ID: 1172935433

View in Genome Browser
Species Human (GRCh38)
Location 20:38616756-38616778
Sequence ACCTTGCCAAATGTTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1921
Summary {0: 2, 1: 27, 2: 207, 3: 590, 4: 1095}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172935433_1172935440 19 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT 0: 2
1: 27
2: 207
3: 590
4: 1095
Right 1172935440 20:38616798-38616820 TAAAACTGAGAGGGATGCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1172935433_1172935441 29 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT 0: 2
1: 27
2: 207
3: 590
4: 1095
Right 1172935441 20:38616808-38616830 AGGGATGCTTTGGCGTCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
1172935433_1172935438 9 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT 0: 2
1: 27
2: 207
3: 590
4: 1095
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG 0: 1
1: 4
2: 1
3: 37
4: 309
1172935433_1172935439 10 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT 0: 2
1: 27
2: 207
3: 590
4: 1095
Right 1172935439 20:38616789-38616811 TGTCATTGTTAAAACTGAGAGGG 0: 1
1: 0
2: 4
3: 25
4: 356
1172935433_1172935442 30 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT 0: 2
1: 27
2: 207
3: 590
4: 1095
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172935433 Original CRISPR ACCTTGCCAAATGTTCCCTG GGG (reversed) Intronic
900590437 1:3457062-3457084 ACGTTGGCAAATGTGCCCTGGGG + Intronic
900747375 1:4370204-4370226 ATCTTGCCTGATGTTCCCTGGGG + Intergenic
900766727 1:4510891-4510913 CCACTGCCAAATATTCCCTGAGG + Intergenic
900794837 1:4701677-4701699 ATATTGCCAAATGTCCCCTGAGG + Intronic
900884889 1:5408120-5408142 ACATGGCCAAATGTCCCCTCGGG + Intergenic
900967318 1:5967721-5967743 ACATTGCCAAATGTGCCTTAGGG - Intronic
901151754 1:7107997-7108019 ACATTGTCAAATGTCCCATGGGG - Intronic
901347619 1:8560335-8560357 ACATTGCTAAATCTCCCCTGTGG + Intronic
901924529 1:12557572-12557594 ACATTACCAAATGTCCCCTAAGG - Intergenic
902074217 1:13769880-13769902 ACATGGCCAGATGTCCCCTGGGG - Intronic
902246295 1:15123110-15123132 ACATTGCCAAATGTCCCTGGGGG + Intergenic
902288621 1:15422521-15422543 ACATTGCCAGATGTCTCCTGGGG + Intronic
902556569 1:17250396-17250418 ACATTGCCAAATGTGCCCTGGGG + Intronic
902593098 1:17488983-17489005 ACATTGACAGATGTTCCCTGGGG + Intergenic
902605398 1:17566325-17566347 CCATTGCCAAATGTCCCTTGGGG + Intronic
902672783 1:17986463-17986485 ACATTGCCAAATGTCCTCTGAGG - Intergenic
902681205 1:18045141-18045163 ACATCGCCAAATGTCCCCTGGGG + Intergenic
902706765 1:18210787-18210809 ACATTGCCAAGTGTCCCCTGGGG + Intronic
902790428 1:18764203-18764225 ACATTGCCAAATGTCTCCTGGGG - Intergenic
902813056 1:18900460-18900482 ACATTGTCAGATGTTACCTGGGG - Intronic
903012200 1:20339163-20339185 ACACTGCCAAATGTTCCCTGGGG + Intronic
903262384 1:22138409-22138431 ACTTTGCCAAATGTCCCCTGGGG - Intronic
903303747 1:22397712-22397734 CCATTGCCAACTGTCCCCTGGGG + Intergenic
903344506 1:22675841-22675863 ACATTGTCAAATGTCCCCTGGGG - Intergenic
903397434 1:23012620-23012642 ATATTGCCAAATGTCCCCTGGGG - Intronic
903469605 1:23576807-23576829 ATCTTGCCAAATGTCCTCTGGGG + Intergenic
903559785 1:24218659-24218681 ACATTGCCAAATGTCCCCAGAGG + Intergenic
903718389 1:25386285-25386307 ACATTGTCAGATGTCCCCTGGGG + Intronic
904133906 1:28296301-28296323 ACTTTGCCAAATATCCCGTGAGG - Intergenic
904229112 1:29052319-29052341 ACATTGCCAGATATTCTCTGGGG + Intronic
904246714 1:29193373-29193395 ACATTGTCAAATGTCTCCTGGGG + Intronic
904399900 1:30249165-30249187 ACATTGCTAAATTTTCCCTAAGG + Intergenic
904889457 1:33768279-33768301 ACATTGCCAAATATTCCCTGGGG - Intronic
904929661 1:34076539-34076561 ATGTGGCCAAATGTCCCCTGGGG + Intronic
904933004 1:34105352-34105374 ATATTGCCAAATGTCCCCTAGGG + Intronic
905138059 1:35815832-35815854 TATTTGCCAAATGTTTCCTGGGG + Intronic
905158237 1:36007123-36007145 ACATTGCCAAATGTCCCCTGGGG + Intronic
905187840 1:36209508-36209530 ACATTGCCAAATATCCTCTGGGG + Intergenic
905387952 1:37617177-37617199 GCATTGTCAAATGTCCCCTGGGG - Intronic
905502048 1:38447160-38447182 ACATTGTCAAATGTCCCCTGGGG + Intergenic
905775790 1:40666284-40666306 ACATGGTCGAATGTTCCCTGGGG - Intergenic
905970361 1:42137358-42137380 ATGTTGCCAAATGTTCCCTGGGG - Intergenic
905973227 1:42156292-42156314 AGCTGGCCAGATGGTCCCTGTGG - Intergenic
906096879 1:43229875-43229897 ACCTTGCCAGAGGTCCCCTGGGG + Intronic
906203234 1:43973057-43973079 ACCTTGGCAAATGTTATCTGTGG + Exonic
906240519 1:44239618-44239640 CTCTTGCCAGATGTTCCCTCTGG + Intronic
906778642 1:48552660-48552682 ACATTGCCAAACACTCCCTGGGG + Intronic
906820038 1:48919767-48919789 ACATTGCCAAATGTTTCTTGAGG + Intronic
907009407 1:50949464-50949486 ACATTGCCCAATGTCCCCTGGGG + Intronic
907015989 1:51013601-51013623 ACATTGGCAAATGTCCCCTGGGG - Intergenic
907468903 1:54658922-54658944 ACATTGCTGAATGTTCCATGGGG + Intronic
907708445 1:56853258-56853280 ACATTGCCAAATATCCCCTGAGG + Intergenic
907714065 1:56911522-56911544 ACATTGCCAAATATTCCTTGGGG - Intronic
907984772 1:59519930-59519952 ACATTGCCAAATGTCCCCTGAGG - Intronic
908151986 1:61311632-61311654 ACATTGCCAAATGTCACCTGGGG + Intronic
908191874 1:61712081-61712103 ACCTTGCCAAATGTCCTCTGGGG - Intronic
908288518 1:62637418-62637440 GTATTGCCAAATGTTCCCTTGGG - Intronic
908338366 1:63150449-63150471 ACCTTACCAAATGTTGCCTAGGG + Intergenic
908523925 1:64969464-64969486 ACGTTGCCAAATGTCCCCTGGGG + Intergenic
908772185 1:67607340-67607362 ACACTGCCAAATGTTCCCTTGGG + Intergenic
908833879 1:68209176-68209198 ACATTGCCAAATATTCCCTGGGG + Intronic
909071925 1:71005038-71005060 ACATTGCCAAATGTACTATGGGG - Intronic
909425858 1:75523745-75523767 ATATTGTCAAATGTCCCCTGTGG - Intronic
909506150 1:76392154-76392176 ACATTGCCAAATGTTCCCTAGGG + Intronic
910044140 1:82891180-82891202 ACATTGCCAAATATATCCTGGGG + Intergenic
910164351 1:84308461-84308483 ACATTGCCAAATGTTCCCTGAGG + Intronic
910241351 1:85089706-85089728 ACATTGCCAAATGTCCCATGAGG + Intronic
910423511 1:87096716-87096738 ACATTGCCAAATATCACCTGAGG + Intronic
910447914 1:87317598-87317620 ACATTGCCAAATGTCCACTGGGG + Intergenic
910764737 1:90770326-90770348 GCATTGCCAAATGTCTCCTGGGG + Intergenic
910948914 1:92623691-92623713 ACATTGCCAAATGTCCCCTGGGG - Intronic
910973390 1:92880027-92880049 ACATTGCCAAGTGTCCCCTGTGG - Intronic
910990783 1:93053694-93053716 ACATTGCCAAACGTTCCAAGGGG - Intergenic
911517294 1:98882139-98882161 ACATTGCCAAATGTCCCCTGGGG + Intergenic
911692743 1:100853652-100853674 ACCATCCCAAATATTCCTTGGGG + Intergenic
911694187 1:100869919-100869941 ACATTGCCAGATGTCCCCTCGGG + Intergenic
911956852 1:104247059-104247081 ACATTGTCAAATGTCCTCTGGGG + Intergenic
912083011 1:105961464-105961486 ATGTTGCCAAATATTTCCTGTGG - Intergenic
912163227 1:107011631-107011653 AGATTGCCAAATATTCCATGAGG - Intergenic
912198053 1:107423283-107423305 ACATTGCCAAATGTCCCCTGGGG - Intronic
912397295 1:109355847-109355869 ACATTACCAAATGTTTCTTGGGG - Intronic
912725864 1:112058313-112058335 ACGTTGCCTAATGTCCCCTGAGG - Intergenic
912864275 1:113243319-113243341 ACATCGCCAAATGTCCCCTGGGG + Intergenic
912974513 1:114315739-114315761 ACATTGCCAAATGTCCCCTGGGG - Intergenic
913072376 1:115311463-115311485 ACATCGCCAAATGTCCCTTGTGG - Intronic
913134369 1:115873757-115873779 ACATTGCCACATGTTTCATGAGG - Intergenic
913239392 1:116816742-116816764 AGTATGCCAGATGTTCCCTGGGG - Intergenic
913373120 1:118122624-118122646 ACATTGCCAAATGTTCCCTTGGG + Intronic
913715212 1:121526858-121526880 ACATTGCCAAATGTCTCCTGTGG + Intergenic
913955666 1:143289124-143289146 ACATTGACAAATGTCTCCTGGGG + Intergenic
913981766 1:143526317-143526339 ACATTGACAAATGTCTCCTGGGG - Intergenic
914076136 1:144352973-144352995 ACATTGACAAATGTCTCCTGGGG - Intergenic
914103042 1:144613523-144613545 ACATTGACAAATGTCTCCTGGGG + Intergenic
914720499 1:150284993-150285015 ACCTGGCCAAATGATTCATGCGG + Intronic
914809260 1:151014767-151014789 GACTTGCTGAATGTTCCCTGGGG - Intronic
914868019 1:151449319-151449341 ACATTGCCAAATGCCCTCTGGGG - Intronic
915168387 1:153961464-153961486 ACATTACCAAATGTTTCCTGAGG + Intronic
915366535 1:155320008-155320030 ACATTGCCAAATGTCCCCTCGGG - Intronic
915892540 1:159784853-159784875 ACATTGCCAAATGTTCCCTGGGG + Intergenic
916011021 1:160705900-160705922 ATATTGCCAAATGTCCCTTGAGG + Intronic
916142781 1:161713707-161713729 ACATTGCCCAATGTCCTCTGGGG - Exonic
916335410 1:163665489-163665511 ACATTGCCAAAGGTCCCCTAGGG - Intergenic
916416426 1:164596469-164596491 ATATTGCCAAATGGCCCCTGGGG - Intronic
916449991 1:164911512-164911534 ATATTGTCAAATGTTCCCTGGGG + Intergenic
916704049 1:167328454-167328476 ACCTTGCTAATTGTTTCCTTGGG + Intronic
916723013 1:167499145-167499167 ACGTTGCCAAATGTTTCCTGGGG - Intronic
916850538 1:168698610-168698632 ACATTGCCAAGTATTCCCTTGGG - Intronic
916923171 1:169490239-169490261 ACATTGCCAAATGTCCCCTGTGG - Intergenic
917037731 1:170767737-170767759 GCATTGCCAAATGTTTCCTGGGG - Intergenic
917042757 1:170824268-170824290 ACAATGCCAAATGTACCCTCAGG - Intergenic
917200940 1:172514721-172514743 CCCTTCCCAAATTTCCCCTGGGG + Intergenic
917469104 1:175310896-175310918 ACATTGCCAAATGTCCTCTGGGG - Intergenic
918314345 1:183310573-183310595 ACATTGCCAAATGTGCCCTGGGG - Intronic
918499658 1:185179847-185179869 GCATTGCCAAATGTCCCCTGAGG - Intronic
918517212 1:185376159-185376181 ACACTGCCAAATGTCTCCTGGGG + Intergenic
918729404 1:187972169-187972191 ACGTTGCCAAATTGCCCCTGAGG + Intergenic
918822437 1:189271700-189271722 CCCTTGCCAAAACTTACCTGTGG - Intergenic
919097216 1:193052350-193052372 TCATTGCCAAATGTTCCCTGGGG - Intronic
919668687 1:200318700-200318722 ACTTTGCCTAATGTCTCCTGGGG + Intergenic
919807743 1:201390772-201390794 ACATTGCCAAATGTCTCCTGGGG + Intronic
919853684 1:201691236-201691258 ACATCACCAAATGTCCCCTGAGG + Intronic
920023984 1:202978499-202978521 ACATTGCCAAATGTCCCCAGGGG + Intergenic
920245122 1:204582118-204582140 ACATCACCAAATGTCCCCTGGGG + Intergenic
920532068 1:206709915-206709937 ACATTGCCAAACGTCCCCTGGGG + Intronic
920916778 1:210264111-210264133 ACCTTGTGAAATGTCCCCTGGGG - Intergenic
921539460 1:216395671-216395693 ACATTGCCAAGTGTCCCCTAAGG - Intronic
922081916 1:222305563-222305585 ACATTGCCAGATGTTCCCGGGGG - Intergenic
922097654 1:222456139-222456161 ACATTGCCAAATGTTTCCTGGGG + Intergenic
922194277 1:223346192-223346214 ACATTGCCAAATGTCCCCTGGGG + Intronic
922234195 1:223711161-223711183 ACATTCCCAAATGTCTCCTGGGG + Intronic
922236667 1:223727418-223727440 ACCTTGCCAAATGTCCCCTGGGG + Intronic
922295688 1:224247900-224247922 ACATTGCCAAATGTTCCCTGGGG + Intronic
922531255 1:226347051-226347073 ATGTTGCCAAATGTCCCCTGAGG - Intergenic
922546659 1:226463097-226463119 ACATTGCCACCTGTTCCCTGGGG + Intergenic
922583334 1:226714883-226714905 ACATTGCCAAATGTCCCCCATGG - Intronic
922926626 1:229352461-229352483 ACATTGCCAAATGCTGCCCGGGG - Intergenic
922942572 1:229480611-229480633 ACATTGCCAGATGGCCCCTGGGG - Intronic
923054803 1:230417965-230417987 ACATTGCCAAATGTCCCCTGGGG - Intronic
923103280 1:230834507-230834529 ACACTGCCAAATATCCCCTGGGG + Intergenic
923223744 1:231920130-231920152 ACCTTGCCAGATGTCCCTTGGGG + Intronic
923584392 1:235253422-235253444 GCATTGCCAAATGTTCCCTGGGG + Intronic
924051870 1:240087478-240087500 ACAGTGTCATATGTTCCCTGGGG + Intronic
924055405 1:240119481-240119503 ACATTGCCAAGTGTCTCCTGGGG - Intronic
924095006 1:240542030-240542052 ACATTGACAAATGTCCCCTGAGG - Intronic
924176223 1:241393934-241393956 ACATTGCCAAATATCCCCTTGGG + Intergenic
924277752 1:242405305-242405327 ACATTGCCAAATGTCCCTGGAGG - Intronic
924413738 1:243835252-243835274 ACATTGCCAAATGTCCTCTGGGG + Intronic
924430419 1:243991734-243991756 ACATTACCAGATGTTCCCTGAGG + Intergenic
924520023 1:244797961-244797983 ACATTTCTAAATGTCCCCTGGGG - Intergenic
1063276770 10:4577852-4577874 ACATTAACAAATGTTCCCTAGGG + Intergenic
1063476400 10:6332443-6332465 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1063630055 10:7724842-7724864 ACATTGCCAAATGTCCGCTGGGG + Intronic
1063687204 10:8248477-8248499 ACATTACCAAATGTTCCCCAGGG - Intergenic
1063768391 10:9169247-9169269 TCCTTATCAAATGTCCCCTGGGG - Intergenic
1064131807 10:12716333-12716355 ACATTGTCATATGTCCCCTGCGG + Intronic
1064731415 10:18334724-18334746 AAATTGCCCAATGTCCCCTGAGG + Intronic
1065177070 10:23088073-23088095 ACATTGCCAGATGTTCCCTTAGG - Intergenic
1065391300 10:25185090-25185112 ACATTGCCAAATATCCCCTGTGG + Intronic
1065412430 10:25444098-25444120 ACATTGCCAGATATCCCCTGGGG + Intronic
1065416708 10:25496038-25496060 ATATTGCCAAATGTGTCCTGGGG + Intronic
1065446139 10:25802969-25802991 ACATGGACAAATATTCCCTGGGG + Intergenic
1065474217 10:26116879-26116901 ACATTGCCAAATGTCCTGTGAGG + Intronic
1065484824 10:26227589-26227611 ATATTGCCAAATGTCCCTTGTGG - Intronic
1066114883 10:32230782-32230804 ACCTTCCCAAATGGTTCCTGGGG - Intergenic
1066434268 10:35382508-35382530 ACCTTGCCAAATGTGCCCTGGGG - Intronic
1066473299 10:35720137-35720159 ACATTGCCAAATGTCTCCTGGGG + Intergenic
1066551468 10:36563180-36563202 ACGTTGCCAAATATTCCCTGAGG - Intergenic
1066587215 10:36949120-36949142 ACATTGCCAAATGTGCCCTGGGG - Intergenic
1066779083 10:38923600-38923622 ACATTGACAAATGTCTCCTGGGG - Intergenic
1066952148 10:42130024-42130046 ACATTGACAAATGTCTCCTGGGG + Intergenic
1067356727 10:45535367-45535389 ACCATGCCAAAAGCTACCTGTGG + Exonic
1067433760 10:46263406-46263428 CCCTTGCCAACCATTCCCTGTGG - Intergenic
1067439926 10:46302902-46302924 CCCTTGCCAACCATTCCCTGTGG + Intronic
1067496436 10:46764543-46764565 AGATTGCCAAATGTCCCCTGTGG - Intergenic
1067598218 10:47575854-47575876 AGATTGCCAAATGTCCCCTGTGG + Intergenic
1067727454 10:48781060-48781082 ACATTTCCAAATATACCCTGGGG + Intronic
1067743898 10:48918887-48918909 ACATTGCCAAATGTCCACTGAGG + Intronic
1067818424 10:49502704-49502726 ACATTGCCAAATGTCCCATAGGG - Intronic
1068022217 10:51599200-51599222 ACATTGCTAAATGTTTCCTGGGG - Intronic
1068066917 10:52143446-52143468 GCATTGCCAAATGTCTCCTGTGG + Intronic
1068172850 10:53418780-53418802 CCCTTGGCAAATGTTCCATGTGG + Intergenic
1068578694 10:58713957-58713979 ATATTGCCAAATGATCCCTGTGG - Intronic
1068975211 10:63001857-63001879 ACATTGCCAAATGTTCCCTGGGG - Intergenic
1069020903 10:63487367-63487389 ACATTGCCAAATGTCCCAAGGGG - Intergenic
1069073385 10:64013223-64013245 ATATTGCCAAATGTCCCCTGGGG + Intergenic
1069090043 10:64189238-64189260 ATATTGCCAAATGTTCCTAGAGG + Intergenic
1069692418 10:70362743-70362765 ACATTTCCAAATGTCCCCTGGGG - Intronic
1069771289 10:70901868-70901890 ACCTTGCCAACTGTCCCCTGGGG - Intergenic
1070158351 10:73850433-73850455 GCATTGCCAAATGTCCCCTGCGG - Intronic
1070502433 10:77084245-77084267 ACATTGCAAAATGTCCCCTGGGG + Intronic
1070623881 10:78034904-78034926 ACTTAGCCAACTGTTCCCTTAGG - Intronic
1070744455 10:78924678-78924700 ACATTGCCAAATGTCCTCTGAGG + Intergenic
1070755709 10:78992092-78992114 ACAATTCCAAATGTTCCCTCAGG - Intergenic
1071204628 10:83259829-83259851 ACATTGCCAAATATCCTCTGGGG + Intergenic
1071275544 10:84051168-84051190 ACCTCCCCAAATTTTTCCTGAGG + Intergenic
1071465691 10:85937699-85937721 ACATTGCCAAATGTTCCAGTGGG - Intronic
1071471198 10:85985113-85985135 ACATTGCCAAATGTTGTCTGGGG + Intronic
1071541555 10:86489535-86489557 ACATTGCCAAATGTTTCCTGGGG - Intronic
1071612892 10:87047630-87047652 AGATTGCCAAATGTCCCCTGTGG - Intergenic
1071776149 10:88790412-88790434 ACATTGCCAAATTTCCCATGAGG + Intergenic
