 CACCCCCAGCCCTCCAGCCCTGG - Intronic
1167239434 19:48334322-48334344 TACCCAGACCTCTTCAGTACGGG + Intronic
1168012125 19:53541480-53541502 AACCCACTGCACTCCAGCATGGG - Intronic
926061727 2:9808784-9808806 TACCCATTGCCCTCCAGCACCGG - Intergenic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927599324 2:24426630-24426652 TACCCACTGCACTCCAGCCTAGG + Intergenic
928251059 2:29681050-29681072 TAGCCACAGCACTCCAGCCTGGG - Intronic
928387753 2:30884456-30884478 GACCCACAGCTCTGCAGGGCTGG - Intergenic
929256849 2:39820548-39820570 TAGCCACTGCACTCCAGCCCAGG - Intergenic
930748578 2:54909806-54909828 TGCCCACTGCACTCCAGCATGGG + Intronic
931654432 2:64498095-64498117 TAGCCACTGCACTCCAGCCCAGG - Intergenic
932314812 2:70772908-70772930 TATCCACAGCTCTCCAGGTCTGG - Intergenic
932324589 2:70849464-70849486 TACCCACTGCACTCCAGCCTGGG - Intergenic
934582668 2:95457724-95457746 AAACCAGAGTTCTCCAGCACAGG - Intergenic
934596782 2:95618990-95619012 AAACCAGAGTTCTCCAGCACAGG + Intergenic
935087089 2:99858506-99858528 TCCCCACTGCACTCCAGCCCAGG + Intronic
935125152 2:100216261-100216283 TGCACACAGAGCTCCAGCACTGG - Intergenic
935185218 2:100725553-100725575 TACCCACAGCAGGCCAGCCCAGG + Intergenic
935222219 2:101025266-101025288 TAGCCACTGCACTCCAGCCCTGG - Intronic
936106266 2:109627126-109627148 TACCCACTGCACTCCAGCCTGGG + Intergenic
938340777 2:130534717-130534739 GACCCACTGCACTCCAGCCCGGG + Intergenic
938349053 2:130585994-130586016 GACCCACTGCACTCCAGCCCGGG - Intergenic
938950346 2:136249381-136249403 TGCCCACAGCTCCCCAGCTAAGG - Intergenic
940214386 2:151289523-151289545 CACCCCCGGCTCTCCAGCCCGGG + Intronic
940894903 2:159072021-159072043 CACCCACTGCACTCCAGCCCAGG - Intronic
942070832 2:172313864-172313886 TCGGCACAGCTCTCCAGCAAAGG - Intergenic
942303237 2:174582587-174582609 TAGCCACAGCACTCCAGCCTAGG - Intronic
943764579 2:191647021-191647043 TATCCACTGCACTCCAGCCCAGG - Intergenic
944035623 2:195291124-195291146 TAGCAACACCTCTCCAGCAAGGG + Intergenic
944129934 2:196336850-196336872 GACACACAGCTCTGTAGCACTGG - Intronic
944568113 2:201012415-201012437 CACCCACTGCACTCCAGCATGGG + Intronic
944643659 2:201755222-201755244 TACCCACTGCACTCCAGCCTGGG + Intronic
945196349 2:207240811-207240833 TCCACACAGTTCTCCAGCAGTGG + Intergenic
945250860 2:207765834-207765856 TAATCACAGCTCTCCAGGAGAGG + Exonic
947830664 2:233139371-233139393 AATCCACAGATCACCAGCACTGG + Intronic
948450105 2:238063942-238063964 TAGCCACTGCACTCCAGCCCGGG - Intronic
948895845 2:240926501-240926523 TCCCAACAGCCCTCCAGCAAAGG + Intronic
1168794796 20:604416-604438 TCCTCACAGCTCTCCAGGATCGG + Exonic
1169641099 20:7753430-7753452 CACCCACAGTTCACTAGCACAGG + Intergenic