1071842305 10:89485148-89485170 ACATTGCCAAATGTCCTCTGGGG - Intronic
1072000512 10:91191038-91191060 GCCTTGGAATATGTTCCCTGTGG - Intronic
1072016172 10:91348971-91348993 ATATTGCCAAAGGTCCCCTGAGG - Intergenic
1072145054 10:92628082-92628104 ACTCTGCCAAATGTCCTCTGGGG - Intronic
1072147323 10:92653343-92653365 GCATTGCCAAATGTCCCCTGTGG + Intronic
1072156499 10:92728699-92728721 ACATTGCCAAATGTCTCCTGGGG + Intergenic
1072243375 10:93518668-93518690 CCCTTGCCGAGAGTTCCCTGAGG - Intronic
1072330784 10:94349570-94349592 ACATTGCCTAATGTTCCCTGGGG + Intronic
1072504471 10:96050841-96050863 ACGTTGCCAAGTGTTCCCTGTGG - Intronic
1072713900 10:97736889-97736911 CTCTCGCCAACTGTTCCCTGCGG + Intergenic
1072816783 10:98517318-98517340 ACATTGCTAAATGTCCCTTGGGG + Intronic
1072845387 10:98824819-98824841 ACCTCTTCAAATGTTCCTTGTGG + Intronic
1072894120 10:99350980-99351002 ACATGGCCAAATGTCCCCTGGGG + Intronic
1073594188 10:104784220-104784242 ACTTTGCCAAAAGTCCCCTGGGG - Intronic
1074088155 10:110224371-110224393 ACATTGCCAAATATCTCCTGGGG - Intronic
1074119329 10:110481759-110481781 ACATGGCCAGATGTCCCCTGCGG + Intergenic
1074212574 10:111350660-111350682 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1074308065 10:112297268-112297290 ACAGTGCCAAATGTCCCCTGGGG + Intronic
1074404519 10:113169486-113169508 ACATCGCCAGATGTCCCCTGGGG + Intergenic
1074580778 10:114717552-114717574 TCATTGTCAAATGTCCCCTGAGG + Intergenic
1074659950 10:115642915-115642937 ACATTGCCAAATGTTTCCTGAGG - Intronic
1074729872 10:116359612-116359634 ACATTGCAAAATGTCCGCTGGGG + Intronic
1074958695 10:118418884-118418906 ACATTGCCAAATATCCCATGAGG + Intergenic
1075051775 10:119187580-119187602 ATGTTGCCAAATGTCCCCTGGGG + Intergenic
1075168959 10:120095532-120095554 ACATCACCAAATGTCCCCTGGGG + Intergenic
1075215496 10:120529132-120529154 ACATTGCTAAATGTCCCCTGGGG - Intronic
1075306206 10:121369960-121369982 ACATTGCCAAATGACTCCTGGGG - Intergenic
1075363835 10:121864797-121864819 ACTTTGCCAAATGTCCCTAGGGG - Intronic
1075546062 10:123355568-123355590 ACATTACCAAATGTCCTCTGGGG + Intergenic
1075615420 10:123887548-123887570 ACATTGCCAAATATCCCCAGGGG - Intronic
1075706675 10:124506435-124506457 ACATTGCCAGATGTGCCCTGGGG + Intronic
1075895802 10:125993591-125993613 ACATTGCCAAATGTCCTCTGGGG + Intronic
1075931545 10:126301018-126301040 ACATTGCCACATGTTCCCTGGGG - Intronic
1076047219 10:127303983-127304005 TCTTTGCTGAATGTTCCCTGGGG - Intronic
1076527112 10:131118855-131118877 ACCTTACCAAATGTCCCCTGGGG - Intronic
1076618738 10:131773460-131773482 ACACTGCCAGATGTCCCCTGGGG - Intergenic
1076923505 10:133467776-133467798 GCTTTGCCAAATGTGCTCTGGGG + Intergenic
1076923975 10:133472030-133472052 ACGTCACCAAATGTTTCCTGGGG + Intergenic
1077458347 11:2694333-2694355 ACATTGCCATATGTCCCCTGGGG - Intronic
1077590563 11:3487786-3487808 ACATGGCCACATGTTCTCTGGGG - Intergenic
1077893892 11:6439687-6439709 ACCTTGCCAAAGGTGCTGTGTGG - Intronic
1078025960 11:7695971-7695993 TCATTGCCAAATGTGTCCTGAGG + Intronic
1078558564 11:12351338-12351360 ACATTGCCAAATATCCTCTGAGG - Intronic
1078672659 11:13378508-13378530 ACATTGCAAAATATTGCCTGGGG - Intronic
1079295344 11:19228346-19228368 AGTTTGTCAAATCTTCCCTGAGG - Intronic
1079468826 11:20758804-20758826 ACATTGCCAGATGTCCCCTGGGG + Intronic
1080137406 11:28871831-28871853 ACATTGCCAAATATCCCCTCAGG + Intergenic
1080284990 11:30600449-30600471 ACACTGCCAAATGTACCCTTGGG + Intergenic
1080286552 11:30620696-30620718 ACATTGCTAAATGTCTCCTGGGG + Intergenic
1080430046 11:32189656-32189678 ACATTGCCAAATATCCCCTGGGG - Intergenic
1080635150 11:34117314-34117336 ACATTGCCAAATGTCCCCAGGGG - Intronic
1080667625 11:34349710-34349732 ACTTTTCCAGATGTTCCCTGGGG - Intronic
1080702935 11:34659951-34659973 ACATCACCAAATGTTCCCTGGGG + Intronic
1080846632 11:36032689-36032711 ACAGTGCCATATGTTCCCAGGGG + Intronic
1080948600 11:37002998-37003020 ACATTGCCAAATGGACCCTGGGG - Intergenic
1080950429 11:37026093-37026115 ACATTTCCAAATGTCCCCTGGGG + Intergenic
1081178306 11:39955889-39955911 ACATTGCCAAGTGTCCCCTGAGG + Intergenic
1081193304 11:40130645-40130667 ACACTGCCAAATGTCCCCTGGGG + Intronic
1081301996 11:41463874-41463896 AACTTGGTAAATGTTCCTTGTGG + Intergenic
1081549909 11:44101341-44101363 ACATTGCCAAATATCCCTTGGGG - Intronic
1081551661 11:44119103-44119125 AAATAGCCAAATGTCCCCTGGGG - Intronic
1081709425 11:45207425-45207447 GCCTTGCCAAATGCCCCCAGGGG - Intronic
1082085892 11:48049262-48049284 ACATTGCCAGATGTCCCCTGGGG + Intronic
1082808907 11:57466797-57466819 ACATTGCCAAATGTCCCCTGGGG - Intronic
1082857938 11:57826142-57826164 AATTTACCAAATGTTCCTTGAGG - Intergenic
1082989023 11:59191515-59191537 ACATGGCCAAATGTTCCCTCAGG - Intronic
1083032861 11:59610177-59610199 ACATTGCCAAATGTCCCCTGGGG + Intronic
1083486618 11:62986989-62987011 ACATTGCCAAGTGTCCCCTGGGG - Intergenic
1083694791 11:64435466-64435488 ACATTACCAAATGTCCCCTGGGG + Intergenic
1084246284 11:67859567-67859589 ACATGGCCACATGTTCTCTGGGG - Intergenic
1084336926 11:68463827-68463849 ACACTGCCAAATGTTTCCTGGGG - Intronic
1084572330 11:69967090-69967112 ACATTGCCCAATGTCCCCTGAGG + Intergenic
1084767437 11:71321950-71321972 CCCTTGCCCAATGTTACCTCTGG - Intergenic
1084789686 11:71465649-71465671 ACATTACCAGATGTCCCCTGGGG + Intronic
1084793866 11:71491407-71491429 ACGTTGCCTGATGTCCCCTGGGG - Intronic
1085131110 11:74039644-74039666 ACATTGCCAAGTGTATCCTGAGG - Intronic
1085276664 11:75304597-75304619 ACATTGCCAGGTGTCCCCTGGGG - Intronic
1085555823 11:77420767-77420789 ACATTGCCAAATATCCCCTGGGG - Intronic
1085786148 11:79452034-79452056 ACATTGCCAAATGTCCCCTCTGG + Intergenic
1085829560 11:79884983-79885005 AAATTGCCAAATGTCCCCAGGGG - Intergenic
1085844707 11:80051739-80051761 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1085900879 11:80698851-80698873 ACATTGCCAAATGTGCCCTGGGG + Intergenic
1085994431 11:81893643-81893665 ACTTTACCACATATTCCCTGAGG + Intergenic
1086029343 11:82335002-82335024 ACCTTGCCACATGTACTCAGAGG - Intergenic
1086039552 11:82459316-82459338 ACATTGCCAAATGGGCCCTGTGG + Intergenic
1086202359 11:84218730-84218752 ACATTGCCAAATGTTTCCTGAGG - Intronic
1086898390 11:92339284-92339306 AGATTGCCAAATGTCCCATGGGG + Intergenic
1087140636 11:94762353-94762375 ACATTGCCAAATGTCCCCTAGGG - Intronic
1087240126 11:95765212-95765234 ACATTGCCAAATATCCCCAGGGG + Intergenic
1087283681 11:96241426-96241448 ACATTGCCAAATGTCTCCTGGGG - Intronic
1087297702 11:96396865-96396887 ACATTGCCAGATGTCCCCTGGGG + Intronic
1087698478 11:101408592-101408614 ACAATGTCAAATGTCCCCTGTGG - Intergenic
1087779890 11:102290830-102290852 ACATTGCCAAATGTCCCCCGGGG - Intergenic
1087858679 11:103126373-103126395 ATATTGCCAAATGTTCCCTGAGG + Intronic
1087923829 11:103896822-103896844 ACATTGCCAAATATCCCCTGGGG - Intergenic
1088136620 11:106563227-106563249 ACATTGCCAATTGTCTCCTGGGG - Intergenic
1088148488 11:106714697-106714719 ACATTGCCAAATGTCCACTGAGG - Intronic
1088313441 11:108484178-108484200 ACATTGGCAAATGTCCTCTGAGG + Intronic
1088941993 11:114468560-114468582 ACACTTCCAAATGTCCCCTGGGG - Intergenic
1088979913 11:114852934-114852956 ACATTGCCAAGTGTCCCCTGGGG + Intergenic
1089477649 11:118778441-118778463 AAATTGCTAAATGTCCCCTGGGG + Intronic
1089709776 11:120306570-120306592 ACATTGCCAAATGTCCCAGGGGG + Intronic
1090199428 11:124843576-124843598 CCCATGCCCAAAGTTCCCTGAGG - Intergenic
1090399289 11:126438539-126438561 GCACTGCCAAATGTCCCCTGGGG + Intronic
1090422995 11:126588542-126588564 TCCTTGCCAAAATTTCCCTTTGG + Intronic
1090879028 11:130817041-130817063 ACATTGCCAAATGTCCCCTCAGG + Intergenic
1091060118 11:132453203-132453225 ACACTGCCAAATGTATCCTGTGG - Intronic
1091331783 11:134736458-134736480 ACATTGCCAAATGTCCCTTGAGG + Intergenic
1091551582 12:1539147-1539169 ACATTGCCAAATGTCCCGTGGGG + Intronic
1091610296 12:2001882-2001904 ACACTGCCAAATGTCACCTGGGG + Intronic
1091656652 12:2351257-2351279 ATACTGCCAAATGTCCCCTGGGG + Intronic
1091791424 12:3274204-3274226 GACATGCCACATGTTCCCTGGGG + Intronic
1091798844 12:3312093-3312115 ACATTGCCAAATGTCCCCTGAGG - Intergenic
1091953779 12:4618706-4618728 ACATTGCCAAATGTCCCCTGGGG + Intronic
1091995423 12:4989103-4989125 ACATTGCCAAATGTGCTCTAGGG - Intergenic
1092127625 12:6085984-6086006 ACCTTGGCCACTGTTCCCTTGGG - Intronic
1092240388 12:6832516-6832538 ACTTTGCCTAATGACCCCTGGGG + Intronic
1092416850 12:8296691-8296713 ACATGGCCACATGTTCTCTGGGG - Intergenic
1092861222 12:12720773-12720795 ACATTGCCAAATGTTCCCTGTGG + Intronic
1092903330 12:13080222-13080244 ACATTGTCAAATGTCCCCTAAGG - Intronic
1093000908 12:13994445-13994467 ACCTTGACAAATCTTACCAGGGG + Intergenic
1093930961 12:24954842-24954864 ACATTGCCAAATCTCCCCAGGGG - Intergenic
1094438669 12:30450934-30450956 AGCTTGCCAAATGTGACCTATGG - Intergenic
1094801970 12:34047922-34047944 ACCCTCCCAAAGGATCCCTGTGG - Intergenic
1095559152 12:43545028-43545050 ACATTGCCAAATGTCTTCTGGGG + Intronic
1095665100 12:44788550-44788572 ACCCTCCCAAAGGATCCCTGTGG - Intronic
1095669131 12:44837386-44837408 ACAATGCCAAACATTCCCTGGGG + Intronic
1095688221 12:45059958-45059980 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1095730370 12:45500164-45500186 ACCTTTCCTCATGTTCCCTGTGG + Intergenic
1095734324 12:45539979-45540001 ACATTGCCAAATGCCCCCTGTGG + Intergenic
1095905943 12:47378094-47378116 ACATTGTCAAATGTCCCCTGGGG - Intergenic
1096084479 12:48856572-48856594 ACGTTGCTAAATGGCCCCTGTGG - Intergenic
1096348552 12:50873650-50873672 ATGTTACCAAATGTTCCCTGGGG - Intronic
1096608488 12:52785045-52785067 ACATTGCTATATGTTCCCTGGGG + Intergenic
1096644349 12:53021996-53022018 ACATTGCCAGAAGTCCCCTGTGG - Intronic
1096725486 12:53558190-53558212 ACATTGTCAAATGTCCCATGGGG - Intronic
1096872470 12:54602092-54602114 ACCTTCCCACCTCTTCCCTGGGG + Intergenic
1096970290 12:55660020-55660042 ATATGGCCAAATGTCCCCTGAGG + Intergenic
1097943495 12:65339328-65339350 ACATTCTCAAATATTCCCTGGGG + Intronic
1098049715 12:66440827-66440849 ACCTCACCAAATGTCCCCTGGGG + Intronic
1098170543 12:67742448-67742470 ACCTTACTAAATATTCCCTGGGG + Intergenic
1098462509 12:70747943-70747965 ACACTGCCAAACGTTTCCTGAGG - Intronic
1098549637 12:71749047-71749069 ATATTACCAAATGTTCCCTGAGG + Intergenic
1098910216 12:76201465-76201487 ACATTGCCACATGTCCCCTGGGG + Intergenic
1098915826 12:76255861-76255883 ACATTGCGAAATGTTCTCTGGGG - Intergenic
1098928589 12:76382528-76382550 ACATTGCCAAATGTCTCCTGAGG + Intronic
1098942250 12:76551328-76551350 ATATTGCCAGATGTTCCCTGGGG - Intronic
1099019234 12:77382459-77382481 GATTTGCCAAATGTTCCCTGGGG + Intergenic
1099038024 12:77614256-77614278 ACATTGCCAAATGTCCTCTGGGG + Intergenic
1099070011 12:78034267-78034289 ATATTGCCAAATGTCCCTTGGGG + Intronic
1099096140 12:78377835-78377857 ACATTGCCAAATGTCCCTTCTGG - Intergenic
1099279199 12:80622400-80622422 ACTTTGCCAAATATCCCCTGGGG - Intronic
1099463621 12:82955242-82955264 ACATTGCCAAATATCCCCTGGGG + Intronic
1099839843 12:87951763-87951785 ACATTGCCAAATATTCCCTAGGG + Intergenic
1099975065 12:89537934-89537956 ACATTGCCAAATGTCCCATGTGG - Intergenic
1100157074 12:91812652-91812674 ACATTGCCAGATATCCCCTGAGG - Intergenic
1100483049 12:94997909-94997931 ACATTGCCAAATGTCCCCTTGGG - Intronic
1100494767 12:95114224-95114246 ACATTGCCAGATGTACCCTAGGG - Intronic
1100527563 12:95433800-95433822 GCATTGCCAAATGTCCCTTGTGG + Intergenic
1100571767 12:95849695-95849717 GCATTGCCAAATGTCCCCTGGGG - Intergenic
1100584088 12:95963269-95963291 ACATTGCCAAATGTCCCCTGAGG - Intronic
1100601130 12:96112298-96112320 ACATTGCCAAATGTCCCGAGGGG - Intergenic
1100603067 12:96128885-96128907 ACATTGCCATATGTCCCCTGGGG + Intergenic
1100845992 12:98658677-98658699 ACATTGTCAAATGTCACCTGGGG - Intronic
1100971651 12:100077607-100077629 ATATTGCCAAATGTCCCCTGGGG + Intronic
1101017260 12:100514592-100514614 ACATTGCTAAATGTCCTCTGGGG + Intronic
1101099244 12:101375350-101375372 ACATTGCCAAATGTCACCTGGGG - Intronic
1101110005 12:101477290-101477312 ACATCACCAAATGTACCCTGAGG - Intronic
1101203936 12:102466367-102466389 ACATTGCCAAATGTACCCCTGGG - Intronic
1101343972 12:103867682-103867704 GCCCTGCCAAATGTTCCCTGGGG + Intergenic
1101450360 12:104771660-104771682 ATCTTGGTATATGTTCCCTGTGG + Intergenic
1101723750 12:107373076-107373098 ACATTGCTAAATGTCCCCTGAGG + Intronic
1101738386 12:107481044-107481066 ACATTGCCACTTGTCCCCTGGGG - Intronic
1101865669 12:108517853-108517875 ACGTCACCAAATGTCCCCTGGGG + Intronic
1101878635 12:108611469-108611491 ACATGGCCAAATGTCCCCTAGGG + Intergenic
1101895139 12:108750836-108750858 ACACTGCCAAATGTCCCCTGGGG - Intergenic
1101918869 12:108916600-108916622 GCATTGCCAAATGTCCCCTGGGG + Intronic
1101941464 12:109102272-109102294 ACATTGCCAAAAGTCCCTTGGGG + Intronic
1102068833 12:110000556-110000578 ACATTGCCAAATGTCCCCGGGGG - Intronic
1102137311 12:110586139-110586161 ATATTGCCAAATGTCCCCTGGGG + Intergenic
1102279444 12:111607430-111607452 ACATTGCCAAATGTCTCCTGAGG - Intergenic
1102545275 12:113649871-113649893 ACATTGCCAAAAGTCCCCTGGGG - Intergenic
1102545575 12:113652641-113652663 ACATTATCAAATGCTCCCTGGGG + Intergenic
1102546634 12:113662014-113662036 ATAGTGCCAAATGTTGCCTGGGG - Intergenic
1102559070 12:113749285-113749307 ACATTGCCAGATGTCTCCTGGGG - Intergenic
1102598134 12:114008520-114008542 ACATTGTCAAATGTCCCCTGGGG - Intergenic
1102654692 12:114471992-114472014 ACATTGTCAAATGTCCCCTGGGG + Intergenic
1102706729 12:114887558-114887580 GCATTGCCAGATGTCCCCTGGGG - Intergenic
1102791750 12:115652200-115652222 ACATTGCCAAATGTCCCTTGCGG - Intergenic
1102841621 12:116131109-116131131 CCATTGCCAAATGTCCTCTGGGG + Intronic
1102894856 12:116590759-116590781 ATGTTGCCAAATGTCCCCTGGGG + Intergenic
1102902886 12:116652174-116652196 ACATTGCCAAGTGTCCCCTGGGG - Intergenic
1102908671 12:116696401-116696423 ACATTTCGAGATGTTCCCTGGGG - Intergenic
1102910114 12:116707279-116707301 ACATTGCCAAATATCCCCTGGGG + Intergenic
1102910911 12:116713178-116713200 ACATTGCCAAATGTTCCCTGGGG + Exonic
1102976294 12:117209226-117209248 ACATTGCCCAATGTCCCCAGGGG - Exonic
1103003538 12:117404470-117404492 ACATTGCTAAATATTCCTTGGGG + Intronic
1103025408 12:117569974-117569996 ACATTGCCAAATGTTCCCTGGGG - Intronic
1103028704 12:117594795-117594817 ACATTGCCAAATGTCCCCTAGGG - Intronic
1103033478 12:117637285-117637307 ACATTGTCAAATGTGCCCCGAGG - Intronic
1103044740 12:117726609-117726631 ACATTGCCAAATGTTGTCTAGGG + Intronic
1103057836 12:117835630-117835652 ACACTGTCAAATGTCCCCTGCGG - Intronic
1103101802 12:118182509-118182531 ATATTGCCAAATGTTCCCTTGGG + Intronic
1103192240 12:119011454-119011476 ACCGTGCCAAATGTCCCCTGGGG + Intronic
1103259803 12:119576887-119576909 ACATTGCCCAATGTCCCCTAAGG - Intergenic
1103299446 12:119916836-119916858 ACATTGTCAAATGTCCCCTCGGG + Intergenic
1103766925 12:123287016-123287038 ACGTTGGCAAATGTCTCCTGGGG - Intergenic
1103790745 12:123469102-123469124 AGACTGCCAAATGTCCCCTGGGG + Intronic
1103809951 12:123605357-123605379 ACATTGTCAAATGTTCCCTCAGG + Intronic
1104089179 12:125500436-125500458 ACATTGCTAACTGTTCCCTGGGG + Intronic
1104262034 12:127193526-127193548 GTATTGCCAAATGTTCCCTGGGG + Intergenic
1104303899 12:127592064-127592086 ACATTGCTAAATGTCCCCTGGGG + Intergenic
1104336052 12:127896580-127896602 ACATTGCCAAATGTCTTCTGTGG - Intergenic
1104388930 12:128375148-128375170 ATCTTACCAAATGTCCCCTGTGG + Intronic
1104542133 12:129675658-129675680 ACATTACCAACTGTCCCCTGGGG - Intronic
1104570690 12:129922774-129922796 ACATTACCAAATATACCCTGAGG - Intergenic
1104884913 12:132101060-132101082 ACATTGCCTGATGTCCCCTGCGG + Intronic
1104964009 12:132501004-132501026 TCCTGGCCACATGGTCCCTGGGG - Intronic
1105374353 13:19830096-19830118 ACATTGCCAAATGTCCCCATGGG + Intronic
1105544353 13:21340817-21340839 ACCTTCCCAAGTGTCCCCAGTGG + Intergenic
1105940450 13:25142738-25142760 ACATTGCCAAATGTCTCCTGGGG - Intergenic
1106006535 13:25775328-25775350 ACCTTGCCAGGTGATCGCTGAGG + Intronic
1106274537 13:28191409-28191431 ATATTACCAAATGTTCTCTGGGG - Intronic
1106443237 13:29799257-29799279 ACATTGCCAAATGTCTCCTAGGG + Intronic
1106708261 13:32304524-32304546 ACATTGCCAGATGTCCACTGGGG - Intronic
1107033790 13:35879924-35879946 ACATTCCCAAATGTCCTCTGAGG + Intronic
1107035732 13:35900778-35900800 ACACTGCCAAATGTACCTTGGGG + Intronic
1107077122 13:36334554-36334576 ACATTGTCAAATGTTCTCTGGGG + Intronic
1107164703 13:37270820-37270842 ACATTGTCAAATGTCCCCAGTGG - Intergenic
1107595185 13:41956269-41956291 ACATTGCTAAATGTCCCCTGAGG + Intronic
1107597361 13:41976765-41976787 ACATTGCCAGCTGCTCCCTGGGG - Intergenic
1107674954 13:42785963-42785985 GCATTGCCAAATGTCCCCTGGGG + Intronic
1107715974 13:43199765-43199787 ACATTTCCAAAAGTCCCCTGGGG - Intergenic
1107813965 13:44227652-44227674 ACATTGCCAAATGTGCCCCAGGG - Intergenic
1107866454 13:44707902-44707924 AGATTGCCAAATATCCCCTGGGG - Intergenic
1107978906 13:45715611-45715633 ACATTGCTGAATGTCCCCTGGGG + Intergenic
1108408781 13:50127754-50127776 CCCGGGCCAAAAGTTCCCTGCGG - Intronic
1108583064 13:51843939-51843961 ATATTGCCAAATGTGCCTTGGGG - Intergenic
1108711810 13:53040583-53040605 GCATTGCTAAATGTTCCCTGGGG - Intronic
1108753808 13:53475916-53475938 ATATTGCCAAATGTACCCTGGGG - Intergenic
1109391245 13:61696527-61696549 ACATTGCCAAATGTCACCTCTGG + Intergenic
1109751431 13:66698317-66698339 ATATTGCTAAATGTCCCCTGTGG + Intronic
1110095496 13:71513903-71513925 AACTTGCCATATGGCCCCTGTGG - Intronic
1110146177 13:72193093-72193115 ACATTGCCAAATATCCTCTGGGG - Intergenic
1110241390 13:73271088-73271110 ACATTGCCACATGTCTCCTGGGG + Intergenic
1110466831 13:75812050-75812072 ACATTGCCAAATGTCTCCTGGGG - Intronic
1110556953 13:76870509-76870531 ACATTGCCAAATATTCCCTGGGG + Intergenic
1111708837 13:91785384-91785406 ACATTGCCAGCTGTCCCCTGGGG + Intronic
1111782897 13:92752291-92752313 ACATTGACAAATGATCCCTGGGG + Intronic
1111948233 13:94687919-94687941 ACATTGCCAAATGTTCTCCTGGG + Intergenic
1112017285 13:95341714-95341736 GCATTGCCGAATGTCCCCTGGGG - Intergenic
1112030506 13:95452277-95452299 ACCCTTCAAAATGTTCCCTTTGG + Intronic
1112061719 13:95747288-95747310 ACCCTTCCATATGTTCCCAGAGG - Intronic
1112154886 13:96806451-96806473 ACATTTCCACATGTTCCCAGAGG - Intronic
1112181398 13:97084807-97084829 ACATTGTCAGATGTCCCCTGGGG - Intergenic
1112182165 13:97094308-97094330 ACATTTCCAAATGTCTCCTGGGG + Intergenic
1112241752 13:97688539-97688561 ACATTGTCAAATGTCCCCTGGGG - Intergenic
1112514364 13:100039210-100039232 ACATTGCCAAATGTTCACTGAGG - Intergenic
1112525759 13:100145401-100145423 ACATTGCCAACTGTGTCCTGGGG + Intronic
1112721883 13:102254774-102254796 ACATTGCCAAATGTCCCCTGAGG + Intronic
1113030662 13:105990525-105990547 ACATTCCCAAATGTCCCTTGTGG + Intergenic
1113072132 13:106432204-106432226 GCTTTGCCAGATGTCCCCTGGGG + Intergenic
1113112368 13:106837265-106837287 ACATTGCTGAATGTTTCCTGGGG + Intergenic
1113314094 13:109160167-109160189 ACATTGCTGAATGTCCCCTGGGG + Intronic
1113382257 13:109814465-109814487 ATATTGCCAAATGTCCCCTGGGG - Intergenic
1113641292 13:111959119-111959141 ACATTTCCAAATGTCCCCTGGGG + Intergenic
1114271999 14:21106346-21106368 ACCTTGCAAAATATCCTCTGGGG - Intergenic
1114530191 14:23390575-23390597 ACATTGCCAACTGTTCCCTGGGG - Intronic
1114572441 14:23681942-23681964 ACATTGCTAAATGTGCCTTGGGG - Intergenic
1114637121 14:24194096-24194118 ACATTGCTAAATGTCCCTTGGGG + Intronic
1115498594 14:34029885-34029907 ACACTGCCAAATGTTCCAGGGGG + Intronic
1115680239 14:35730275-35730297 ACCCTCCCAAAGGATCCCTGTGG - Intronic
1116042751 14:39705316-39705338 ACATTGCCAAATATTCCCTGAGG - Intergenic
1116283354 14:42939409-42939431 ATATTGCCAAATGTCCCCTGGGG - Intergenic
1116769510 14:49110931-49110953 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1116891924 14:50277017-50277039 ACATTGCCAAATGTTCCCCGAGG + Intronic
1117028066 14:51641897-51641919 ACATTGCCAAATGTTCTCGTAGG + Intronic
1117196186 14:53342200-53342222 ACATTGCCAAATATCCACTGTGG - Intergenic
1117274734 14:54181354-54181376 ACAGTGTCATATGTTCCCTGAGG - Intergenic
1117371294 14:55080622-55080644 ACCTTGGGAAATGTTGCCTTGGG - Intergenic
1117513783 14:56479922-56479944 TCCTTGCTAAATGTTAACTGCGG - Intergenic
1117549711 14:56822408-56822430 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1117654054 14:57936518-57936540 ACATTGTCAAAAGTTCCCTGGGG - Intronic
1117673935 14:58137295-58137317 ACATTGCTAAATGTCCCCTGGGG + Intronic
1117777751 14:59199891-59199913 ACATTGCCAAATGTCCCCTGGGG + Intronic
1117869820 14:60188358-60188380 ACATTGCCAAATGTCCTGTGTGG + Intergenic
1117959952 14:61153078-61153100 ACATTGCCAAATGTCCCCCGAGG + Intergenic
1117989461 14:61419519-61419541 ACATTGCAAAATGTCCACTGGGG + Intronic
1118333856 14:64835165-64835187 ACGTTCCCAAATGTTCCCAGAGG - Intronic
1118389786 14:65286637-65286659 ATATTGCCAAATGTCCCCTAGGG + Intergenic
1118409680 14:65465701-65465723 TCTTTGTGAAATGTTCCCTGTGG + Intronic
1118798560 14:69167875-69167897 ACATTGACAAATGTTCCCTTAGG - Intergenic
1118883910 14:69851060-69851082 ACATTGCCAAATGTTCCCTGGGG + Intergenic
1119008312 14:70956002-70956024 ACATTGCTACATGTGCCCTGGGG - Intronic
1119393115 14:74304660-74304682 ACATTGCCAAATGTCCCTTAGGG + Intronic
1119512111 14:75219899-75219921 ACATTGCCAAATATAACCTGAGG + Intergenic
1119591494 14:75892498-75892520 ATATTGCCAAATGTCTCCTGGGG - Intronic
1119669116 14:76505489-76505511 ACATTGCAAAATGTCCCCTGGGG - Intergenic
1119677833 14:76569191-76569213 ACATTGCCGAATGTCCCCTGTGG - Intergenic
1119798971 14:77425788-77425810 ACATTGCCAAATGTCTCTTGAGG + Intergenic
1119840440 14:77788746-77788768 ACATTGCCAAAGATCCCCTGGGG + Intergenic
1119983896 14:79114106-79114128 ACATTGACCAATGTTCTCTGAGG - Intronic
1120771441 14:88384801-88384823 ACATTGTGAAATATTCCCTGGGG - Intergenic
1120870119 14:89329416-89329438 ATATTGCCAGATGTTCCCTGGGG - Intronic
1120876354 14:89379501-89379523 ACCTTGGCAAGTGTGCCCTGGGG + Intronic
1121360261 14:93251040-93251062 ACATTGCCAGTTGTGCCCTGTGG - Intronic
1121489189 14:94345863-94345885 TCATCGCCAGATGTTCCCTGGGG - Intergenic
1121788217 14:96679151-96679173 ACATTGCCAAATGTCTCCTGGGG - Intergenic
1121951111 14:98171859-98171881 GCATTGTCAAATGTCCCCTGGGG + Intergenic
1122109525 14:99487454-99487476 ACATTGCCAAATGTCCCCTGGGG + Intronic
1122302982 14:100742164-100742186 ACATTGCCAAATGTCTCCTGGGG - Intergenic
1122417234 14:101556256-101556278 GCCTTGCCAGAGGTTGCCTGTGG - Intergenic
1122447441 14:101780428-101780450 ACATTGCCAAATGTCCCTTGGGG - Intronic
1122518179 14:102323191-102323213 ACATTGCCAAGTGCCCCCTGTGG - Intronic
1122775287 14:104114284-104114306 AGCTTGACAAATGCTCTCTGCGG - Exonic
1202938174 14_KI270725v1_random:112652-112674 ACATTGACAAATGTCTCCTGGGG + Intergenic
1123395024 15:19925237-19925259 ACATTGACAAATGTCTCCTGGGG - Intergenic
1124370324 15:29101015-29101037 CCATTGCTAAATGTCCCCTGAGG - Intronic
1124446731 15:29740829-29740851 ACATTGCCAGATGTTTCCTTGGG - Intronic
1124714276 15:32044700-32044722 ATAATGCCAAATATTCCCTGGGG - Intronic
1124783980 15:32661654-32661676 ACATTGTCAAATGTCCTCTGAGG + Intronic
1124984285 15:34590997-34591019 ACATTGCCAGCTGTACCCTGGGG + Intergenic
1125292473 15:38165132-38165154 ACATTGCCAAATGTTCCCTGGGG - Intergenic
1125455362 15:39853656-39853678 ACATTGCCAAATGTTCCCAGGGG - Intronic
1125473359 15:40025826-40025848 ACATTGCTAAATGTCCCCTGGGG + Intronic
1125900942 15:43346522-43346544 ACATTGCCAAGTGTCCCCTGGGG + Intronic
1125922651 15:43534718-43534740 ACCATCCCAAGAGTTCCCTGAGG - Exonic
1126006826 15:44265959-44265981 ACATTGCCAAAAGTCCCCTGAGG + Intergenic
1126041270 15:44593536-44593558 ACCTTACCTACTGTTGCCTGTGG + Intronic
1126056573 15:44735527-44735549 TCATTGCCAAATGTCTCCTGGGG - Intronic
1126369009 15:47926232-47926254 ACATTGCCAGATGTTCCTTGGGG - Intergenic
1126671064 15:51115300-51115322 ATATTGCCAAATGTCTCCTGGGG + Intergenic
1126885699 15:53147353-53147375 ATCTTGTAAAATGTTCCCTAGGG + Intergenic
1126999206 15:54482096-54482118 GCTTTACCACATGTTCCCTGGGG + Intronic
1127135046 15:55911162-55911184 ACATTGCCAGATGTCCCCTAGGG - Intronic
1127389777 15:58496149-58496171 ATATTGCCAAATGTCCCATGGGG - Intronic
1127435864 15:58957601-58957623 ACATCTCCAAATGGTCCCTGGGG + Intronic
1127532671 15:59860054-59860076 ACATTGCCAAGTGTTCTTTGGGG - Intergenic
1127604019 15:60568074-60568096 ACACTGATAAATGTTCCCTGGGG + Intronic
1127637186 15:60882255-60882277 ACATTGCCAAATATACCCTAGGG - Intronic
1127710458 15:61592114-61592136 ACATTGCCAAATGTCCCCTGTGG + Intergenic
1127799613 15:62466510-62466532 ACATTGCCAAATGTTCCCTGTGG + Intronic
1128386598 15:67153592-67153614 ACATTGCCAAATGTCCCCTGGGG - Intronic
1128394882 15:67214532-67214554 AGACTGCCAAATGTCCCCTGGGG + Intronic
1128570194 15:68728105-68728127 ATATTGCCCAATGTCCCCTGGGG + Intergenic
1128636387 15:69305237-69305259 ACATTGCCAAATGTCCTCTCGGG + Intronic
1128636929 15:69308588-69308610 ACATTGCCAAATGTCCACTGGGG + Intronic
1128697568 15:69780042-69780064 ACTTTGCCAAATGTCTCCTACGG - Intergenic
1128925698 15:71653433-71653455 ACATTGCCAAATGTTCCCCATGG - Intronic
1129504151 15:76067020-76067042 AAATTGCCAAATGTCCCCTAGGG + Intronic
1129623000 15:77166547-77166569 ACATTGTCAAATGTGCCCCGGGG + Intronic
1129799574 15:78403850-78403872 ACACTGCCAAATGTCCCCTGTGG - Intergenic
1129817822 15:78570936-78570958 ACATTGTCAGATGTGCCCTGGGG + Intronic
1129876679 15:78979897-78979919 ACATTGCCAAATGTCCACTAGGG - Intronic
1129929818 15:79401456-79401478 ACATTGCCAAATGTCCCCTGGGG - Intronic
1130001885 15:80054931-80054953 ACATTGCCAAATGTCCTGTGGGG + Intergenic
1130079885 15:80723709-80723731 ACATTGCCACAGGTTTCCTGGGG + Intronic
1130221441 15:82022781-82022803 ACATTGCCAAATGTTCCCGAGGG - Intergenic
1130233349 15:82113247-82113269 ACATTGCCAAATGTCCCTGGGGG + Intergenic
1130660354 15:85826777-85826799 ACCTGGCCATAAGTTCCCTCAGG - Intergenic
1130693483 15:86106495-86106517 ACATTGCCAAACATCCCCTGGGG - Intergenic
1130706215 15:86235774-86235796 ACCTTGCTAATTGCTCCCTCTGG - Intronic
1130980440 15:88808569-88808591 ACATGGCCAAATGTTCCCCGGGG - Intronic
1131019005 15:89082114-89082136 ACATTGTCAAGTGTCCCCTGAGG + Intergenic
1131421732 15:92312016-92312038 ACATTGCCAAATGTCTCCTGGGG - Intergenic
1132277442 15:100581385-100581407 ACATTGTCAAATGTCCCCTGGGG + Intronic
1133355932 16:5136871-5136893 ACATGGCCACATGTTCTCTGGGG - Intergenic
1133443354 16:5838956-5838978 ATATTGCCAAATGTCCTCTGGGG - Intergenic
1133457318 16:5953964-5953986 ACATTTCCAAATGTCCCCTGGGG - Intergenic
1133542661 16:6771638-6771660 ACATTGCCAAATGTCTCCTGAGG - Intronic
1133603706 16:7365495-7365517 ACATTTCCGAATGTTCCCTGTGG - Intronic
1133607870 16:7405891-7405913 ACATGGCCAAATGCACCCTGGGG - Intronic
1133696868 16:8272926-8272948 ACTTTGCCAAATCTTCCTTAGGG + Intergenic
1133744774 16:8677701-8677723 ACATTGCCAGATGTGCCCTGGGG + Intronic
1133882689 16:9797895-9797917 GCATTGCCAAATGTCACCTGAGG + Intronic
1133984638 16:10659135-10659157 ACATTGCGAAATATCCCCTGAGG + Intronic
1134112183 16:11522523-11522545 ACTTTGCAAAATGTCCCCAGGGG + Intronic
1134187289 16:12094613-12094635 ACATGGCTAAATGTCCCCTGGGG - Intronic
1134289989 16:12896709-12896731 ACGTTGCCAAATGTCCCCTGAGG - Intergenic
1134363323 16:13553075-13553097 ACATTGCCAAATGACCCCTGGGG + Intergenic
1134567395 16:15263334-15263356 ACATTGCCAAATGTCCCTTATGG + Intergenic
1134568806 16:15274126-15274148 TCATTGCCAAATGTCCCCTGAGG - Intergenic
1134635128 16:15786169-15786191 ACATTGTCAGATGTTCCCTGGGG - Intronic
1134657609 16:15958993-15959015 ATGTTTCCATATGTTCCCTGGGG + Intronic
1134673634 16:16074243-16074265 ACATTGCCAGATGTGCCTTGAGG + Intronic
1134689787 16:16183670-16183692 ATCTTGCCAAATGACTCCTGGGG - Intronic
1134733629 16:16482236-16482258 TCATTGCCAAATGTCCCCTGAGG + Intergenic
1134735098 16:16493366-16493388 ACATTGCCAAATGTCCCTTATGG - Intergenic
1134774368 16:16838989-16839011 ACACGGCCAAATGTCCCCTGGGG + Intergenic
1134777171 16:16863335-16863357 ACATTACCTAATGTCCCCTGGGG - Intergenic
1134829121 16:17309297-17309319 ACATTGCCAAATGTCCCTTGGGG + Intronic
1134837745 16:17376166-17376188 ACAGTGTCAAATGTTCCCTGGGG - Intronic
1134885036 16:17783211-17783233 ACATTGCCAAATGACCCCTGTGG - Intergenic
1134932424 16:18218851-18218873 ACATTGCCAAATGTCCCTTATGG + Intergenic
1134933872 16:18230046-18230068 TCATTGCCAAATGTCCCCTGAGG - Intergenic
1135059415 16:19258298-19258320 ACATTGCCAGATGTACCCTGGGG - Intronic
1135060345 16:19266275-19266297 ACATGGCCAAATGGCCCCTGCGG - Intronic
1135134289 16:19876219-19876241 ACATTGCCAAATGTCCCCTTGGG - Intronic
1135172093 16:20193866-20193888 ATATTGCCAAATGCTCCCTGGGG + Intergenic
1135285256 16:21187644-21187666 GCATTGCCAAATGTCCCCTGGGG - Intergenic
1135392723 16:22107218-22107240 ACATTGCTAAATGTTCCCGTGGG - Intronic
1135408201 16:22213476-22213498 ACATTGCCAAATGTCCCTTGAGG + Intronic
1135738547 16:24953809-24953831 ACCTTGACAAATGTCTCCTGGGG + Intronic
1135742143 16:24985075-24985097 ACATTGCCAAATGTCCTCTGGGG - Intronic
1135802139 16:25507294-25507316 ACATTGCCAAATATCCCGTGGGG - Intergenic
1135903420 16:26488310-26488332 ACTTTATCAAATGTACCCTGGGG - Intergenic
1136588631 16:31203337-31203359 ACCTTGCCAGATGCTTCCTAGGG + Exonic
1136685140 16:31989594-31989616 ACATTGTCAAATGTCCTCTGGGG + Intergenic
1136686594 16:31998464-31998486 ACATTGCCAAGTGCCCCCTGGGG + Intergenic
1136701121 16:32143666-32143688 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136766539 16:32783796-32783818 ACATTGACAAATGTCTCCTGGGG + Intergenic
1136770236 16:32831482-32831504 ACATTGACAAATGTCTCCTGGGG + Intergenic
1136785753 16:32933129-32933151 ACATTGTCAAATGTCCTCTGGGG + Intergenic
1136787208 16:32942001-32942023 ACATTGCCAAGTGCCCCCTGGGG + Intergenic
1136801559 16:33086582-33086604 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136882567 16:33911783-33911805 ACATTGCCAAGTGCCCCCTGGGG - Intergenic
1136884018 16:33920675-33920697 ACATTGTCAAATGTCCTCTGGGG - Intergenic
1136900359 16:34030504-34030526 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136936358 16:34469391-34469413 ACATTGACAAATGTCTCCTGGGG + Intergenic
1136940391 16:34519231-34519253 ACATTGACAAATGTCTCCTGGGG + Intergenic
1136948306 16:34683707-34683729 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136955703 16:34783581-34783603 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136959428 16:34829339-34829361 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136963462 16:34879179-34879201 ACATTGACAAATGTCTCCTGGGG - Intergenic
1136967613 16:34933708-34933730 ACATTGACAAATGTCTCCTGGGG - Intergenic
1137088095 16:36154466-36154488 ACTTTGACAAATGTCTCCTGGGG - Intergenic
1137220595 16:46445898-46445920 ACATTGACAAATGTCTCCTGGGG + Intergenic
1137320078 16:47371692-47371714 ACATTGCCAGATGTTCTCAGGGG - Intronic
1138140808 16:54566989-54567011 ACATTGCCAAATGTCCTCTGGGG + Intergenic
1138148570 16:54634541-54634563 ACATTGCCAAATGTCCCCTGAGG - Intergenic