1170158861 20:13292822-13292844 TGCCCTCAGTTCTCCAGCAGAGG + Intronic
1172052373 20:32128118-32128140 TCCCCTCAGCTGTGCAGCACTGG - Intronic
1172473647 20:35220449-35220471 TCGCCACTGCACTCCAGCACGGG + Intergenic
1172626056 20:36347491-36347513 TTTCCACAGCACCCCAGCACAGG - Intronic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1173458429 20:43222464-43222486 TAGCCACAGCACTCCAGCCTGGG + Intergenic
1174643901 20:52069185-52069207 TACCCACTGCACTCCAGCCTGGG + Intronic
1176074959 20:63244253-63244275 TATCCTCAGCTCTCAAGCTCCGG + Intronic
1176427211 21:6555735-6555757 AGCACACAGCTCTTCAGCACTGG - Intergenic
1178824429 21:36003967-36003989 TCACCATAACTCTCCAGCACAGG - Intronic
1179702702 21:43164053-43164075 AGCACACAGCTCTTCAGCACTGG - Intergenic
1181805290 22:25370891-25370913 GAGCCACTGCACTCCAGCACGGG + Intronic
1181914579 22:26269374-26269396 TACCCACTGCTCTCTGGCAGGGG + Intronic
1182216488 22:28722746-28722768 TAGCCACTGCCCTCCAGCTCGGG - Intronic
1182722880 22:32417910-32417932 TACCCACTGCACTCCAGCCTGGG - Intronic
1183054226 22:35292673-35292695 TACCAACAGCTCTCCAGAGTAGG + Intronic
1184180946 22:42825210-42825232 CACCCACTGCACTCCAGCATGGG + Intronic
950875943 3:16273425-16273447 TACCCACTGCACTCCAGCCTGGG - Intronic
952853698 3:37750453-37750475 CACCCACAGGTCTACAACACTGG + Exonic
952917158 3:38255517-38255539 AACCCACAGCTCTCCGCCAACGG - Intergenic
953043888 3:39278438-39278460 TCCTCAAGGCTCTCCAGCACAGG + Intronic
953648769 3:44780117-44780139 TAGCCACTGCACTCCAGGACTGG - Intronic
954260897 3:49438100-49438122 TAGCCACTGCTCTCCAGCCTGGG + Intergenic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
954726234 3:52613375-52613397 TGCCCACTGCACTCCAGCATGGG - Intronic
955504053 3:59613617-59613639 TAGCCACTGCTCTCCAGCCTGGG + Intergenic
959067280 3:101670662-101670684 TACCCACTGCTCTCCAGACGGGG - Intronic
959861649 3:111222815-111222837 GACCCACAGCTCTTCAGCCTTGG - Intronic
961603648 3:128078090-128078112 TGCCCACAGCCCTCCAGAGCAGG + Intronic
961678463 3:128582989-128583011 TCCCCACAGCTCTACAACTCGGG - Intergenic
962620147 3:137170014-137170036 TACCCACTGCACTCCAGCCTGGG - Intergenic
963193270 3:142497522-142497544 TAGCCACTGCACTCCAGCTCAGG + Intronic
966118173 3:176490052-176490074 TCCCCACGGCACTCCAGCATGGG - Intergenic
967341587 3:188404848-188404870 TTGCAAGAGCTCTCCAGCACAGG - Intronic
969054134 4:4391015-4391037 TGTCCACAGCCCTCCAGGACTGG - Intronic
969262525 4:6043066-6043088 TCCCCACAGCCCTCCCCCACAGG - Intronic
970478374 4:16448733-16448755 TAACCCCTGCTGTCCAGCACAGG - Intergenic
973603652 4:52565785-52565807 TACCCACACCTCTCTAACAGTGG - Intergenic
975803821 4:78091687-78091709 TAGCCACAGCACTCCAGCCTGGG - Intronic