1138153340 16:54679663-54679685 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1138219168 16:55236490-55236512 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1138297520 16:55899673-55899695 ACATTGCCAAATGTCCCCTGGGG - Intronic
1138378059 16:56580530-56580552 ACATTGCCAAATGACCCCTGGGG + Intergenic
1138426985 16:56941338-56941360 ACATTGCCAAATGTCCCCTGGGG - Intronic
1138616412 16:58171038-58171060 ATTTTGCCCAATGTCCCCTGGGG + Intronic
1138624049 16:58235219-58235241 ACATTGCCAAATGTCGCCTGGGG + Intronic
1138628790 16:58276573-58276595 GCATTGCCAAATGTCCCCTTGGG + Intronic
1138921930 16:61541283-61541305 GAGCTGCCAAATGTTCCCTGGGG + Intergenic
1138928616 16:61623472-61623494 ACATTGTCAAATGTTTCCTGGGG + Intergenic
1138984639 16:62313784-62313806 ACCTTTCCAACTTTTCACTGGGG - Intergenic
1139137351 16:64220890-64220912 ACATTGTCAAATGTTGCCTAGGG + Intergenic
1139212847 16:65097586-65097608 ATCTTGCCAAATGTCCTCTGGGG + Intronic
1139270949 16:65682045-65682067 ACATTGCCAAATGTCCCCAGAGG - Intergenic
1139487827 16:67268793-67268815 GCATTGCCAAATGTCCCCTGGGG - Intronic
1139802321 16:69533250-69533272 ACATTGCCAAATGTCCCCTGCGG + Intergenic
1139866131 16:70064312-70064334 AGATAGCCAAATGTCCCCTGGGG + Intergenic
1140058027 16:71542881-71542903 ACATTGTCAAGTGTTCCCTGTGG - Intronic
1140262759 16:73395023-73395045 ATATTGCCAAATGTTCTCTATGG - Intergenic
1140491734 16:75342784-75342806 ACTGTACCAAATGTTTCCTGAGG - Intronic
1140547107 16:75821282-75821304 ACACTGCCAACTGTCCCCTGAGG - Intergenic
1140700194 16:77574553-77574575 ACATGGCCAAATTTCCCCTGGGG + Intergenic
1140924471 16:79569315-79569337 ACATTGCCAAATGTCCCTGGAGG + Intergenic
1140939224 16:79705767-79705789 ACATTGTCAACTGTCCCCTGGGG - Intergenic
1141029355 16:80574190-80574212 ACATTGCCAAACTTACCCTGGGG - Intergenic
1141101131 16:81198308-81198330 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1141219388 16:82055085-82055107 ACATTGTCAAATGTTCCCTGGGG + Intronic
1141353082 16:83317012-83317034 ACATTGCCAAATAATCCCAGGGG - Intronic
1141440012 16:84024141-84024163 ACATGGTCAAATGTTCCCTGGGG + Intronic
1141516128 16:84546350-84546372 ACATTGCCGAGTGTTCCCTGGGG + Intronic
1141605008 16:85147713-85147735 ACTGTGCTAAATGCTCCCTGGGG + Intergenic
1141875621 16:86822339-86822361 ACACTGCCAAATGTCCCCTGGGG + Intergenic
1141982599 16:87559791-87559813 TCATCACCAAATGTTCCCTGGGG + Intergenic
1203068928 16_KI270728v1_random:1046046-1046068 ACATTGACAAATGTCTCCTGGGG + Intergenic
1203072656 16_KI270728v1_random:1093589-1093611 ACATTGACAAATGTCTCCTGGGG + Intergenic
1203087984 16_KI270728v1_random:1194791-1194813 ACATTGTCAAATGTCCTCTGGGG + Intergenic
1203089444 16_KI270728v1_random:1203678-1203700 ACATTGCCAAGTGCCCCCTGGGG + Intergenic
1143078068 17:4362351-4362373 CCATTGCCAAATGTCTCCTGAGG - Intronic
1143238197 17:5420900-5420922 GCATTGCCAAATGTTCCTTGGGG + Intronic
1143988100 17:10932950-10932972 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1144049911 17:11489733-11489755 ACATTGCCAAAGGTTCTCTGGGG - Intronic
1144209225 17:13000620-13000642 ATGTTGCCAAATGTCCTCTGAGG + Intronic
1144261141 17:13522008-13522030 ACGTGGCCAAATGTCTCCTGGGG + Intronic
1144319560 17:14101011-14101033 ACAATGCTAAATGTCCCCTGGGG + Intronic
1144320043 17:14107150-14107172 ACATCACCAAATGGTCCCTGGGG + Intronic
1144487127 17:15676227-15676249 ACGTTGCCAAATGTCCCCCGGGG + Intronic
1144619145 17:16805163-16805185 ACCCTGCCAAATGTAACCTGGGG + Intergenic
1144893553 17:18510532-18510554 ACCCTGCCAAATGTAACCTGGGG - Intergenic
1144913904 17:18706088-18706110 ACATTGCCAAATGTCCCCTGGGG - Intronic
1145138672 17:20433742-20433764 ACCCTGCCAAATGTAACCTGGGG + Intergenic
1145691643 17:26747640-26747662 ACATTGACAAATGTCTCCTGGGG - Intergenic
1145708383 17:26944279-26944301 ACATTGACAAATGTCTCCTGGGG - Intergenic
1145772437 17:27503226-27503248 ACATTGCCAAATGTCCCTGGAGG - Intronic
1145837153 17:27963197-27963219 TCCTTTCCAAATGTTTGCTGAGG - Intergenic
1146209528 17:30931278-30931300 GCATTGCCAAATGTCCTCTGGGG - Intronic
1146526898 17:33574601-33574623 GCATTGCCAAATGTCCCCTGGGG + Intronic
1146595747 17:34166977-34166999 ACATTGTCAAATGTCCCCTGGGG + Intronic
1146640584 17:34537809-34537831 ACATTGCCAAATGTCCCTTGGGG - Intergenic
1146675441 17:34770416-34770438 ATATTGCCAAGTGTTCCCTGGGG - Intergenic
1146739597 17:35270832-35270854 ACATCGCCAAATGTCCCTTGGGG + Exonic
1146817909 17:35958892-35958914 AAATTGCCAAATGTTTCCTGGGG - Intergenic
1147056036 17:37836017-37836039 ACCCTGCCAAATGTAACCTGGGG - Intergenic
1147146081 17:38485275-38485297 ACATTGTCAAATGTCCTCTGTGG + Intronic
1147249056 17:39142157-39142179 ACATTGCCAAATATCCCCTGGGG + Intronic
1148813865 17:50312833-50312855 ACATTGCCAAATGTCCCATGGGG + Intergenic
1149051367 17:52309478-52309500 ATATTGCCAGATGTTCCCTGAGG - Intergenic
1149250704 17:54765789-54765811 ACATTGCCAAATGTCCTCTGTGG - Intergenic
1149269863 17:54966612-54966634 ACATCGCTAAATGTTCCCTGAGG + Intronic
1149292389 17:55229911-55229933 ACATTGGCAAATGTCCCCTGGGG + Intergenic
1149533969 17:57417635-57417657 ACCCTGACTAATGTTCGCTGAGG - Intronic
1149769751 17:59311030-59311052 ATATTGTCAAATGCTCCCTGGGG + Intergenic
1149825030 17:59820451-59820473 ACATTGCCAAATGTCACATGGGG + Intronic
1149855000 17:60074723-60074745 GCATTGCCAAATGTTCCTTGGGG - Intronic
1150054666 17:62003038-62003060 ACATTGGCAAATGTTACCTGGGG + Intronic
1150158104 17:62870982-62871004 GCCTTGCCAAAGGTCACCTGGGG - Intergenic
1150198319 17:63325203-63325225 AAATTGCCAAATGTTTCCTGGGG + Intronic
1150261684 17:63797606-63797628 ACATTGCCAGATGTTGCCTAGGG + Intronic
1150434443 17:65143117-65143139 ACATTGCCAAATGTCCCCAGAGG - Intronic
1150461931 17:65360798-65360820 ACAGTTCCAAATGTCCCCTGAGG - Intergenic
1150473424 17:65456652-65456674 ACTTTGTCACATGTCCCCTGGGG + Intergenic
1150767436 17:68013291-68013313 ATATTGCCAAATGTTACTTGGGG + Intergenic
1150837486 17:68577454-68577476 ACATTGCCAAATGTCCCCTGAGG - Intronic
1150898025 17:69236750-69236772 ACTTTGCCAAATATTTCCTGAGG - Intronic
1150966873 17:69980716-69980738 ACATTGTCAAATGGCCCCTGGGG + Intergenic
1150985744 17:70195327-70195349 ACATTGTGAAATGTTCCCAGGGG - Intergenic
1151119421 17:71775874-71775896 ACGTTGCCAAATGTTCCCTGGGG + Intergenic
1151124706 17:71832260-71832282 ACATTGTCAAATGTCCTCTGGGG - Intergenic
1151233601 17:72702360-72702382 ACATTGCCCACTGTTCCCTAGGG - Intronic
1151420354 17:73993104-73993126 ACATTGCCAAATGTCGTCTGGGG - Intergenic
1151451092 17:74198767-74198789 ACATTGCCAAATGTCCCCGGGGG - Intergenic
1151461389 17:74256258-74256280 ACATTGCCAAATGTCCCCAGGGG - Intronic
1151473995 17:74335149-74335171 ACACTGCCAAATGTTCCTGGGGG - Intronic
1151665058 17:75541052-75541074 ACCCACCCAAATGCTCCCTGGGG - Intronic
1151692505 17:75695310-75695332 ACATTGCCAAATGTCCCCTTGGG + Intronic
1151806726 17:76410322-76410344 ACATTGCCAAATGTCCTTTGAGG - Intronic
1152187759 17:78868873-78868895 ACATTGCCACATGTGCCCAGGGG - Intronic
1152306724 17:79525267-79525289 ACATTGCCAAATGTCCCCCCGGG + Intergenic
1152476955 17:80524731-80524753 ACTTTGCCAAATGTCATCTGGGG - Intergenic
1203183165 17_KI270729v1_random:85197-85219 ACATTGACAAATGTCTCCTGGGG - Intergenic
1153263208 18:3244198-3244220 ACATCGCCAAATGTTCCTTCAGG + Intergenic
1153423368 18:4934101-4934123 ACAGTGCCAAATGTCCTCTGGGG + Intergenic
1153512462 18:5870380-5870402 ACATTGCCAAGTGTTCCCTGGGG + Intergenic
1154240872 18:12653095-12653117 CCATTGCCAGATGTTCCCTAGGG - Intronic
1154520506 18:15223290-15223312 ACATTGACAAATGTCTCCTGGGG + Intergenic
1155001145 18:21687964-21687986 ACATTGCCAAATGTTCCCTGGGG + Intronic
1155013521 18:21807570-21807592 ACATTTCCAAATGTCCCTTGTGG - Intronic
1155128866 18:22909945-22909967 ACATTGCCAAATGTCCCCTGTGG + Intronic
1155899553 18:31372214-31372236 ACCTTGCCCAAGATTCACTGTGG + Intergenic
1155931992 18:31718199-31718221 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1155951493 18:31918445-31918467 ACGTTGCCAGATGTTTCCTGGGG - Intronic
1156042414 18:32837265-32837287 ATCTTCCCACATCTTCCCTGGGG - Intergenic
1156187036 18:34675270-34675292 ACATTGTCATATGTCCCCTGGGG + Intronic
1156195865 18:34773636-34773658 ACGTTCCCAAAAATTCCCTGTGG + Intronic
1156917718 18:42481141-42481163 ACATTGCCAAATTTCCCTTGAGG + Intergenic
1157176366 18:45456174-45456196 ACATAGCCAAATGCCCCCTGGGG + Intronic
1157601550 18:48896252-48896274 ACATTGCCAAGTGTCCCCTGGGG - Intergenic
1157686520 18:49646941-49646963 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1157722174 18:49933566-49933588 ACATTGCCAAATGTTCTCTTGGG - Intronic
1157741752 18:50099643-50099665 TCCTTGCCATATGTTTCCTGGGG - Intronic
1157850192 18:51041569-51041591 ATGTTGCCAAGTGTCCCCTGAGG + Intronic
1157882882 18:51338495-51338517 ACATTGCCAAATGCCCTCTGGGG + Intergenic
1157998934 18:52593807-52593829 ACATTGGCAATTGTCCCCTGAGG + Intronic
1158101992 18:53840259-53840281 ACATTGCCAAGTGTCCCCCGGGG + Intergenic
1158137416 18:54223426-54223448 ACATTGACAAATGTTCCCTGGGG + Intronic
1158507665 18:58060737-58060759 GCATTGCCAAATGTCCCCTAGGG - Intronic
1158571712 18:58602030-58602052 ACATTACCAAATGTCCCCTGGGG + Intronic
1158590128 18:58772150-58772172 ACATTGCCAAACGCTCCCTGGGG + Intergenic
1158891684 18:61878206-61878228 ACATTGCCAAATGTCCTCTAGGG - Intronic
1159019394 18:63130972-63130994 ACATTGCCAAATGTCCCCTGGGG - Intronic
1159888979 18:73936766-73936788 ACGTTGCCAAATGTCCCCTGGGG - Intergenic
1160101446 18:75923308-75923330 CCATTGCCAAATGTCCCCTGGGG + Intergenic
1160107051 18:75987905-75987927 ATATTGCCAAATGTTCACTGCGG + Intergenic
1160695519 19:482401-482423 ACATAGCCAAGTGTCCCCTGGGG - Intergenic
1161134853 19:2613665-2613687 ACATTGCCCAGTGTCCCCTGGGG - Intronic
1161142208 19:2654483-2654505 ACATTGCCTGATGTCCCCTGGGG + Intronic
1161262117 19:3343872-3343894 ACATTGCCAAGTGTCCCCTGGGG + Intergenic
1161279899 19:3440318-3440340 ACCTGGCCAAATGTCTCTTGCGG + Intronic
1161293692 19:3508773-3508795 ATACTGCCAAATGTCCCCTGGGG - Intronic
1161518948 19:4713027-4713049 ACATCGCCAAGTGTTCCTTGGGG - Intronic
1161523044 19:4736541-4736563 ACATGGCCAAGTGTCCCCTGTGG - Intergenic
1161548330 19:4895940-4895962 ACATTGCCAAATGTCCCTTATGG + Intronic
1161626778 19:5331595-5331617 ACGTTGCCAAGTGTGCCCAGGGG + Intronic
1161738187 19:6004528-6004550 ACATTGCCCAGTGTCCCCTGGGG - Intronic
1161745683 19:6058282-6058304 ACATTGCCCAGTGTCCCCTGGGG + Intronic
1161877818 19:6925472-6925494 ACATTGCCAAGTCTCCCCTGGGG - Intronic
1161908575 19:7175855-7175877 ACATTGCCAAAAGTCCCCTGGGG + Intronic
1161956967 19:7501482-7501504 ACATTGCCAAATGTTCCCTGGGG - Intronic
1162140729 19:8584268-8584290 ACATTGCCCAATGTCCCCTGGGG - Intronic
1162201122 19:9020976-9020998 ATATTGCCAACTGTCCCCTGGGG + Intergenic
1162563708 19:11433379-11433401 ACATTGCCAAATGGCCCCTGTGG + Intronic
1162786431 19:13037759-13037781 ACATTGCCAAATGTTCCCTGCGG - Intronic
1162859283 19:13493470-13493492 ACATTGCCAAAAGTCCCCTTGGG + Intronic
1163054742 19:14709888-14709910 ACATTGCCAAATGTCCCCTGGGG + Intronic
1163213535 19:15859301-15859323 ACATTGCCAGATGTCCACTGGGG - Intergenic
1163298778 19:16430009-16430031 ACATTGCCCAATGTCCCCTGGGG + Intronic
1163349200 19:16764760-16764782 ACATTGTCAAGTGTCCCCTGGGG - Intronic
1163381094 19:16969289-16969311 ACATTGCCCAATGTTCCCTGGGG - Intronic
1164050079 19:21578338-21578360 ACATTGCCAAATGCTCTCTAGGG - Intergenic
1164474514 19:28564913-28564935 GCATTGCCAAATGTCCCCTAGGG + Intergenic
1164631591 19:29765437-29765459 ACATTGTCACATGTGCCCTGGGG - Intergenic
1164994900 19:32713846-32713868 ACATAGCCAAATGTTCCCTAGGG - Intergenic
1165053111 19:33155771-33155793 ACATTGTCAAATGTCCACTGGGG - Intronic
1165652103 19:37500522-37500544 GCATTGCCAAATGTCCCCTGGGG + Intergenic
1165949395 19:39465534-39465556 ACGTTACCAAATGTCCCCTGGGG - Intronic
1167092798 19:47356172-47356194 ACATTGCCATATGTTCCCTCTGG + Intronic
1167092975 19:47357476-47357498 ACATTGCCATATGTTCCCTCTGG - Intronic
1167216034 19:48165278-48165300 ACGCTGCCAGATGTTCCCTGGGG + Intronic
1167789545 19:51665002-51665024 ACCTTGCCAAATGTCCCCTGGGG + Intergenic
1167820167 19:51920565-51920587 ACATTGCCAAATGTCACCTGGGG + Intronic
1168048699 19:53812474-53812496 CCGTTGCCAAATGTCCCCTGGGG - Intronic
1168070703 19:53949669-53949691 ACATTGCCAAATGCAACCTGGGG - Intergenic
1168243869 19:55100286-55100308 ACGTGGCCAAATGTCCCCTGGGG - Intronic
1168374126 19:55861174-55861196 ACATCCCCAAATGTCCCCTGGGG + Intronic
1168379176 19:55905845-55905867 GCATTGCCAAATGTCCCCTGGGG + Intronic
1168411413 19:56142438-56142460 ACATTGCCACATGTCCCCTGGGG - Intronic
1168435467 19:56313954-56313976 ACATTGCCAAATGTCCCCTGGGG - Intronic
1168482795 19:56735808-56735830 AACTTGCCAAATGTCTCCTATGG + Intergenic
1168523385 19:57070165-57070187 GCATTGCCAAATGTCCCCTGGGG + Intergenic
1168529577 19:57117142-57117164 ACATTGCCAATTGTCCCCTGGGG + Intergenic
1202671273 1_KI270709v1_random:55732-55754 ACATTGACAAATGTCTCCTGGGG - Intergenic
1202681631 1_KI270712v1_random:10499-10521 ACATTGACAAATGTCTCCTGGGG - Intergenic
925005192 2:437901-437923 ACCTTGCCAAATGTTCCCTGGGG - Intergenic
925248712 2:2410229-2410251 ATATTGCCAAATATACCCTGGGG - Intergenic
925528415 2:4831533-4831555 AAATTGCCAAATGTCCCCTGGGG - Intergenic
925865306 2:8221656-8221678 ACCTTCCCACCTGGTCCCTGAGG + Intergenic
926052081 2:9751785-9751807 ACATTGCCAAATGTGCCCTGGGG - Intergenic
926250333 2:11152186-11152208 ACCTTCCCAAATTGTTCCTGGGG - Intergenic
926645602 2:15287434-15287456 ACATTGTCAAATGTCCCCTGGGG - Intronic
926832737 2:16981074-16981096 CCCTTCCCCCATGTTCCCTGTGG - Intergenic
927085838 2:19673306-19673328 ACATTGCCAAATGTCCCCTGGGG + Intergenic
927147508 2:20176344-20176366 ACCTTGCCAACTGTCCCCTGGGG - Intergenic
927247541 2:20969646-20969668 ACATTGCCAAATGGTTCTTGGGG - Intergenic
927248837 2:20980432-20980454 GCATTGCCAAATGTTTCCTGGGG - Intergenic
927621094 2:24659859-24659881 ACATTGCCAAATGTCCCCTGGGG + Intronic
927815734 2:26215772-26215794 ACTTTCACAAATGTTCCTTGGGG - Intronic
928073875 2:28245057-28245079 GCATTGCCAAACGTCCCCTGAGG - Intronic
928543316 2:32304544-32304566 ATGTTGACAAATGTCCCCTGGGG - Intronic
928715188 2:34051964-34051986 ACATTGCCAAATGTCCCATAGGG + Intergenic
928997360 2:37307149-37307171 ACATTGCCAAATGTTCCCAGGGG + Intronic
929210344 2:39349994-39350016 GCTTTGCCAAATGTTCCTTGGGG - Intronic
929274175 2:40007252-40007274 ACATTGCCAAGTGTCCCCTTAGG + Intergenic
929371385 2:41228028-41228050 ACATTTCTAAATGTTCCATGGGG - Intergenic
929585085 2:43108562-43108584 ATATTGCCAAATGTCCCCTGGGG - Intergenic
929587593 2:43126182-43126204 ACATTGACGAATGTCCCCTGGGG + Intergenic
929628071 2:43430856-43430878 ACATTGCCAAATATACCTTGTGG + Intronic
929698664 2:44142343-44142365 ACATTGCCAAATATCCCCTGAGG - Intergenic
930062999 2:47306326-47306348 ACATTGCCAAATGTCCCCTGGGG + Intergenic
930202921 2:48561702-48561724 ACACTGCCAAATGTTTCCTGGGG + Intronic
930330473 2:49977284-49977306 ACATTGTCAAATGTTCCCTGGGG - Intronic
930393755 2:50793934-50793956 ACATTGTCAAATGTCCCCTGTGG - Intronic
930693245 2:54386028-54386050 ACATTGCCAAATGTCCTCTGGGG - Intergenic
931037439 2:58259167-58259189 GCATTGCCAAATGTCCCCTGGGG - Intergenic
931095399 2:58934579-58934601 ATATTGCCAAATGTTCCCTGGGG + Intergenic
931225959 2:60332548-60332570 ATACTGCCAGATGTTCCCTGGGG - Intergenic
931410939 2:62030526-62030548 ACATTGCCAAGTGTCTCCTGGGG + Intronic
931412777 2:62049421-62049443 ACATTGCCAAATGTCCCCTGGGG - Intronic
931451428 2:62370367-62370389 ACCTTGCCAAATGTCCCTGGAGG - Intergenic
931495483 2:62802240-62802262 ACATTGCCAAATATTCCCCCGGG - Intronic
931525710 2:63150320-63150342 ACATTGCCAAATGTCTCCTGGGG - Intronic
931635391 2:64336847-64336869 TTGTTGCCAAATGTACCCTGGGG + Intergenic
931910499 2:66894427-66894449 ACATTGCCAAATTGTCCCTTGGG + Intergenic
931968520 2:67560305-67560327 ACATTGTCAAATGTCCCTTGGGG + Intergenic
931980099 2:67685474-67685496 ACATAGCCAAATGTCCCCTGGGG - Intergenic
932056645 2:68452249-68452271 ACATTGCCAAATGTCTCCTGGGG - Intergenic
932179397 2:69632305-69632327 ACATTGCTAAATGTCACCTGTGG - Intronic
932417960 2:71585081-71585103 ACATTGCCCAATGTCCCCTGTGG - Intronic
932489038 2:72106809-72106831 ACATTGCCTAATGTCCCCTGGGG + Intergenic
932710221 2:74057605-74057627 ATATTGCCAAATGTCCCCTGGGG - Intronic
932745873 2:74333091-74333113 ACATTGCCAGATGTGCCCAGGGG - Intronic
932855298 2:75227461-75227483 ACATTGCCAAATGTCCCCTAAGG - Intergenic
933222313 2:79705005-79705027 ACATTGACAAATGTCCCCAGTGG - Intronic
933252729 2:80047053-80047075 ACATTGCCAGATGTCCCCTGGGG + Intronic
933704577 2:85280181-85280203 ATTTTGCCAAATGTCTCCTGGGG - Intronic
934064444 2:88327617-88327639 ACATTGCCAACTATTCCCTGGGG + Intergenic
934250137 2:90344553-90344575 ACATTGACAAATGTCTCCTGGGG + Intergenic
934259430 2:91458863-91458885 ACATTGACAAATGTCTCCTGGGG - Intergenic
934302726 2:91790784-91790806 ACATTGACAAATGTCTCCTGGGG - Intergenic
934330530 2:92061982-92062004 ACATTGACAAATGTCTCCTGGGG + Intergenic
934468753 2:94291868-94291890 ACATTGACAAATGTCTCCTGGGG + Intergenic
935050217 2:99518840-99518862 ACATTGCCAAATGTCTCCTGAGG - Intergenic
935671881 2:105562885-105562907 ACCTTGCCAAATGACTCCTGGGG + Intergenic
935760197 2:106313260-106313282 TTCTTGCCAAATATCCCCTGGGG - Intergenic
935785084 2:106541403-106541425 ACATTGTCAAATGTGCCCTGGGG - Intergenic
936411177 2:112259667-112259689 ACATTGCCAAATGTCCTCTGCGG + Intergenic
936489629 2:112958944-112958966 ATATTGCCAAATGTCCCCTGGGG - Intergenic
936551959 2:113451600-113451622 ACATTGCCAAATATTCCCTGGGG + Intronic
937132021 2:119520946-119520968 ACATTGCCAAATTTTTTCTGGGG - Intronic
937330248 2:121022162-121022184 ACATGGCCAAATCTCCCCTGGGG - Intergenic
937494490 2:122403279-122403301 ACATTGCCAAATGTTTCCTTGGG + Intergenic
937500131 2:122469394-122469416 ACATTGCCAAATATCTCCTGGGG + Intergenic
937524786 2:122754972-122754994 ACATGGTCAAATGTGCCCTGGGG + Intergenic
937625713 2:124041612-124041634 ACCCTACCATATGTCCCCTGGGG - Intronic
937723123 2:125126652-125126674 ACCTGCCCCAAGGTTCCCTGTGG + Intergenic
938461300 2:131499159-131499181 ACATTGCCAAGTGTCCCTTGAGG - Intergenic
938519861 2:132057064-132057086 ACATTGACAAATGTCTCCTGGGG + Intergenic
938786118 2:134631478-134631500 ACATTGCCAGACGTCCCCTGGGG + Intronic
938951094 2:136255192-136255214 ACTGTGCCAAATGTTTTCTGTGG + Intergenic
938985421 2:136570755-136570777 ACATTGCCAAATGTTCCTTGGGG + Intergenic
939025728 2:137011544-137011566 ACATTGCCAAATGTCTCTTGGGG + Intronic
939028189 2:137039366-137039388 ACATTGCCAAATGCCCCTTGGGG - Intronic
939059555 2:137403784-137403806 GCATTGCCAAATGTTCCCTTGGG - Intronic
939177504 2:138766405-138766427 ACATTGACAAATGTCCCCTGGGG - Intronic
939293797 2:140230251-140230273 ACATTGCCAAATGTCTTCTGGGG - Intergenic
939582353 2:143965737-143965759 ACATTGCCAAATGTCCCTGGAGG + Intronic
939635405 2:144576033-144576055 ACAGTGCCAAATGTCCCCTGGGG - Intergenic
939678151 2:145097563-145097585 ACATTGCCAAATGTCCCCAGTGG - Intergenic
939885648 2:147678459-147678481 ACATTGCCAAATGTCTGCTGTGG + Intergenic
939919811 2:148096259-148096281 ACATTGCCAAATGTGCCTGGAGG - Intronic
940287620 2:152048239-152048261 ACATTACCAAAAGTTCCCTGGGG + Intronic
940467396 2:154048357-154048379 ACATTGCCAAATGTACTCTGGGG + Intronic
940522203 2:154765174-154765196 AATTTGCCAAATGTCCCATGGGG + Intronic
940840252 2:158571692-158571714 CCCTTTCCAACTGTGCCCTGTGG - Intronic
941375413 2:164723054-164723076 ACTTTGTCAAATGTCCTCTGGGG - Intronic
941577090 2:167246862-167246884 ATCTTACCAAATGTACTCTGAGG - Exonic
941610950 2:167661634-167661656 ACATTGTCTAATGTCCCCTGGGG + Intergenic
941620918 2:167777867-167777889 ACATTGCCATATGTCCCCTGAGG - Intergenic
941770670 2:169342076-169342098 ATGTTTCCAAAGGTTCCCTGAGG + Intronic
942219988 2:173759613-173759635 ACATTTCCAAATGTCCCCTAGGG - Intergenic
942658296 2:178237759-178237781 ACATTGCCAAATGTCCCTGGAGG + Intronic
942721679 2:178959995-178960017 ACATTGCCAAATGTCCCCTGGGG - Intronic
942797773 2:179841686-179841708 ACATTACCAAATGTCTCCTGGGG + Intronic
943176277 2:184478640-184478662 ACATTGCCAAATGCAGCCTGAGG - Intergenic
943467996 2:188254144-188254166 ACTTTGCCAAATGTGAACTGGGG + Intergenic
943553144 2:189366354-189366376 ACATTGCCAATTGTCCCCTGAGG - Intergenic
943571118 2:189576538-189576560 GCATTGCCAAATGATCCCCGGGG - Intronic
943576168 2:189633512-189633534 ACTTTGCCAAATGTCCCCTAGGG - Intergenic
943614412 2:190076345-190076367 ACATTGCCAAAAGTTTTCTGGGG + Intronic
943664830 2:190598169-190598191 ACATTGCCAAATGTTTCCTGGGG + Intergenic
943730443 2:191297790-191297812 ACATTGTCAACTGTCCCCTGGGG - Intronic
944138789 2:196432144-196432166 ACCTTGCCGAATGTCCTCTAGGG + Intronic
944195805 2:197051772-197051794 ACACTGCCAAATGTCCCCTAGGG - Intronic
944306509 2:198185869-198185891 ACAATGCCAAATGTCTCCTGAGG + Intronic
944310882 2:198232672-198232694 ACACTGCCAAATGTTCCCTGGGG - Intronic
944356029 2:198788961-198788983 ACGTTACCAAATGTCCCTTGGGG - Intergenic
944370774 2:198980972-198980994 ACTTTGCCAAATGTCCCCTGGGG - Intergenic
944513281 2:200485256-200485278 ACCCATCCAAATGTCCCCTGGGG - Intergenic
944612103 2:201421545-201421567 ACATTGTCAGATGTCCCCTGGGG + Intronic
944689047 2:202143017-202143039 ACCCTGCCAAATGCCCACTGGGG + Intronic
944816014 2:203376198-203376220 ACATTGCCAAATGTCCCCTTGGG - Intronic
944983579 2:205149819-205149841 ACATTGCCAAATGTTACCTGGGG - Intronic
945088083 2:206154345-206154367 ACATTGCTAAATATTCCCTGGGG - Intronic
945183009 2:207111079-207111101 ACATTGCTAAATGTTCCCTGAGG + Intronic
945635492 2:212344369-212344391 ACCTTGCTAAATGTCCCCTAAGG + Intronic
945635583 2:212345399-212345421 ACATTGCTAAATGTCTCCTGTGG - Intronic
945854969 2:215058198-215058220 ACATTGCCAAATGTCCCCCGGGG - Intronic
945878671 2:215304664-215304686 ACATTGCCAAATGTCTCCTGTGG - Intergenic
945936675 2:215909457-215909479 ACCTTCCCAAATTGCCCCTGGGG + Intergenic
945939456 2:215933523-215933545 ATATGGCCAAATGTCCCCTGGGG + Intergenic
946101262 2:217326484-217326506 ACATTGCCAAATGTCCCCTGAGG + Intronic
946199206 2:218061704-218061726 ACTTTGTAGAATGTTCCCTGTGG + Intronic
946344657 2:219099365-219099387 ACCTTGCCAAATGTTCTCTGTGG + Intronic
946352269 2:219162895-219162917 ACATTGCCAAATGTCCCCATGGG + Intronic
946642309 2:221797517-221797539 AGCCTTCCAAATGCTCCCTGTGG + Intergenic
946673434 2:222131150-222131172 ACATTGCCAAATGTCCTCTGGGG - Intergenic
946697170 2:222371570-222371592 ATATTGCCAAATGTCCACTGGGG + Intergenic
946935341 2:224714467-224714489 GCATTGCCAAATGTTGCCTTGGG - Intergenic
947017487 2:225637521-225637543 AACCTGGCAAATGTTCCCCGGGG - Intronic
947025669 2:225735014-225735036 ACATTGCCAGAGGTCCCCTGGGG - Intergenic
947095307 2:226560563-226560585 ACATTTCCAAATGTCCCTTGTGG + Intergenic
947113796 2:226747819-226747841 ACATTGCCAGATGTTCCCTGTGG - Intronic
947150893 2:227114196-227114218 ACATTACCAAATGTCCCCTGGGG - Intronic
948258599 2:236586342-236586364 ACATTGACAAATGTCTCCTGGGG - Intergenic
948269387 2:236662693-236662715 ACATTGCCAAGTGTCCCTTGGGG - Intergenic
948413329 2:237781850-237781872 ACATTGCCAAATGTCCACTGCGG + Intronic
948642054 2:239381819-239381841 ACACTGACAAATGTCCCCTGGGG + Intronic
948710722 2:239823323-239823345 ACCTTGCCACATTTACCCGGAGG + Intergenic
948796306 2:240403940-240403962 ACTTTGCCAGATGTTCCCTGGGG - Intergenic
1168907502 20:1417921-1417943 TCTTTGCCAATTGGTCCCTGGGG + Intergenic
1169098159 20:2922075-2922097 ACACTGCCATATGTTCCCTAGGG + Intronic
1169303503 20:4468044-4468066 ATTTTGACAAATGTTCCATGTGG - Intergenic
1169675067 20:8144013-8144035 ACATAGCCAAAAGTCCCCTGGGG + Intronic
1169682496 20:8231392-8231414 ACATTGTCAAATGTTCCCTGGGG + Intronic
1169708572 20:8535587-8535609 CCTTTGCCAAATGTCCACTGGGG - Intronic
1169989734 20:11488021-11488043 ACATTATCAAATGTCCCCTGGGG + Intergenic
1170003670 20:11642750-11642772 ACCTTGCAGTATGTTCCATGGGG + Intergenic
1170095397 20:12640458-12640480 ACCATGCCAAATGCACACTGGGG - Intergenic
1170164600 20:13348008-13348030 ATATTGCCAAATGTCTCCTGGGG - Intergenic
1170349947 20:15427869-15427891 ACATTGTCAAATGTTCCCAGGGG - Intronic
1170531602 20:17298358-17298380 ACATTGCCAAGTGTCCCCTGGGG - Intronic
1170555994 20:17515039-17515061 ACACTGCCAAATGTCCCCTTGGG - Intronic
1170585995 20:17734614-17734636 ACATTGCCAAATGTCCCTTGGGG - Intronic
1170849483 20:19991535-19991557 ACAGTGCCAAATGTCCCCTGGGG + Intronic
1171021479 20:21588162-21588184 ACATTCCCAAATGTCTCCTGGGG - Intergenic
1171021957 20:21592643-21592665 ACATTGCCAAATGTCCACTGGGG + Intergenic
1172273912 20:33669621-33669643 CCCTTGCCACACGTACCCTGGGG + Intronic
1172935433 20:38616756-38616778 ACCTTGCCAAATGTTCCCTGGGG - Intronic
1172962973 20:38811680-38811702 ACATTGCCAAATATCCCCTGGGG - Intronic
1173073445 20:39792910-39792932 GCATTGCCAAATGTTCTCTGGGG - Intergenic
1173077950 20:39838854-39838876 ACATTGCCAGATGTCACCTGAGG + Intergenic
1173507931 20:43603377-43603399 AGATTGCCACATGTTCCCTCAGG - Intronic
1173591355 20:44227560-44227582 GCATTGCCAAATGTCCCCTCAGG - Intergenic
1173703861 20:45095907-45095929 ACGTTCCCAAATGTCCCTTGCGG - Intronic
1173851228 20:46219600-46219622 ACATTGTCAAATGGACCCTGGGG + Intronic
1173946977 20:46959437-46959459 ACATTGCCAAGTGTTCTCTGTGG + Intronic
1173948432 20:46970367-46970389 ACATTGCAAAATGTCCCCTGGGG - Intronic
1174036156 20:47669500-47669522 ACATTGCCAAGTGTCCCCTGGGG + Intronic
1174041826 20:47705608-47705630 ACATTGCCAAGTGTCTCCTGGGG - Intronic
1174082010 20:47977191-47977213 ACATTGCCAAATGTCCTCTGGGG + Intergenic
1174134470 20:48369612-48369634 ACATTGCCAAATGTCCTCTGGGG - Intergenic
1174173005 20:48628640-48628662 ACATTGCCAAATGTTCCCCGGGG + Intronic
1174191553 20:48744222-48744244 ACATTGCCCATTGTCCCCTGGGG + Intronic
1174200975 20:48806161-48806183 ACATTGCCATATGTCCCCTTTGG + Intronic
1174212646 20:48892104-48892126 ACATTGCCAAGTGTCCCCAGGGG + Intergenic
1174276385 20:49407609-49407631 ACATTGCCAAATGTCCCCTGGGG - Intronic
1174283474 20:49455843-49455865 ACAATGCCAAATGCTCTCTGAGG + Intronic
1174429943 20:50460504-50460526 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1174432001 20:50477166-50477188 ACTTTGCCAGATGTCCTCTGGGG - Intergenic
1174433024 20:50484573-50484595 ACATTGTCAAATGGCCCCTGGGG + Intergenic
1174433928 20:50491805-50491827 ACGTTGTCAAATGTCCCCTGGGG + Intergenic
1174481352 20:50833543-50833565 ATGTTGCCAAATGTCCCCTGGGG + Intronic
1174563953 20:51451378-51451400 ACCTTGCCAAATTTGCCCTGGGG - Intronic
1174605285 20:51757016-51757038 ACATTGCCAAGTGTCCTCTGGGG - Intronic
1174672166 20:52318522-52318544 ACAATGCCAAATGTCCTCTGGGG + Intergenic
1174699855 20:52597405-52597427 ACATTGCCAGATATCCCCTGAGG - Intergenic
1174705220 20:52648180-52648202 ACATTGCCAAATGCCCACTGGGG + Intergenic
1174708880 20:52684586-52684608 ATATTGCCAAATGTCCCTTGGGG - Intergenic
1174725048 20:52852512-52852534 ACACTGCCAAATATTCCCTGGGG - Intergenic
1174781120 20:53389723-53389745 ACATTGCCAAATGTCCCCTGGGG - Intronic
1174866491 20:54141509-54141531 ACATTGTCAGATGTCCCCTGGGG - Intergenic
1174878622 20:54252515-54252537 ACATTACCAAATGTTCCCTGGGG - Intergenic
1174904245 20:54533275-54533297 ACATTGTCAAATGTCCACTGGGG + Intronic
1174923742 20:54733651-54733673 GCATTGCCAGATGGTCCCTGAGG + Intergenic
1174941936 20:54938897-54938919 ACATTGCCAAATATTCCCTTGGG + Intergenic
1174961778 20:55165984-55166006 ACCTTGCCAAATGTCTCTTGGGG + Intergenic
1175019128 20:55825866-55825888 ACATTGCCAAATGTTGCAAGAGG - Intergenic
1175026856 20:55911569-55911591 ACATTGCCAAAAGTCCGCTGTGG + Intergenic
1175058342 20:56218625-56218647 ACATTGCCACATGTCCCCTGGGG + Intergenic
1175062427 20:56255863-56255885 ACATTGCCAAATGTTCTCAGGGG + Intergenic
1175105708 20:56613307-56613329 ACCTAGCTGAATGTCCCCTGGGG + Intergenic
1175135377 20:56819454-56819476 ACGTTGCCAGGTGTCCCCTGGGG + Intergenic
1175139961 20:56853718-56853740 TCATTGGCAAATGTCCCCTGGGG + Intergenic
1175158423 20:56990088-56990110 ACATTGCCAAGTGTCCACTGGGG + Intergenic
1175182820 20:57160571-57160593 ACATTGCCACGTGTCCCCTGGGG - Intergenic
1175197261 20:57252866-57252888 ACATTGCTAACTGTACCCTGGGG - Intronic
1175207391 20:57321863-57321885 ACATTGCCAAATGTCCTTTGAGG + Intergenic
1175305500 20:57973198-57973220 ACATTGTCAAATGCCCCCTGTGG + Intergenic
1175413431 20:58786124-58786146 GACTTGCCAAATGTCCCCGGGGG - Intergenic
1175417228 20:58809936-58809958 ACATTGCCAAATGCTCCCCTGGG + Intergenic
1175423241 20:58849084-58849106 ACTTTGCTAAATGTCCTCTGGGG - Intronic
1175431047 20:58903337-58903359 AACCTCCCAAATGTGCCCTGAGG - Intronic
1175554723 20:59841726-59841748 ACATTGCCAAATGTCCCTCGGGG - Intronic
1175571594 20:60026873-60026895 GCCTTGACAAAGCTTCCCTGTGG - Intronic
1175574123 20:60047827-60047849 ACTTTGCCAAATATCCGCTGGGG + Intergenic
1175748880 20:61481168-61481190 ACCCTACCACGTGTTCCCTGGGG - Intronic
1175771526 20:61627519-61627541 ACATCGCCAAGTGTCCCCTGCGG + Intronic
1175792640 20:61751311-61751333 CCACTGCCAAATGTTCCCTGGGG + Intronic
1176585142 21:8576484-8576506 ACATTGACAAATGTCTCCTGGGG - Intergenic
1176590958 21:8651036-8651058 ATGTTGCTAAATGTCCCCTGTGG - Intergenic
1176672463 21:9747237-9747259 GCTTTGTCAAATGTCCCCTGTGG + Intergenic
1176776774 21:13143464-13143486 ACATTGACAAATGTCTCCTGGGG - Intergenic
1177151290 21:17457827-17457849 ACATGGCCAAATGTCCTCTGGGG + Intergenic
1177258756 21:18700870-18700892 CCCTTGCCAAAAGCCCCCTGGGG + Intergenic
1177420805 21:20854063-20854085 ATGTTGGCAAATGTTCCCTGGGG - Intergenic
1177644603 21:23885873-23885895 AAATTGCCAAATATTCCCGGGGG + Intergenic
1177817539 21:25993770-25993792 ACATTGCTAAATGTGCCCAGGGG - Intronic
1178083936 21:29094120-29094142 CCATTGCCAAATATCCCCTGGGG - Intronic
1178132175 21:29586037-29586059 ACATTTCCAAATGTTCCCTGGGG + Intronic
1178723899 21:35034557-35034579 ACATTGCCAGATGACCCCTGAGG - Intronic
1178753183 21:35323620-35323642 ATATTGCCAAATGTGCCCCGGGG - Intronic
1178847147 21:36183290-36183312 ACATTGCCAAATGTCCCCTGGGG + Intronic
1178894374 21:36546893-36546915 ACATTGCCAAATGTCCTCTTAGG - Intronic
1178905864 21:36635467-36635489 GCATTGCCAAATGCCCCCTGAGG - Intergenic
1179042610 21:37817116-37817138 ACCTTGACAACAGTTCCGTGAGG - Intronic
1179071039 21:38071245-38071267 GCAGTGCCAAATGTCCCCTGGGG + Intronic
1179086560 21:38223395-38223417 ACTTTGACAAATGTCCCTTGGGG - Intronic
1179146017 21:38768468-38768490 ACATTGTCAAATGTCCCCCGGGG - Intergenic
1179167767 21:38947964-38947986 AAGGTGCCAAATGTCCCCTGGGG + Intergenic
1179191594 21:39126703-39126725 ATATTGCCAAATGTCCCCAGGGG - Intergenic
1179291544 21:40022206-40022228 ACTTTGCTACATGTCCCCTGGGG - Intronic
1179397599 21:41056010-41056032 ACACTGCCAAATGTGCCCTCGGG + Intergenic
1179590231 21:42403266-42403288 ACATTTCCAAATGTCCCCTTGGG + Intergenic
1180267951 22:10553384-10553406 ACATTGACAAATGTCTCCTGGGG - Intergenic
1181103832 22:20559986-20560008 ACATTGTCAAATATCCCCTGTGG - Intronic
1181114661 22:20623870-20623892 ATATTGCCAAGTGTCCCCTGAGG + Intergenic