975951564 4:79778241-79778263 TATCAACAGATCTCCAGCAATGG + Intergenic
976995986 4:91434607-91434629 TATCCACAGCTTTCCATAACTGG + Intronic
977638467 4:99328142-99328164 AACCCACAGCCTTCCAGCATGGG + Intergenic
978791023 4:112663694-112663716 TACCCACTGCACTCCAGCCTGGG + Intergenic
980653915 4:135758364-135758386 CACTCACACCTCTGCAGCACTGG + Intergenic
980910220 4:138987602-138987624 GTGCCACTGCTCTCCAGCACGGG - Intergenic
981508937 4:145533650-145533672 TAGCCACAGCACTCCAGCCTGGG + Intronic
981721792 4:147809164-147809186 TAGCCACAGCACTCCAGCCTGGG + Intronic
982006389 4:151067244-151067266 TAGCCACAGCACTCCAGCCTGGG - Intergenic
982488506 4:155999050-155999072 TGCCCACTGCTCTCCAGCCTGGG - Intergenic
983682710 4:170372031-170372053 TAGCCACTGCTCTCCAGCCTGGG - Intergenic
984731762 4:183075118-183075140 TGCCCACTGCACTCCAGCCCGGG + Intergenic
984903368 4:184604571-184604593 AACCCACAACCTTCCAGCACGGG - Intergenic
985042011 4:185900083-185900105 TAGCCACTGCACTCCAGCTCAGG + Intronic
985126904 4:186703590-186703612 GAGCCACAGCACTCCTGCACAGG + Intronic
985698003 5:1352718-1352740 CACCTGCACCTCTCCAGCACTGG - Intergenic
986165752 5:5270252-5270274 TTCCCACAACTCTCCTGCACTGG + Intronic
986888019 5:12264392-12264414 TAGCCACAGCACTCCAGCCTGGG + Intergenic
988882633 5:35520095-35520117 TAACTCCAGTTCTCCAGCACGGG - Intergenic
992035310 5:72768236-72768258 TAGCCACTGCTCTCCAGCCTGGG - Intergenic
992400701 5:76408717-76408739 TAGCCACAGCTCTCCAGCCTGGG + Intronic
993732960 5:91444727-91444749 TACCCACTGCACTCCAGCCTGGG - Intergenic
996861252 5:128068599-128068621 TCTCCAGAGCTCTCCAGCTCAGG - Intergenic
1001042183 5:168344300-168344322 TACCCAACTCTCTCAAGCACAGG - Intronic
1001747571 5:174103528-174103550 TCCCCACCGCGCCCCAGCACTGG - Intronic
1001848102 5:174939481-174939503 AAGCCACTGCTCTCCAGCGCAGG - Intergenic
1002171740 5:177378511-177378533 TTCCTTCAGCTCCCCAGCACTGG - Intergenic
1002693140 5:181065060-181065082 TGCCTACAGCCCTCCTGCACTGG - Intergenic
1002756527 6:165805-165827 TAGCCACTGCACTCCAGCCCAGG - Intergenic
1003531143 6:6938627-6938649 TAGCCACTGCACTCCAGCCCGGG - Intergenic
1003944052 6:11057535-11057557 TGCCCACTGCACTCCAGCCCGGG - Intergenic
1003954395 6:11148346-11148368 ACACCACTGCTCTCCAGCACTGG - Intergenic
1004249879 6:14015130-14015152 TACCCACAGTTCTCAAGGATGGG + Intergenic
1004315482 6:14583542-14583564 TAGCCACTGCTCTCCAGCCTGGG - Intergenic
1004975397 6:20960158-20960180 TAGCCACAGCACTCCAGCCTGGG - Intronic
1005289418 6:24364302-24364324 TAACCACTGCTCTCCAGCCTGGG - Intergenic
1007555559 6:42762883-42762905 TACCCACTGCACTCCAGCTTGGG + Intronic