1181879242 22:25964677-25964699 ACATTACCAAATGTCCCCTAAGG + Intronic
1181880540 22:25976054-25976076 ATATTTCCTAATGTTCCCTGGGG - Intronic
1181882401 22:25991452-25991474 ACATGACCAAATGTCCCCTGGGG + Intronic
1181921052 22:26320787-26320809 ACATTGGCAAGTGTCCCCTGGGG - Intronic
1182120180 22:27781439-27781461 ACATTGCCAAGTATGCCCTGGGG + Intronic
1182227342 22:28809182-28809204 ACATTGCAGAATGTCCCCTGGGG + Intergenic
1182250641 22:28997346-28997368 ACATTGCCAAGTATCCCCTGGGG - Intronic
1182375773 22:29846701-29846723 ACACTGCCATATGTCCCCTGTGG - Intergenic
1182401132 22:30078960-30078982 ACTTTGCCAAATGTCCCATGGGG - Intergenic
1182414630 22:30213379-30213401 ACCTGGCCAAAGCCTCCCTGGGG - Intergenic
1182416164 22:30222761-30222783 ACATTGTCAAGTGTGCCCTGGGG + Intergenic
1182454030 22:30438479-30438501 TCCTCTCCAAATGTTCCCTCTGG + Intergenic
1182540327 22:31036736-31036758 ACACTGCCAAATGCCCCCTGGGG - Intergenic
1182655002 22:31883160-31883182 ACATTGCCAAATGTCCCCTGGGG + Intronic
1182756174 22:32681384-32681406 ACATTGCCAAATATCCCCTGGGG - Intronic
1182859907 22:33550365-33550387 GCGTTGCCAAATGTCCCCTGAGG - Intronic
1182886098 22:33775514-33775536 ACATTGCCAAATGTCCCCTGGGG - Intronic
1182888826 22:33799158-33799180 ACCTTGCAAAATGTTCTCAGTGG + Intronic
1182919399 22:34065505-34065527 ACATTGCCAAATGTTCCCTGGGG - Intergenic
1183020512 22:35022691-35022713 ATATTGCCAAGTGTTTCCTGGGG + Intergenic
1183096324 22:35554334-35554356 AGATTGCCAACTGTCCCCTGCGG - Intergenic
1183258912 22:36781597-36781619 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1183355115 22:37354585-37354607 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1183355163 22:37354873-37354895 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1183763682 22:39849298-39849320 ACATTGCCAAATGTCCCCTGGGG - Intronic
1184013840 22:41770460-41770482 ACTTTACCAAATGTCCCATGGGG + Intronic
1184665991 22:45989363-45989385 ACATTGCCAAATGTCTCCCGGGG + Intergenic
1185176343 22:49329246-49329268 ACATTGCCAAGTGTCTCCTGGGG - Intergenic
1185322383 22:50207749-50207771 ACCTTGCCTGATGTCCCCTGGGG + Intronic
1203236983 22_KI270732v1_random:13679-13701 ACATTGACAAATGTCTCCTGGGG - Intergenic
1203323616 22_KI270737v1_random:94075-94097 ACATTGACAAATGTCTCCTGGGG + Intergenic
949097917 3:108560-108582 ACTTTGCCAGATGTCCCCTAAGG + Intergenic
949176517 3:1069611-1069633 ACATTGCCAGATGTCCCCTGGGG - Intergenic
949473985 3:4425050-4425072 ACATTGCTAAATGTCCTCTGAGG + Intronic
949697430 3:6715331-6715353 ACATTGTTAAATGTTCTCTGTGG - Intergenic
949753107 3:7376959-7376981 ACAATGCCAAACGTCCCCTGGGG + Intronic
949775879 3:7631770-7631792 GCTTTGCCAAATGTTCCCCAGGG + Intronic
949830843 3:8212517-8212539 ACATTGTCAAATATTCCCTGGGG - Intergenic
949894782 3:8760960-8760982 ACATTGCCAAAAGTTCACTAAGG - Intronic
949932316 3:9088598-9088620 ACATTGCCAGGTGTTCCCTGGGG + Intronic
949952035 3:9237251-9237273 ACATAGCCAAATGTCCCCTGGGG - Intronic
949952115 3:9237973-9237995 ACATAGCCAAATGTCCCCTGGGG - Intronic
950136957 3:10588272-10588294 ACATTGCCAAATGTCCCTAGGGG + Intronic
950275089 3:11653972-11653994 ACATTGCCAGATGTCTCCTGAGG - Intronic
950671940 3:14532555-14532577 ACATTGCCAAACGTGCCCTAGGG + Intronic
950678845 3:14571087-14571109 AGATTGCCAAATGTCCCCTGGGG + Intergenic
950760091 3:15214859-15214881 AAATTGCCAAATGTCCCCTGGGG - Intronic
950924715 3:16729040-16729062 ATATTGCCAAATGTCCCCTGGGG + Intergenic
950945089 3:16937097-16937119 GCATTGCCAAATGTCCCCTCAGG + Intronic
950963131 3:17126436-17126458 ATGTTGCCAAATGTTTCTTGTGG + Intergenic
951011723 3:17689741-17689763 ACATTGCCAAATGTCCCCTGGGG - Intronic
951013929 3:17708631-17708653 GCATTGCCAAATGTCCCTTGAGG + Intronic
951084351 3:18493276-18493298 TCATTGCCAAATGTCCCTTGAGG - Intergenic
951490507 3:23265639-23265661 TCCTTACCAATGGTTCCCTGTGG - Intronic
951592072 3:24277198-24277220 ACATTGCCAGATGAACCCTGGGG - Intronic
951629531 3:24704302-24704324 ACATTGCCAGATGTCCTCTGGGG + Intergenic
951688633 3:25372345-25372367 ATATTGCCAAATGGCCCCTGTGG + Intronic
951729443 3:25794754-25794776 ATATTGCCAAATGTTTTCTGGGG + Intergenic
951763079 3:26165672-26165694 AGATTGCCAAATATCCCCTGAGG + Intergenic
951802262 3:26608994-26609016 ACATTGCTCAGTGTTCCCTGGGG + Intergenic
952068551 3:29603468-29603490 ACATTGCCAAATGTCCTCTATGG - Intronic
952324073 3:32305202-32305224 TCATTACCAAATGTTCCCTAGGG - Intronic
952359489 3:32615523-32615545 AAATTGCCAAATGTTCCCTAGGG + Intergenic
952412139 3:33058960-33058982 ACATAGCCACATGTCCCCTGTGG - Intronic
952699694 3:36312816-36312838 ATATTGCCAAATGCTCCCTTTGG + Intergenic
952714040 3:36460513-36460535 AAATTGCCAAATGTCCCCTGGGG - Intronic
952755010 3:36858221-36858243 ACATTGCCAAATGTCCCTTGGGG - Intronic
952766018 3:36955106-36955128 ACTTTGCTAAATATTCCCTAGGG - Intergenic
952819707 3:37475496-37475518 CCTTTGCTAAATCTTCCCTGTGG - Intronic
953144334 3:40260576-40260598 ACATTGTCAAATATTCCCTGAGG - Intergenic
953253610 3:41268027-41268049 ACATTGCCAAATGTCTCCTGGGG - Intronic
953479436 3:43237577-43237599 ACATTGCCAAATATTCCCTGAGG - Intergenic
953610849 3:44446093-44446115 GCCTTCCCAAATGCCCCCTGGGG - Exonic
953682179 3:45047823-45047845 ACCAGTCCAAATGTCCCCTGGGG + Intergenic
954570831 3:51639533-51639555 CCCTTGCCTTTTGTTCCCTGTGG - Exonic
954571222 3:51642668-51642690 ACATTGCAAAATGTCCCGTGGGG + Intronic
954592692 3:51797158-51797180 ACCTCCCCAAATTGTCCCTGGGG - Intergenic
954762976 3:52890431-52890453 ACATTGCCAACTGCCCCCTGGGG - Intronic
954789327 3:53119555-53119577 ACGTTGCCAAATGTCCCCTGGGG - Intronic
955057164 3:55465107-55465129 AACATGCCAAATGTGCCCTGGGG - Intergenic
955065293 3:55528862-55528884 ACCTTGCCAAATGTCCCTGGGGG + Intronic
955122365 3:56073443-56073465 ACATTAGCAAATGTTCCCAGGGG + Intronic
955254053 3:57311559-57311581 ACATTGCCAAATGTAACCTGGGG - Intronic
955267443 3:57460121-57460143 ACATTGTCAAATGTTCCCTGGGG - Intronic
955318969 3:57960780-57960802 ACCTTGCCATATGTCCCCGGGGG + Intergenic
955376857 3:58404495-58404517 ACATTGCTAAATGTCTCCTGGGG + Intronic
955521950 3:59783744-59783766 ACGTTGCCAAATATCCTCTGGGG + Intronic
955525124 3:59812049-59812071 ACATTGCCAAGTATCCCCTGGGG - Intronic
955531072 3:59873701-59873723 ACAATGCCAAATGTGCCCCGGGG + Intronic
955533126 3:59895031-59895053 ACATTGTCAAATGTCCCCTGTGG - Intronic
955737636 3:62056694-62056716 ACATTACCAAATGTCCCCTGGGG + Intronic
955761780 3:62292653-62292675 ACATGGCCAAATGTCCCCTGGGG - Intronic
955801177 3:62688273-62688295 ACATTGGCAAATGTCCCCTAGGG + Intronic
955981787 3:64534725-64534747 ACATTGCCAGATTTCCCCTGGGG - Intronic
955984620 3:64559720-64559742 ACCTTGCCACATATGCACTGAGG - Intronic
955985086 3:64564732-64564754 ACATTCCCAAATGTCCCATGGGG + Intronic
956017964 3:64904351-64904373 ACATTGCCAAATATAGCCTGAGG - Intergenic
956090732 3:65663858-65663880 ACATTGCCAGATGTCCCCTAGGG + Intronic
956100038 3:65758588-65758610 ACGTTGCCAGATGTCTCCTGGGG - Intronic
956102065 3:65778883-65778905 ACATCCCCAAATGTCCCCTGGGG - Intronic
956127840 3:66027916-66027938 ACGTTGCCAAATGTCCCCTGGGG + Intronic
956174823 3:66462980-66463002 ACATTGCCAAGTGTCCTCTGGGG - Intronic
956191291 3:66610782-66610804 ACATGACCAAATGTTCCTTGGGG + Intergenic
956195505 3:66650083-66650105 ACATTGCCCAATGTCCCCTGTGG - Intergenic
956228848 3:66990066-66990088 AGATTCCCAAATATTCCCTGAGG + Intergenic
956232572 3:67033499-67033521 AAATTGACAAATGTTCCCTGGGG - Intergenic
956381473 3:68668717-68668739 ACATTGCCAAATGTCACCTGGGG + Intergenic
956407599 3:68944310-68944332 ACATTGCCAAACATTCACTGGGG + Intergenic
956408703 3:68955836-68955858 ACATTGCCAAATGTCTCCTAGGG - Intergenic
956435164 3:69228059-69228081 ACATTGCTAAACGTCCCCTGAGG - Intronic
956469560 3:69552199-69552221 ATATTGTCAAATGTTCCCTGGGG - Intergenic
956660645 3:71593712-71593734 ACCTTGCCAAATGTGCCCTAGGG + Intergenic
956661076 3:71598509-71598531 ACATTACCAAATGTCCCCTGGGG - Intergenic
956680491 3:71774967-71774989 ACATTGCCAAATGTCCCCTGGGG - Intronic
956683316 3:71802137-71802159 ACATTGCCAAATGTCCCCTGGGG - Intergenic
956700657 3:71955983-71956005 ACATTGCCAAATGTCCCCTGTGG - Intergenic
956729877 3:72186855-72186877 ACATTGCCAAGTGTCCCCTGGGG - Intergenic
956734701 3:72229341-72229363 ACATTGCCAAATGTCCCCTGGGG + Intergenic
956862616 3:73339479-73339501 ATCTTGCCACATGTTCCATGGGG + Intergenic
956891636 3:73619943-73619965 ACATTGCCAAACGTCCCTTGAGG - Intronic
956893728 3:73638735-73638757 ACATTGCCAAGTGTACCTTGGGG + Intergenic
957439956 3:80232802-80232824 ACATTGCCGAATGTTTCTTGTGG - Intergenic
957817475 3:85320096-85320118 ACATTGCCAAATGTTCCCCTGGG - Intronic
957908678 3:86591920-86591942 ATATTGACAAATGTCCCCTGGGG - Intergenic
958027266 3:88063081-88063103 ACATTGCCAAATGTCTCCTAAGG - Intronic
958462063 3:94411104-94411126 ACATTGCCAAATATGCCCTGTGG - Intergenic
958898256 3:99854666-99854688 ACATTGCCAAATGTCTCCTGGGG + Intronic
959005932 3:101019846-101019868 ACATTACCAAATGTCCCTTGGGG - Intergenic
959136022 3:102422288-102422310 ACATTGCCAAATGTCTCCTAGGG - Intronic
959245821 3:103866261-103866283 ACATTGTCATATGTTCCCTGGGG + Intergenic
959350472 3:105255898-105255920 ACATTGCCAACTGTCCCCTGGGG + Intergenic
959399706 3:105884862-105884884 ACATTGCCAAACGTTCCCTTGGG - Intergenic
959596829 3:108137552-108137574 ACATTGGAAAATGATCCCTGAGG + Intergenic
960030946 3:113054355-113054377 GCATTGTCAAATGTACCCTGGGG + Intergenic
960321138 3:116238072-116238094 ATATTGCCAAATATTTCCTGGGG + Intronic
961321826 3:126082334-126082356 ACATTGCCCAATGTCCTCTGTGG - Intronic
961329248 3:126129106-126129128 ACCTTGCCCGATGTCCTCTGTGG + Intronic
961661550 3:128471243-128471265 TCATTGCCAAATGTCCCCTGGGG - Intergenic
961733586 3:128985861-128985883 ACATTGCCAGATGTTCCCTGGGG - Intronic
961922410 3:130441662-130441684 GCATTTCCAAATGTCCCCTGGGG - Intronic
961965844 3:130901863-130901885 ACATTGCCAAATGTCCCCCGGGG - Intronic
962014275 3:131424458-131424480 CTCTTGCCTATTGTTCCCTGTGG + Intergenic
962243170 3:133768416-133768438 ACATTGCCAAATGTCCCGTGGGG - Intronic
962250125 3:133830955-133830977 ACATTGCCAAATGTCCCCTGTGG + Intronic
962964657 3:140342322-140342344 AGATTGCCAAATGTCCCTTGGGG + Intronic
963099109 3:141581587-141581609 GTATTGCCAAATGTTCCTTGAGG + Intronic
963102540 3:141620856-141620878 ATACTGCCAAATGTCCCCTGGGG - Intergenic
963151659 3:142051546-142051568 ATATTGCCAAATGTCCCCTAGGG + Intronic
963205465 3:142629924-142629946 ACATTGCCAGATGTCCTCTGGGG + Intronic
963711303 3:148750770-148750792 ACATGGCCAAATGTCCCCTGGGG - Intergenic
963716550 3:148810627-148810649 ACATTGCCAAATGTTCCCTCAGG - Intronic
963720106 3:148852297-148852319 ACATTGCCAAATGTCATCTGGGG - Intronic
963733942 3:148998326-148998348 ACATTGCCAAATGTCCTTTGGGG - Intronic
963750163 3:149169649-149169671 ATGTTGCCAGATGTCCCCTGTGG + Intronic
963756775 3:149242646-149242668 GCATTGCCAAATGACCCCTGGGG - Intergenic
963842119 3:150118461-150118483 ACATTGCAAAATGTCCCCTGAGG + Intergenic
963952652 3:151220173-151220195 ACTTTGCCAAATGTCCTCTGAGG + Intronic
964559475 3:157977790-157977812 ACATTGCCAAATGTTCCGTGGGG + Intergenic
964742603 3:159983301-159983323 ACATTGCCAAGTGTCCCCTGGGG + Intergenic
964840167 3:160984847-160984869 ACATTGCCAAATGTCCCATGGGG - Intronic
965711664 3:171561812-171561834 ACATTGCCAAATGTCCCCTCAGG + Intergenic
966323763 3:178731435-178731457 ACACTGCCAAATGTCCCCCGTGG + Intronic
967718157 3:192787805-192787827 ACATTGCCATATGTCCTCTGGGG - Intergenic
967897444 3:194409782-194409804 ACAATGCCAAATGTCCCCTGGGG + Intronic
968135945 3:196219692-196219714 ACACTGCCAAATATTCCCTGGGG - Intronic
968562623 4:1292652-1292674 ACATTGCTAGATGTGCCCTGGGG + Intronic
968564685 4:1305238-1305260 ACATTGCCAGGTGTCCCCTGGGG + Intronic
969004492 4:4008371-4008393 ACATGGCCACATGTTCTCTGGGG - Intergenic
969012875 4:4081299-4081321 ATATTGCCTAATGTCCCCTGGGG - Intergenic
969064809 4:4470341-4470363 ACATTGCCAAATGTCCCCTGGGG + Intronic
969167039 4:5324672-5324694 ACATTGTCCAATGTTCCCAGGGG + Intronic
969182320 4:5451776-5451798 ACATTGCCACATATCCCCTGGGG + Intronic
969249721 4:5959053-5959075 ACATGGCCAGATTTTCCCTGGGG + Exonic
969501856 4:7558385-7558407 ACATTGCCAAGTGTCCCTTGGGG + Intronic
969748376 4:9091777-9091799 ACATGGCCACATGTTCTCTGGGG + Intergenic
969809407 4:9636336-9636358 ACATGGCCACATGTTCTCTGGGG + Intergenic
969838780 4:9865161-9865183 ACATTGCCAAATGTTCCCTGGGG - Intronic
969863408 4:10055482-10055504 ACATTGCCAAATGTCCCCTGGGG + Intergenic
969923193 4:10559999-10560021 ACTTTGTCAAAAGTCCCCTGGGG + Intronic
969966311 4:11000429-11000451 ATATTGCCAAATGTCTCCTGGGG + Intergenic
969986907 4:11221776-11221798 TAATTGCCAAATGTCCCCTGGGG + Intergenic
970228259 4:13882060-13882082 ACTTCGACAAATGTTCCCTGGGG + Intergenic
970375464 4:15452567-15452589 TCATTGCCAAATGTCTCCTGGGG + Intergenic
970476471 4:16428902-16428924 ACATTGCCAAATGTCCCCTGGGG - Intergenic
970499196 4:16660010-16660032 ACATTGCTAACTGTACCCTGCGG - Intronic
970518696 4:16861440-16861462 ACTTTGACAAGTGTTCCCTACGG + Intronic
970569162 4:17362731-17362753 ACATTGCCAGATGTTCCCTAGGG + Intergenic
970613943 4:17750632-17750654 ACATTGCCAAATGTCCCCAGGGG + Intronic
970716996 4:18937946-18937968 ACATTGCCCAATATTCCCAGTGG + Intergenic
970934152 4:21549057-21549079 ACCAGGCCAAATGTCCCCTGGGG + Intronic
970976675 4:22049745-22049767 ACATTGCTGAATGTTCCCTGGGG - Intergenic
971116173 4:23647896-23647918 ACATTGCCAAATTCCCCCTGGGG - Intergenic
971354069 4:25878754-25878776 ACATTGCCAAATGTCTCCTGGGG - Intronic
971575997 4:28275471-28275493 ACCTTCCCAACCTTTCCCTGTGG - Intergenic
971631085 4:28994728-28994750 ACATTGTCAATTGTACCCTGTGG + Intergenic
971753124 4:30676619-30676641 ACATTGCAAAATGTCCTCTGGGG + Intergenic
973138881 4:46741430-46741452 ACCTTGCTAAATGTTACCTAGGG + Intronic
973250855 4:48058465-48058487 ACATTGCCAAATGTCCCCTGGGG - Intergenic
973257085 4:48124327-48124349 GCATTGCCAAATGTTCCCTGGGG + Intronic
973576733 4:52297208-52297230 ACATTGCCAAATGTCACTTGGGG + Intergenic
973590181 4:52433289-52433311 ACATTGCCAAATGTCCTCTTGGG + Intergenic
974061415 4:57039411-57039433 ACATTGCCAAATGTCCCCTAAGG - Intronic
974086307 4:57264685-57264707 AGCTTGTCAAATGTTCCCTGGGG + Intergenic
974320684 4:60345217-60345239 ACATTGCCTAATTTCCCCTGAGG + Intergenic
974529829 4:63093417-63093439 ACATTGCTAAATGTTACTTGGGG - Intergenic
974578981 4:63769967-63769989 ACATTGCCAAATATCTCCTGGGG + Intergenic
974900441 4:67990012-67990034 ACATTGCCAAATGTCCCTAGGGG - Intergenic
975087106 4:70355373-70355395 ACATTACCAAATGTCCCCTGGGG - Intergenic
975235375 4:71989494-71989516 ACATTGCTAAATGTCCCCTGGGG - Intergenic
975776465 4:77792884-77792906 ACATTGCCAAATGTCTCCTGAGG - Intronic
975856887 4:78633971-78633993 ACCTTGCTAAAAGTAACCTGGGG + Intergenic
976305106 4:83552320-83552342 ACATTGCCAGTTGTCCCCTGGGG + Intronic
976466131 4:85370564-85370586 ACATTGCCAAATGTCCCCTGGGG - Intergenic
976479910 4:85529687-85529709 ATATTGCCAAATGTCCTCTGTGG + Intronic
976568320 4:86578140-86578162 GTATTGCCAAATGTCCCCTGGGG - Intronic
976657644 4:87506108-87506130 ACATTGCCAAATGTTCCATGGGG + Intronic
976705109 4:88011922-88011944 AGATTGCCAAATGTCCCCTGAGG - Intronic
976950162 4:90818745-90818767 ACATTGCCAAATGTCCCATGGGG + Intronic
977007641 4:91591039-91591061 ACATTGCCAAATGTCCCCAAGGG - Intronic
977302320 4:95281973-95281995 ACAATGCCAAATGTCCCCTAAGG + Intronic
977336707 4:95708796-95708818 ACATTGCCAGATGTCCCCTGGGG - Intergenic
977346733 4:95825231-95825253 ACATTACCAAATGTCCCTTGGGG + Intergenic
977593530 4:98852635-98852657 ACATTGCCAAATGTCCCCTAGGG + Intergenic
977842525 4:101725854-101725876 ACATTGTCAAATGTTCCCTTGGG - Intronic
977909779 4:102520139-102520161 ACGTTGCCAAATGACCCCTGGGG + Intronic
977911383 4:102541189-102541211 ACATTGACAAATGTCCCCTGGGG + Intronic
977922236 4:102658365-102658387 GCACTGCCAAATGTTCCATGGGG + Intronic
978196103 4:105973765-105973787 GCATTACCAAATGTCCCCTGAGG - Intronic
978552403 4:109941496-109941518 ACACTGCCAATTGTTCCCTCAGG - Intronic
978905563 4:114001475-114001497 GCCTTCTCAAATGTTCTCTGAGG - Intergenic
979287522 4:118942676-118942698 TCATTGCCAAATGTCCCCTGTGG - Intronic
979438131 4:120719223-120719245 ACATTGCCAAACGTCCCCTGGGG + Intronic
979527038 4:121728329-121728351 ATGTTGTTAAATGTTCCCTGTGG + Intergenic
979601308 4:122589158-122589180 ATATTGCCAAATGTCTCCTGAGG - Intergenic
979776182 4:124590864-124590886 ACCTTGCTGAATGTTCCATAGGG + Intergenic
979843844 4:125482937-125482959 ATATTGCCAAATGTCCCATGGGG - Intronic
980150689 4:129043775-129043797 ACATTGCCAAATATCTCCTGGGG + Intronic
980249126 4:130291310-130291332 ACCTTGCCAAGTGTACTCTGGGG - Intergenic
980514251 4:133833367-133833389 ATTTTGCAAAATGTTACCTGGGG - Intergenic
980571779 4:134628932-134628954 ACCATGAAAAATGTTCCATGGGG + Intergenic
980873663 4:138638735-138638757 GCTTTTCCAAATGCTCCCTGGGG + Intergenic
981283055 4:142983523-142983545 GACTTGCCAAATGTCCACTGTGG + Intergenic
981342318 4:143635570-143635592 ACATTGCCAAATGTCCCCTGGGG + Intronic
981350419 4:143722985-143723007 GCATTGCCCAATGTTCCCTGGGG + Intergenic
981435070 4:144710655-144710677 ACATAGCCAAATGTCCCCTGGGG - Intronic
981452702 4:144917132-144917154 ACACTGCCAAATATGCCCTGTGG - Intergenic
981516561 4:145616475-145616497 ACATTGCCAAATGTTCCCTGGGG + Intergenic
981536037 4:145800807-145800829 ACACTGCCAAATGTCCCCTTGGG + Intronic
981691631 4:147515342-147515364 ACATTGCCAAGTGTTCCCTGTGG + Intronic
981759996 4:148183918-148183940 ACTTTACCAAATGTCCCCTTGGG - Intronic
981898163 4:149829281-149829303 ATGTTGCCAAATGCTTCCTGGGG - Intergenic
982119780 4:152131782-152131804 ACATTGCCAAATATTCGCTGGGG - Intergenic
982156129 4:152522678-152522700 ATAGTGCCAAATGTCCCCTGGGG + Intronic
982228346 4:153186003-153186025 ACATTGCCAAATTTTCCCTTGGG - Intronic
982304844 4:153920084-153920106 ACATTGCCAAACATTCCCTCCGG - Intergenic
983111434 4:163755015-163755037 ACATTGCCGAATGTCCCCTTGGG - Intronic
983563030 4:169120165-169120187 ATATTGTCAAATGTTCCCTGGGG + Intronic
983680699 4:170350324-170350346 ACTTTGCCAAATATTCCCAGGGG + Intergenic
984156886 4:176205138-176205160 ACATTGTCAAATGTCCCTTGGGG - Intergenic
984525199 4:180849833-180849855 ACACTGCCAAAGTTTCCCTGGGG + Intergenic
984960765 4:185095271-185095293 ACATTGCCAAATGTGCCCTGTGG + Intergenic
985027418 4:185751922-185751944 CAGTTGTCAAATGTTCCCTGGGG - Intronic
985077786 4:186234442-186234464 ACATTGTCAAATGTCCCCAGTGG - Intronic
985080724 4:186261534-186261556 ACGTTGCCGAATGTTTCCTGAGG - Intergenic
985402267 4:189604594-189604616 GCTTTGTCAAATGTCCCCTGTGG - Intergenic
985616113 5:922986-923008 ACCTTTCCCACTGTGCCCTGTGG + Intergenic
986038706 5:3965279-3965301 ACATTGCCAAGTGTTCCCACAGG + Intergenic
986394749 5:7317417-7317439 ACCTTCCCAAATGTCCCATTGGG - Intergenic
986430919 5:7680160-7680182 ACATTGACAACTGTTTCCTGGGG - Intronic
986601817 5:9480178-9480200 ACATTGCCAGATGTCCCCTGAGG + Intronic
986732550 5:10645889-10645911 ACGTGGCCAAATGTCCCCTGGGG - Intronic
986736499 5:10672100-10672122 ACAGTGTCAAATGTTCCCTGGGG + Intergenic
986800683 5:11256978-11257000 ACATTGTCAAATGTCCCCTGGGG + Intronic
987006502 5:13715810-13715832 AAATTGCCAAATGTCCTCTGGGG - Intronic
987026598 5:13933088-13933110 ACATTGCCAAATGGCCCCTGTGG + Intronic
987217026 5:15748038-15748060 ACTTTTCCAGGTGTTCCCTGGGG - Intronic
987217035 5:15748097-15748119 ACTTTTCCAGGTGTTCCCTGGGG - Intronic
987233863 5:15923691-15923713 ATCTTTTCAAAAGTTCCCTGAGG + Intronic
987379057 5:17266882-17266904 ATCTTTCAAAATGTTGCCTGTGG + Intronic
987788949 5:22538566-22538588 ACATTGCCAAATGTTCCGTGGGG + Intronic
987909900 5:24127953-24127975 ACATAGCCAAATGTCCCCTGAGG - Intronic
988440179 5:31224971-31224993 GTATTGCCAAATGTTCCCTGGGG - Intronic
988445620 5:31283084-31283106 ATATTTCCAAATGTCCCCTGGGG - Intronic
988456566 5:31392265-31392287 ATATTGCCAAATATCCCCTGGGG - Intergenic
988468578 5:31514771-31514793 ATATTGCCAAATGTCCCCTGGGG - Intronic
988589285 5:32534947-32534969 GCTTTGCCAAAAGTTCCCAGCGG + Intronic
988675884 5:33432702-33432724 ACATTGCCAAATGTCCTATGGGG - Intergenic
988693025 5:33591763-33591785 ACATTCCCAAATGTCCCCTGGGG - Intronic
988812815 5:34802113-34802135 ACATTGCCAAATGTCCCCTGGGG - Intronic
989115582 5:37949239-37949261 ACATTGTCAAATGTCCCCTGGGG + Intergenic
989240781 5:39201384-39201406 ACATTGCCAAATGTCCCCTGGGG + Intronic
989458704 5:41671160-41671182 ACATTTCCAATTGTCCCCTGGGG + Intergenic
989480936 5:41929325-41929347 ACATTGCCAAATGTTCCAGGGGG + Intronic
989544595 5:42658653-42658675 ACATTGCCAAATGTCCCCTGGGG - Intronic
989559188 5:42831583-42831605 ACCTTTCCAAATGTCCCTTTGGG - Intronic
989620172 5:43376307-43376329 ATATTGCCAAATGTCCCCTGGGG - Intergenic
989737299 5:44723551-44723573 ATGATGCCAAATTTTCCCTGGGG - Intergenic
989962535 5:50433610-50433632 ACATTGCCAAATGTCTCCTGCGG - Intronic
990026822 5:51202330-51202352 ACATTATCAATTGTTCCCTGGGG - Intergenic
990205513 5:53424835-53424857 ATTTTGACAAATGTCCCCTGGGG - Intergenic
990206405 5:53434183-53434205 ACATTGCCAAATGTCCCTGGGGG + Intergenic
990265084 5:54066593-54066615 ATGTTACCAAATGTCCCCTGAGG - Intronic
990596433 5:57316788-57316810 ACATTGCCAAATGTCCTCTGGGG - Intergenic
990669528 5:58112575-58112597 ACATGGCCAAATGTCCCCTCAGG + Intergenic
990748789 5:58989147-58989169 ACATTGCCAAATGTCCCTGGTGG + Intronic
990905307 5:60796519-60796541 AAATTGCCAAACGTCCCCTGTGG + Intronic
990976744 5:61567521-61567543 ACATTGCCAAATGTCTCCTGGGG + Intergenic
991271049 5:64781602-64781624 AAATTGACAAATGTCCCCTGGGG + Intronic
991369810 5:65906477-65906499 ACATTGCCAAATGTCCCCTTTGG - Intergenic
991665190 5:68992832-68992854 ACATTGCCAATTGATCCCTTCGG - Intergenic
992322135 5:75623805-75623827 ATTTTTCCAAATGTTTCCTGGGG + Intronic
992360114 5:76028859-76028881 AAATTGCCAAATGTCTCCTGAGG + Intergenic
992515681 5:77490393-77490415 ACATTGCCAAATGTCTCCTGCGG + Intronic
992554486 5:77889914-77889936 ACCTTGGTACATCTTCCCTGAGG + Intergenic
992647061 5:78820823-78820845 AAATTGCCAAATCTCCCCTGGGG + Intronic
993542785 5:89173032-89173054 ACATTGCCATATGTCCCCTGTGG - Intergenic
993543373 5:89180393-89180415 ACATTGCCATATGTCTCCTGAGG - Intergenic
993620986 5:90167563-90167585 ACCTTGGCAAATGTCCCCTGGGG - Intergenic
994206124 5:97037818-97037840 ACATTGCCAAATGTCCCCTGAGG + Intergenic
994206809 5:97044653-97044675 AGTTTGGCAAATATTCCCTGTGG + Intergenic
994244433 5:97463445-97463467 ATATTGTCAAATGTTCCCTGGGG + Intergenic
994282650 5:97924326-97924348 ACCTTGCTAAATATACCCTGGGG + Intergenic
994296889 5:98100946-98100968 ACATTGTCAAATGTCTCCTGGGG + Intergenic
994407361 5:99361571-99361593 ACATTGCCAAATGTTCTCCTCGG - Intergenic
994583457 5:101676820-101676842 ACATTGCCAAATATACCCTCAGG - Intergenic
994607668 5:101989954-101989976 TCCTTACTAAATGTTCTCTGTGG + Intergenic
994885460 5:105555816-105555838 ATTTTGCCATATGTTTCCTGTGG - Intergenic
995004080 5:107170064-107170086 ACGTTGCCAAATATCCCCTGAGG - Intergenic
995050733 5:107699999-107700021 ACATTGCCATATGTCTCCTGGGG + Intergenic
995262101 5:110116160-110116182 ATGCTGCCAAATGTTCCCTGGGG - Intergenic
995280072 5:110324402-110324424 ACATTGTCAAGTGTCCCCTGAGG + Intronic
995837980 5:116416887-116416909 ACATTGCCAATTGTCCCATGGGG - Intergenic
996304306 5:122029077-122029099 ATGTTGCCAAATGTTCCCTGGGG - Intronic
996354631 5:122582013-122582035 ACATTGCCAAATATCCCCTCGGG - Intergenic
996526039 5:124480775-124480797 ACATTGCCAAATGTCCTCTTGGG + Intergenic
997259253 5:132453531-132453553 ACATTGCCAAATGTCCCCTGGGG + Intronic
997270449 5:132532313-132532335 AAATTGCCAAATGTTCCCTTGGG + Intergenic
997294531 5:132761382-132761404 ACCCTGGCATCTGTTCCCTGAGG - Intronic
997561696 5:134851444-134851466 ACATTGCCAAATGTTCCCTGGGG - Intronic
997689557 5:135817129-135817151 ACTTTGCCAGATGTTCCCTGGGG - Intergenic
997727026 5:136130270-136130292 ACATTGCCAAATGTTTCCTGGGG + Intergenic
997816027 5:137018061-137018083 ACATTACCAAATGTCCCCTCGGG - Intronic
997852391 5:137344505-137344527 ACATTGGCAAATGTCCCCTAGGG - Intronic
997994416 5:138574465-138574487 ACATTGCCAGATGTCCCCTGGGG + Intronic
998212459 5:140210429-140210451 ACATTACCAAATGTCCCCTAGGG + Intronic
998237283 5:140409057-140409079 ACGTTGCCAAATGTCTCCTAGGG + Intronic
998394989 5:141812500-141812522 ACATTGCCAAATGTCCCTTGGGG + Intergenic
998497258 5:142601566-142601588 AGATTGCCAAATGTCCCCTTTGG - Intronic
998828066 5:146125857-146125879 ACATTGCCAAATGTCCGCTGGGG - Intronic
998855461 5:146390690-146390712 ACATTGCCCCATGTCCCCTGGGG + Intergenic
998876517 5:146605652-146605674 ATATTGCCAAATGTTCCCCAGGG + Intronic
999209458 5:149875167-149875189 ACATTGCCAAATATCCCCTGGGG - Intronic
999255496 5:150207885-150207907 ACATTGCCAAATGTCCCCCAAGG - Intronic
999436732 5:151569038-151569060 ACATTGCCAAGTGTCCCTTGAGG - Intergenic
999482534 5:151961871-151961893 ACATTGTCAAATGTCTCCTGGGG - Intergenic
999621373 5:153478021-153478043 ACATTGCCAAATGTCTCCTAGGG + Intergenic
999736273 5:154515669-154515691 ACATTGCCAAATGTTCTCTGAGG - Intergenic
999880176 5:155854288-155854310 ACTTTGCCAAATGTCCCCCAGGG + Intergenic
1000161309 5:158600318-158600340 ACATTGCCAAATGTCTCCTGAGG + Intergenic
1000298753 5:159936107-159936129 ACATTGCTAAACGTCCCCTGGGG - Intronic
1000336712 5:160246731-160246753 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1000353868 5:160374477-160374499 ACTTTGCCAAATCTTTCCAGAGG + Intergenic
1000382595 5:160642478-160642500 ACGTTGCCAAATGTCCTCTGGGG - Intronic
1000392879 5:160743810-160743832 ACATTGCCAAATATCCCCTGAGG - Intronic
1000398664 5:160802410-160802432 ACATTGCCAAATGTCCTCTGGGG - Intronic
1000731803 5:164843935-164843957 ACATTGCCAAATATTTGCTGGGG + Intergenic
1000986686 5:167868243-167868265 ACATTGCCAAATCTCCCCTAGGG + Intronic
1001005839 5:168049098-168049120 ACATTGCCAAATGTCCTCTAGGG - Intronic
1001058514 5:168468735-168468757 TCATTGCCAAATGTTCCAGGGGG - Intronic
1001157079 5:169281879-169281901 ACATTGCCAAATGTCCCCTGGGG - Intronic
1001246872 5:170111481-170111503 ACCCTGCCAACTCTTGCCTGTGG + Intergenic
1001494572 5:172178850-172178872 ACGTTGCCACATGCTCCATGGGG - Intronic
1001606135 5:172961034-172961056 ATATTGCCAAATGCTCCCTGGGG + Intronic
1001702629 5:173718327-173718349 ACATTGCCAAGTGTCCCCTGGGG - Intergenic
1001804083 5:174568587-174568609 ACCTTGCCAAATATCTTCTGGGG - Intergenic
1001831212 5:174790916-174790938 ACATTGCCAAATATTCCCTGGGG - Intergenic
1002331526 5:178444289-178444311 ATCTTGCCAAATATTCAGTGAGG + Intronic
1002629844 5:180564972-180564994 ACATTGCCAAATGTCCTCTGGGG - Intronic
1002655684 5:180744793-180744815 ACATTGTCAAATGTCCCCTAAGG - Intergenic
1002712065 5:181201299-181201321 ACTTTGCCAGATGTCCCCTGGGG + Intronic
1002992196 6:2248111-2248133 ACATTGTCAAATGTCCCCTGGGG - Intergenic
1003004499 6:2368625-2368647 ACGTTGCCACATGTTCCCTGGGG - Intergenic
1003063070 6:2877268-2877290 ACCCTCCCAAAGGATCCCTGTGG - Intergenic
1003235710 6:4293837-4293859 ACATTGCTAAATGACCCCTGGGG + Intergenic
1003243282 6:4362859-4362881 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1003295127 6:4819725-4819747 ACATTGCCAAATGTCCCTTGAGG - Intronic
1003444162 6:6169617-6169639 ACATTGCCAAATGTCCCCTGGGG - Intronic
1003501621 6:6707968-6707990 ACATTGCCAATTGTCCCCTGAGG + Intergenic
1003552861 6:7114419-7114441 ACAGTGCCAAAAGTCCCCTGGGG - Intronic
1003745268 6:8994011-8994033 ACCTTGCCAAATATCGTCTGGGG + Intergenic
1003816301 6:9844876-9844898 ACATCGCCAAATGTTCCCTGGGG + Intronic
1003896449 6:10612341-10612363 ACATTGCCAAATGTCCCCTCAGG - Intronic
1003928648 6:10901678-10901700 ACATTGCTAAGTGTCCCCTGTGG + Intronic
1003973731 6:11323486-11323508 ACGTTGCTAGATGCTCCCTGTGG - Intronic
1003974502 6:11329706-11329728 ACATTGCTAAATGTCCCCTAGGG - Intronic
1004039679 6:11963084-11963106 ACATTGCCAAATGTCACCTGAGG - Intergenic
1004162037 6:13222700-13222722 ACATTGCCAAATGTCCTCTGGGG - Intronic
1004162740 6:13229325-13229347 ATTTTGCCAGGTGTTCCCTGGGG + Intronic
1004367214 6:15022376-15022398 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1004429153 6:15528419-15528441 ACATTGCCAAATGTCCCCTTGGG + Intronic
1005354378 6:24968535-24968557 ACATTGCCAGATGTCCCCTGGGG - Intronic
1006178631 6:32139697-32139719 ACATTGCCAAATGTTCCTGGGGG + Intergenic
1006212552 6:32409356-32409378 ACATTGCCAAATGTCCTCTAAGG - Intergenic
1006218005 6:32462290-32462312 ACATTGCCAAATGTTCCCTAGGG + Intergenic
1006219923 6:32480235-32480257 ACATTGCCACATGTTCCCCAAGG + Intergenic
1006229208 6:32567982-32568004 ACATTGCCACATGTTCCCCAAGG + Intronic
1006381267 6:33698779-33698801 ACATTGCCACATGTCCCCTGGGG + Intronic
1006432342 6:34005289-34005311 ACTTTGCCAAATGTCTCCTGGGG - Intergenic
1006597121 6:35201648-35201670 ACATTGACACATGTCCCCTGGGG - Intergenic
1006619937 6:35356722-35356744 ACATTGCCAAATGTCTCCTAGGG + Intronic
1006705045 6:36012648-36012670 ACATCGCCACATGTTCCCTGGGG + Intronic
1006820746 6:36892541-36892563 ACATTGCCAAATGTCCCCTTTGG + Intronic
1007048820 6:38804847-38804869 ACCTTGCCAAATATTCCCTTGGG - Intronic
1007422027 6:41725287-41725309 ACATTGGCAAATGTCCCCTAGGG + Intronic
1007688069 6:43679163-43679185 ACATTGCCAGATGTCCCCTGGGG - Intronic
1007766261 6:44162091-44162113 ACGTTGCCACCTGTTCCCTGGGG + Intronic
1007832686 6:44650869-44650891 ACTTTGTCAGCTGTTCCCTGGGG - Intergenic
1008008197 6:46434768-46434790 ACATTGCCAGATGTCCCCTGGGG - Intronic
1008048405 6:46874843-46874865 ACCTTGCCAAATGTCCTCCAGGG - Intronic
1008145237 6:47883812-47883834 ACATTGTCAAATGTTGCCTGTGG + Intronic
1008158621 6:48049129-48049151 ACATTGCCAAGTGTCCCCTGAGG - Intronic
1008296252 6:49782300-49782322 ACTTTGGCAAATGTCCCCTGTGG + Intergenic
1008418227 6:51267834-51267856 ACATTGCTAAATGTCCCTTGGGG + Intergenic
1008418974 6:51274517-51274539 ACATTGACAAATGTTTCTTGGGG - Intergenic
1008434111 6:51455059-51455081 ACTTTGTCAAATGTCCCCTGGGG - Intergenic
1008454857 6:51697628-51697650 ACATTGCCAAATGTCCCCGAAGG + Intronic
1008487860 6:52054788-52054810 ACATTGCCAACTCTTCCCTGGGG + Intronic
1008618258 6:53246837-53246859 GCCTTGTCAAATGTCCCCAGGGG + Intergenic
1008667479 6:53730468-53730490 CCCTTACAAAATGTTACCTGCGG - Intergenic
1008700287 6:54091129-54091151 ACATTGCCAAAGGTACCCTGGGG + Intronic
1008872644 6:56290392-56290414 ACATTGCCAAGTGTCCCCTCAGG + Intronic
1009484400 6:64201871-64201893 ACATTGTCAAATGCTCCCTGGGG - Intronic
1009831363 6:68940430-68940452 TCATTGCCAAATGTCACCTGGGG + Intronic
1009884008 6:69602901-69602923 ACATTGCCAACTATTCCCTGGGG + Intergenic
1009892274 6:69700546-69700568 ATATTGCCAAATGTTTCCGGGGG + Intronic
1009918022 6:70020644-70020666 ACATTGCCAAATGTTCCTAGAGG - Intronic
1010046028 6:71444806-71444828 ACCTTTGCAAGTGTTCCTTGAGG + Intergenic
1010265953 6:73867472-73867494 ACATTGTCAAATGTACTCTGGGG - Intergenic
1010401967 6:75456144-75456166 ACATTGTCAAATGTTCCCTGGGG - Intronic
1011585476 6:88920021-88920043 ACATTACAAAATGTCCCCTGGGG - Intronic
1011800049 6:91002704-91002726 TCTTTGCCAAATGTTCCCTGGGG - Intergenic