1009987574 6:70800249-70800271 TAGCCACTGCACTCCAGCATGGG + Intronic
1010145525 6:72664611-72664633 TACCCACTGCACTCCAGCCTGGG + Intronic
1010958821 6:82122119-82122141 AAGCCACAGCACTCCAGCCCCGG + Intergenic
1013041366 6:106437072-106437094 TAGCCACAGCACTCCAGCCTAGG + Intergenic
1013367552 6:109447206-109447228 TGCACACAGGTCCCCAGCACCGG + Exonic
1013525154 6:110967109-110967131 TACCCACTGCACTCCAGCCTGGG + Intronic
1013785498 6:113775366-113775388 TACCCACCGCACTCCAGCCTGGG - Intergenic
1013856212 6:114575489-114575511 TAGCCACTGCACTCCAGCATGGG - Intergenic
1014438846 6:121450468-121450490 GCCCCATAGCACTCCAGCACGGG + Intergenic
1015282352 6:131447137-131447159 TACGGGCAGCTCTCCAGAACAGG + Intergenic
1017848804 6:158284444-158284466 TATCCCCAGCTCTTCAGCAGCGG - Intronic
1017970256 6:159306255-159306277 CACCCACAACTCTCCAGAAAGGG + Intergenic
1018358141 6:163039268-163039290 GACTCACAGTTCTCCATCACTGG - Intronic
1019198904 6:170297685-170297707 GGCCAACAGCTCCCCAGCACGGG - Intronic
1019226022 6:170510206-170510228 TTCCCTCAGTTCTCCAGCACAGG - Intergenic
1019528722 7:1493234-1493256 TTCCCCCAGCTCTCCTGCTCAGG - Intronic
1020188114 7:5974181-5974203 TGCCCATAGCACTCCAGCCCTGG + Intronic
1020294804 7:6750588-6750610 TGCCCATAGCACTCCAGCCCTGG - Intergenic
1020525388 7:9251931-9251953 TCCCAACACCTCTCCAGCAAGGG + Intergenic
1022505459 7:30906529-30906551 TACCATCAACTCTCCAGCAATGG - Intergenic
1023460790 7:40394277-40394299 TAACCACAGGTCTGCAGCAGTGG - Intronic
1024710160 7:52006369-52006391 GTCTCACAGCTCTCCAGGACTGG + Intergenic
1026838120 7:73651654-73651676 GACCCACTGCACTCCAGCCCAGG - Intergenic
1028459305 7:91072630-91072652 TCGCAACAGCTCTCCAGCAATGG + Intronic
1029253151 7:99251127-99251149 TTCCCAAAGGCCTCCAGCACAGG - Intergenic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1030002088 7:105075717-105075739 TACCCACTGCACTCCAGCCTGGG - Intronic
1030256650 7:107516960-107516982 TCGCAACAGCTCTCCAGCAAGGG + Intronic
1033153261 7:138934896-138934918 AAAGCACAGCTCTTCAGCACTGG + Intronic
1033198981 7:139352151-139352173 TAGCCACTGCTCTCCAGCCTGGG + Intronic
1034134228 7:148750937-148750959 TAGCCACTGCTCTCCAGCCTGGG + Intronic
1034961056 7:155364639-155364661 TACCCACAGCTGTCAATCCCAGG - Intronic
1035308923 7:157952564-157952586 GACCCACAGCTCTGCACCACAGG - Intronic
1036166720 8:6441700-6441722 TACCTACTGCTCTCCCTCACTGG + Intronic
1037303581 8:17480932-17480954 TTCCCACAGCTCTCCAACGCAGG - Intergenic
1039502270 8:38027573-38027595 TAGCCACTGCACTCCAGCCCAGG + Intergenic
1040010059 8:42653955-42653977 TACCCACTACACTCCAGCATGGG - Intergenic
1041082402 8:54226096-54226118 TACCCACAGCCCTCCAGCCTGGG - Intergenic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1041405987 8:57500208-57500230 TACACACAGCTCTCAAGGAAGGG + Intergenic
1041476645 8:58274647-58274669 ACACCACAGCACTCCAGCACAGG - Intergenic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1042031290 8:64478669-64478691 TAGCCACAGCACTCCATCCCGGG + Intergenic
1042489646 8:69382264-69382286 TGCCAACACCTCTCCAGCATGGG + Intergenic
1043406529 8:79940256-79940278 TAATAACAGCTCTCCAGAACAGG - Intronic
1044586676 8:93875052-93875074 AACCCACAGCCTTCCAGCATGGG + Intronic
1045224274 8:100229379-100229401 CACCCACCGCACTCCAGCCCGGG + Intronic
1045491122 8:102670278-102670300 TACCCGCTGCTTTCCTGCACAGG - Intergenic
1045821407 8:106342806-106342828 TCCCCTCCACTCTCCAGCACCGG + Intronic
1050783186 9:9365082-9365104 TACTCAGTGTTCTCCAGCACAGG - Intronic
1051270311 9:15348999-15349021 TAGCCACTGCATTCCAGCACAGG - Intergenic
1051282038 9:15451659-15451681 TACCCACTGCTTTCCAGCCTGGG + Intronic
1051288900 9:15525805-15525827 TACCCAAAGCACTCCAGCCTGGG - Intergenic
1052411543 9:28128062-28128084 TAACCAGAGCTTTCCAGAACAGG - Intronic
1052836838 9:33256582-33256604 CACTCACAGCCCTCCAGCATAGG - Intronic
1053124448 9:35568471-35568493 TAGCCACTGCACTCCAGCCCAGG + Intergenic
1055121671 9:72667035-72667057 TCCCCACTGCACTCCAGCCCGGG + Intronic
1056171249 9:83987104-83987126 TTCCCACTGCACTCCAGCATGGG - Intronic
1056779491 9:89538744-89538766 TGACCACAGCTCCCCACCACAGG - Intergenic
1057248301 9:93478205-93478227 TAGACACTGCACTCCAGCACAGG - Intronic
1057314599 9:93960374-93960396 CACCCACCGCTCGCCAGCCCCGG + Intergenic
1057331757 9:94121385-94121407 TACACACTGCTCTCCAGCCTGGG + Intergenic
1059434935 9:114270507-114270529 CACCCTCAGCTCTCCAGAAAAGG - Intronic
1059912116 9:119056162-119056184 AACTCACAGCTCTCCATGACTGG + Intergenic
1060191661 9:121597971-121597993 TTCCCACCGGTCTCCAGCACTGG - Intronic
1060857139 9:126923699-126923721 TAGCCACTGCACTCCAGCCCAGG - Intronic
1061576571 9:131510975-131510997 AACACACAGCACTACAGCACTGG - Intronic
1185596206 X:1308520-1308542 CACCCACCTCTCTCCAGCTCAGG + Intronic
1186087536 X:6006627-6006649 TACCCACCTCTCTTCAGCATGGG + Intronic
1186095777 X:6100247-6100269 AACCCACAGCCTTCCAGCATGGG + Intronic
1186349287 X:8727228-8727250 CACCCTCACCTCTCCAGGACAGG + Intronic
1189555833 X:42144380-42144402 TAACCAGAGCTCTTCAGCACAGG - Intergenic
1191595165 X:62935824-62935846 GAGCCACAGCACTCCAGCATGGG + Intergenic
1192338053 X:70238362-70238384 TGCGCACAGCCCTCCAGCATGGG + Exonic
1193623990 X:83794375-83794397 TACCTTCACCTCTCCAGCACTGG + Intergenic
1195934076 X:110108430-110108452 AAACCACTGGTCTCCAGCACTGG - Intronic
1198211893 X:134523991-134524013 AACCCACTGCACTCCAGCCCAGG + Intergenic