1012468875 6:99547706-99547728 ACATTGCCAAATGTCCCCTCGGG + Intronic
1012569695 6:100708542-100708564 ACATTACCAGATGTTCCCCGGGG - Intronic
1012651426 6:101758554-101758576 ACATTCCCAACTGTACCCTGGGG - Intronic
1012969002 6:105706476-105706498 ACCTTGTCAACTGTTCTCAGAGG + Intergenic
1013158534 6:107519195-107519217 ATATTACCAAATGTCCCCTGGGG - Intronic
1013158748 6:107521095-107521117 ATATTACCAAATGTCCCCTGGGG + Intronic
1013237488 6:108210168-108210190 ACATTGCCAAACGTCCCCTGGGG + Intergenic
1013338469 6:109189787-109189809 ACATTTCCAAATGTCCCTTGGGG - Intergenic
1013576801 6:111491526-111491548 ATTTTGCCAAATGTCCCCTAGGG - Intergenic
1013877793 6:114855507-114855529 ACCCTGCCAAAGGATCCCTGTGG - Intergenic
1014147096 6:118010946-118010968 ATATTGCCAAATGTTCCCTGGGG - Intronic
1014412023 6:121136406-121136428 ACACTGCCAAATGTTCCCTGGGG - Intronic
1014908616 6:127061714-127061736 ACATTGCCAAATGTTTCCCGTGG + Intergenic
1015362446 6:132355250-132355272 ACCCTCCCAAAAGATCCCTGTGG + Intronic
1015794570 6:136998098-136998120 ACATTGCCACATATCCCCTGGGG + Intergenic
1015826355 6:137316772-137316794 ACATTGCCCAATGTCCTCTGAGG + Intergenic
1016069249 6:139718913-139718935 ACTTTGGCAAATGTTCCATGTGG + Intergenic
1016100638 6:140095650-140095672 ACTTTGAAAAATGTCCCCTGTGG - Intergenic
1016127916 6:140428570-140428592 ACATTGCAAAATATTTCCTGGGG - Intergenic
1016229349 6:141783867-141783889 AGATTTGCAAATGTTCCCTGAGG + Intergenic
1016323063 6:142869034-142869056 ACATTGCCAAATATCCCCTAGGG - Intronic
1016656523 6:146524610-146524632 ACATTGCCAAATATCTCCTGGGG - Intergenic
1016767348 6:147809870-147809892 ACAGTGCCAAATGTCCCCTGGGG + Intergenic
1016791108 6:148067829-148067851 ATATTGCCAAATGTCCCCTGGGG + Intergenic
1017605313 6:156127082-156127104 ACATTGCTAAGTGTCCCCTGGGG - Intergenic
1017759282 6:157555833-157555855 ACATTGCCAAATGTCCCCTTGGG + Intronic
1017862508 6:158412251-158412273 ACCCTGGAGAATGTTCCCTGAGG - Intronic
1018083859 6:160284321-160284343 ACATTGCCAAATGTCCCCTGAGG - Intergenic
1018192793 6:161325331-161325353 ACATTACCAAATGTCCCCTGGGG - Intergenic
1018392463 6:163350913-163350935 ACATTGCCACATGTCTCCTGGGG - Intergenic
1018395211 6:163373222-163373244 ACAATGCCAAATGTCCCCTGTGG - Intergenic
1018427025 6:163692343-163692365 ACATCGCCAAATGTCCCCTAGGG - Intergenic
1018772895 6:166987560-166987582 ACCTTGTCAGATGTCCCCGGGGG + Intergenic
1019117930 6:169780308-169780330 ACATTGCCAGATATCCCCTGGGG + Intronic
1020324628 7:6964870-6964892 ACATGGCCACATGTTCTCTGGGG - Intergenic
1020352781 7:7240147-7240169 ACCTTGCCAAATGTCCTCTGGGG - Intronic
1020597095 7:10220590-10220612 ATCTTGCCAAATGATGACTGAGG - Intergenic
1020659710 7:10967314-10967336 ACATTGCCAAATATCCACTGGGG - Intergenic
1021005611 7:15391783-15391805 AAATTGCCAAATGTTCCTTAAGG - Intronic
1021075597 7:16300547-16300569 ATATTGCCAAATGTTCCCTAGGG - Intronic
1021096947 7:16546461-16546483 ATATTGTCAAATGCTCCCTGGGG + Intronic
1021248610 7:18295756-18295778 ACATTGCCAAATGTGCTCTGGGG - Intronic
1021279940 7:18705369-18705391 ACATTGTCAAATGTACTCTGTGG + Intronic
1021462865 7:20908979-20909001 ACATTGCCAAATGTACCCTGGGG + Intergenic
1021470062 7:20991768-20991790 ACTTTGCCAAATGTCTCCTGGGG + Intergenic
1021523666 7:21562319-21562341 ACATGGCCAAATGTCCCCTGGGG + Intronic
1021595242 7:22308917-22308939 ACGTCACCAAATGTCCCCTGGGG - Intronic
1021695938 7:23276527-23276549 ACATTGCCAAATGTCCTCTAGGG - Intergenic
1021725570 7:23545013-23545035 ACGTTGCCAAATGTCCTCTGGGG - Intergenic
1021829486 7:24590009-24590031 ACATTTCCAAATGCTCACTGGGG + Intronic
1022109075 7:27216953-27216975 ACACTGCCAAATGTCCCCTGGGG + Intergenic
1022238986 7:28490727-28490749 ACATTGCCAAATGTCCCCTGTGG + Intronic
1022288388 7:28977099-28977121 ACATTGCCAAATATTTTCTGGGG + Intergenic
1022331739 7:29385675-29385697 ACTTTGACAAATGTCCCTTGAGG + Intronic
1022513762 7:30962365-30962387 ACATTGCCAAATGTCCCCTAGGG + Intronic
1022578685 7:31525434-31525456 ACATTGCCAAAGGTCCCCTTGGG + Intronic
1022661903 7:32375451-32375473 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1022757633 7:33310648-33310670 GCATTGCCAAATGTCCCCTGGGG - Intronic
1022771292 7:33475635-33475657 ATGTTCCCAAATGTTCCCTAGGG + Intronic
1022788539 7:33663541-33663563 ACATTGCCAAATATGCCCTGGGG - Intergenic
1022830881 7:34065438-34065460 ATACTGCCAAATGTCCCCTGGGG + Intronic
1022924004 7:35042330-35042352 ACCTTGCCTTATGCTTCCTGGGG + Intergenic
1023000845 7:35806086-35806108 ACATTGCCAAATGTCACGTGGGG + Intronic
1023113696 7:36839854-36839876 ACGTTGCCAGATGTCCCTTGGGG - Intergenic
1023135554 7:37048245-37048267 ACACTGCCAAATGTGCCCTGGGG + Intronic
1023144079 7:37132043-37132065 ACATTGCCAAATGCTCTCTAGGG + Intronic
1023323197 7:39023408-39023430 ACATTGCCACATGTTCACTGAGG - Intronic
1023503126 7:40871957-40871979 ACATTGCCAAATTTCCCATGAGG - Intergenic
1023583717 7:41707326-41707348 ACATGGCCAGATGTTCCCCGGGG - Intergenic
1023665440 7:42518210-42518232 ACATTGCCAAATGTCCCCAGGGG + Intergenic
1023705943 7:42941906-42941928 GCATTGCCAAATGTCCTCTGGGG - Intronic
1023739705 7:43268442-43268464 ACATTGCCAAATGTCCGCGGGGG - Intronic
1024027505 7:45425239-45425261 ACATTGCCAAATGTCTCCTGGGG + Intergenic
1024063857 7:45717258-45717280 ACCTTGCCAAGTCTGCCATGGGG - Exonic
1024605438 7:51019097-51019119 ACTTAGCCAGATGTTTCCTGAGG + Intronic
1024805965 7:53140005-53140027 ACATTGCCAAATGTCTCCTGGGG + Intergenic
1025218419 7:57081311-57081333 ACATTGACAAATGTCCCCTGGGG + Intergenic
1025244856 7:57309207-57309229 ACATTGCTAAATGTCCACTGGGG + Intergenic
1025254165 7:57372226-57372248 ACTTTGCCGAATGTCTCCTGGGG + Intergenic
1025473937 7:60896258-60896280 ACATTGACAAATGTCTCCTGGGG - Intergenic
1025480098 7:60972413-60972435 ACATTGACAAATGTCTCCTGGGG - Intergenic
1025513067 7:61593616-61593638 ACATTGACAAATGTCTCCTGGGG + Intergenic
1025551870 7:62259943-62259965 ACATTGACAAATGTCTCCTGGGG + Intergenic
1025565004 7:62423739-62423761 ACATTGACAAATGTCTCCTGGGG - Intergenic
1025603936 7:63025239-63025261 AGATTGTCAAATGTCCCCTGGGG + Intergenic
1025629341 7:63254930-63254952 ACATTGACAAATTTCCCCTGGGG + Intergenic
1025652929 7:63489150-63489172 ACATTGACAAATGTCCCCTGGGG - Intergenic
1025885884 7:65591065-65591087 ACATTGACAAATGTCTCCTGGGG + Intergenic
1025964471 7:66255194-66255216 ACATTGCCAAATGTCCCCTAGGG - Intronic
1026348432 7:69494997-69495019 ACATTGCCAAATGTCCCCTAAGG + Intergenic
1026485263 7:70812784-70812806 ACATTGCTAAATGTATCCTGGGG + Intergenic
1026614901 7:71893160-71893182 ACATTGCTAAATGTCCCCTGAGG - Intronic
1027433055 7:78134130-78134152 ACTTTACCAAATGTCCCTTGGGG + Intronic
1027729373 7:81850666-81850688 ATATCACCAAATGTTCCCTGGGG + Intergenic
1027883658 7:83874701-83874723 ACATTGCCAAATGTACCTTGAGG - Intergenic
1028030409 7:85905046-85905068 ACATTGCTAAATGTACCCTGCGG - Intergenic
1028210987 7:88073991-88074013 ACATTGCTAAATGTACACTGGGG - Intronic
1028267076 7:88738898-88738920 ATTTTGCCAAATGTGCTCTGGGG + Intergenic
1028357600 7:89928148-89928170 ACATTGCCAAATGTCCCATGGGG - Intergenic
1028512859 7:91644278-91644300 CCTTTGCCAAATGTCCCCTGGGG + Intergenic
1028753416 7:94408477-94408499 ACTTTACCAAATGTTCTGTGAGG + Intronic
1028961202 7:96751371-96751393 ACATTGCCAAATGTTCTCTGAGG + Intergenic
1029822318 7:103158103-103158125 ACCTTGCCTTATGCTTCCTGGGG + Intergenic
1030092238 7:105867809-105867831 ACATTGCCAAATGTCCCAGGGGG - Intronic
1030933003 7:115548571-115548593 ACCTTACCAAATGTTGGCTTTGG - Intergenic
1031007938 7:116495876-116495898 ATGTTGCCAAATGTCCTCTGGGG - Intronic
1031069094 7:117142503-117142525 AAGTTGCTAAATGTCCCCTGGGG + Intronic
1031082501 7:117272199-117272221 ACATTGCCAAATGTTCCCCAGGG - Intergenic
1031137136 7:117897077-117897099 ACATTGCTAAATCTTCCCTGGGG + Intergenic
1031167215 7:118243780-118243802 ACATTGCCAAATATCCCCTGGGG - Intergenic
1031210233 7:118815562-118815584 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1031341273 7:120605107-120605129 ACATTGCCAAATGTAGCATGGGG - Intronic
1031632248 7:124057997-124058019 ACGTTGTCAAATGTTCCCTGGGG - Intergenic
1032572996 7:133021091-133021113 ACATTGTCAAATGCCCCCTGGGG + Intronic
1032614531 7:133452701-133452723 AGCCTGACAAATGTACCCTGTGG + Intronic
1032800364 7:135312916-135312938 ACATTGTCAAATATCCCCTGGGG + Intergenic
1032828908 7:135602459-135602481 ACATTGTCAAATGTGCCCTGGGG + Intronic
1032842183 7:135723087-135723109 ACATTGCCAAATGTCCCTTGGGG + Intronic
1032934477 7:136713058-136713080 TCATTGCCAAATATTTCCTGTGG + Intergenic
1033064622 7:138142533-138142555 ACATTGCCAAACGTCCCCTGAGG - Intergenic
1033549923 7:142437954-142437976 TGCTTGCCAAATCTTCCCTATGG + Intergenic
1034011514 7:147534134-147534156 GCATTGCCAAATGTCACCTGGGG - Intronic
1034282488 7:149863879-149863901 ACATTGGCAAATGGCCCCTGGGG + Intronic
1034321912 7:150192709-150192731 AGCTTGCCAAATGTGACCTAAGG - Intergenic
1034612220 7:152381302-152381324 ACATTGCCAGATGTCCCTTGGGG - Intronic
1034770832 7:153774553-153774575 AGCTTGCCAAATGTGACCTAAGG + Intergenic
1035564552 8:632793-632815 ACATTGCCAAATGTCCCCCAGGG - Intronic
1036410389 8:8494439-8494461 ACATTGCCAAGTGTCCTCTGGGG + Intergenic
1036781250 8:11649417-11649439 AGACTGTCAAATGTTCCCTGGGG - Intergenic
1036920098 8:12844202-12844224 ACATTGCCAAATGTTTTCTAGGG + Intergenic
1036957702 8:13207691-13207713 ACACTGCCAAATGTCCCCTAGGG - Intronic
1037536159 8:19826726-19826748 ACATTGCCAAATGTCCCCTGAGG - Intronic
1037718887 8:21424213-21424235 ACATTGCCAAATCTCCCATGGGG + Intergenic
1037812527 8:22095448-22095470 ACATTGCCTCATGTTCCCTGGGG + Intronic
1038104879 8:24422032-24422054 ACATTGTCAAAAGTTCCCTAGGG + Intergenic
1038920815 8:32081958-32081980 ACCTTGCCTAATGTATCCTGTGG - Intronic
1039917136 8:41868366-41868388 AGTTTGCCAAATGTCCCCTGGGG + Intronic
1039951888 8:42179418-42179440 ACCTCGCCAAACGTTTCCTGGGG + Intronic
1040436293 8:47394472-47394494 AAGTTGCCAAATGTCCCCTGGGG - Intronic
1040563980 8:48549581-48549603 ACATTGCTAAATGTCTCCTGGGG + Intergenic
1041825302 8:62089070-62089092 ACATTGCCAGATGTCCCCAGGGG - Intergenic
1042192172 8:66198094-66198116 ACATTGACAAATGTCCCCTGAGG - Intergenic
1042477417 8:69264548-69264570 ACATTACCAAATGTCCCCGGGGG + Intergenic
1042518446 8:69684237-69684259 ACGTTGCCAAAGGTCCCCTGGGG - Intronic
1042826428 8:72984766-72984788 ATATTGCCAAATGTTCCTTGGGG - Intergenic
1042932675 8:74029306-74029328 ACCTTGCCCATTGCTTCCTGTGG - Intergenic
1043000967 8:74759134-74759156 ACATTTCCAAATGTCCCCTGTGG - Intronic
1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG + Intergenic
1043526337 8:81100559-81100581 ACATTGCCAAATGTCCTCTAGGG + Intronic
1043928392 8:86063747-86063769 ACATTGTTAAATGTCCCCTGTGG - Intronic
1044294306 8:90510053-90510075 ACATTGCCAAATATCCTCTGGGG - Intergenic
1044681849 8:94786949-94786971 ACACTGCCAAATGTCCCCTCGGG - Intronic
1044895597 8:96888194-96888216 ACATTGCCAAATGTCCCTTGGGG + Intronic
1044902802 8:96966640-96966662 ACATTGCCAGATGTCCCCTGGGG + Intronic
1045052339 8:98338563-98338585 GCATTGCCAAATATCCCCTGGGG + Intergenic
1045272646 8:100674996-100675018 ACTTTGCCTAATGTCCCCTGGGG + Intergenic
1045308617 8:100981182-100981204 AATTTGCCAAATGTCCCCTGGGG - Intergenic
1045860875 8:106813926-106813948 ATATTGCCAAATGTCCCCTGGGG - Intergenic
1046238611 8:111461372-111461394 ACATTATCAAATATTCCCTGGGG + Intergenic
1046617055 8:116489275-116489297 ACGTGGCCAAATGTCCCCTCGGG + Intergenic
1046658314 8:116921603-116921625 ACATCGTCAAATGTCCCCTGGGG + Intergenic
1046957315 8:120074974-120074996 ACATTGCCAAATGCCCCCTGGGG - Intronic
1047318797 8:123759328-123759350 ACATAGCCAAATGTCCCCTGGGG + Intergenic
1047372146 8:124265035-124265057 GCATTGCCAAATGTTCCCTGGGG + Intergenic
1047376135 8:124298992-124299014 ATATTGCCAAAGGTCCCCTGGGG + Intergenic
1047401804 8:124554441-124554463 ACATTGCCAGATGTCCCCTGGGG + Intronic
1047432681 8:124806384-124806406 AAATTGCCAAATGCCCCCTGGGG - Intergenic
1047508676 8:125499610-125499632 ACATTAGCAAATGTTCCCAGAGG + Intergenic
1047539377 8:125749590-125749612 ACATTGCCAAATATTTCCTGGGG + Intergenic
1047590687 8:126323797-126323819 ACATTGCCAAATATCCCCCGAGG + Intergenic
1047706676 8:127506183-127506205 ACATTGCCAAATGTATCCTGGGG + Intergenic
1047715461 8:127591038-127591060 AATTTGCCAAATGTCACCTGGGG - Intergenic
1047824979 8:128563444-128563466 ACATTTTCAAATGTCCCCTGAGG + Intergenic
1048152724 8:131909828-131909850 ATATTGCCAAATGTTCTCTGGGG + Intronic
1048165864 8:132060979-132061001 ACATTGCCAAGTGTCCCCTGGGG + Intronic
1048269380 8:133016419-133016441 ATGTGGCCAAATGTCCCCTGTGG + Intronic
1048283503 8:133123105-133123127 ACATTGTCACGTGTTCCCTGGGG + Intronic
1048402742 8:134087184-134087206 ACATTGCCAGATGCCCCCTGGGG - Intergenic
1048734870 8:137488099-137488121 ACCTGGCCAGAAGTCCCCTGGGG - Intergenic
1049096751 8:140552909-140552931 ACACTGCCAGATGTCCCCTGGGG + Intronic
1049112651 8:140657569-140657591 ACATTGCCAAAGGTTCCCAGGGG - Intergenic
1049341922 8:142117802-142117824 ACCTTGCCAACTGTCCCCTGGGG - Intergenic
1049558069 8:143293482-143293504 ACATTGTCAAATGTGCCCTCAGG + Intronic
1049901045 9:165554-165576 ACATTGCCAAATATTCCCTGGGG - Intronic
1050122533 9:2322000-2322022 ATATTGCCAAATGTCCCTTGAGG + Intergenic
1050690782 9:8224160-8224182 ACAATGCCAAATGTTTCCTGGGG + Intergenic
1050778468 9:9299304-9299326 ACATTGCCAAATGTCCTCTGGGG - Intronic
1051112856 9:13659509-13659531 ATATTGCCAAATGTCCCTTGGGG - Intergenic
1051186432 9:14465911-14465933 ACAGTGCCAAATGTCCCCTAGGG + Intergenic
1051202918 9:14649131-14649153 ACATTACCAAATGTTTTCTGTGG + Intronic
1051214893 9:14786523-14786545 ACATTGCCAAATGTCCCTTGGGG - Intronic
1051473121 9:17472579-17472601 ACATTTCCAAATGCTCCCTAAGG - Intronic
1051526157 9:18047300-18047322 ACATTGCCAAATGTTCCCTGGGG - Intergenic
1051617074 9:19016529-19016551 ACATTGCCACATGTTTCCTTGGG - Intronic
1052006109 9:23350798-23350820 ACATTGCCAAATGTTCTAGGTGG + Intergenic
1052085209 9:24256591-24256613 ACCTTTCCAGATGTTTCCTGGGG - Intergenic
1052230304 9:26142703-26142725 ACATTGCCAAATGTCCTATGGGG - Intergenic
1052303889 9:26983415-26983437 AAATTGCCAAATGTTCCCTGGGG - Intronic
1052343757 9:27387947-27387969 CCATTGCCAAATGTTGCCTGTGG - Intronic
1052407541 9:28081227-28081249 ACATTGCCAAATGTCCCCAGGGG + Intronic
1053519868 9:38766683-38766705 ACATTGCCAAATGCTCTCCGGGG + Intergenic
1053537035 9:38936350-38936372 ACATTGCCAAATGTCCCCTGAGG + Intergenic
1053699144 9:40669900-40669922 ACATTGACAAATGTCTCCTGGGG + Intergenic
1053744079 9:41175869-41175891 ACATTGCCAAATATTCCCTGGGG - Intronic
1053902906 9:42812809-42812831 ACATTGACAAATGTCCCCTGAGG - Intergenic
1053945151 9:43300144-43300166 ACATTGACAAATGTCTCCTGGGG + Intergenic
1054310433 9:63469301-63469323 ACATTGACAAATGTCTCCTGGGG + Intergenic
1054349355 9:64005672-64005694 ACATTGCCAAATATTCCCTGGGG - Intergenic
1054409220 9:64793451-64793473 ACATTGACAAATGTCTCCTGGGG + Intergenic
1054442385 9:65277268-65277290 ACATTGACAAATGTCTCCTGGGG + Intergenic
1054483194 9:65689428-65689450 ACATTGCCAAATATTCCCTGGGG + Intronic
1054487896 9:65744228-65744250 ACATTGACAAATGTCTCCTGGGG - Intergenic
1054629101 9:67427580-67427602 ACATTGCCAAATGTCCCCTGAGG - Intergenic
1054684264 9:68255384-68255406 ACATTGCCAAATATTCCCTGGGG + Intronic
1054778694 9:69146702-69146724 ACATTGACAATTGTCCCCTGGGG - Intronic
1054882959 9:70164096-70164118 ACATTGCCAAATGTCCACTGGGG - Intronic
1054953844 9:70885360-70885382 TCATTGCCAAATGTCCCTTGAGG + Intronic
1055067972 9:72137812-72137834 ACATTGCCAAGTGCTCCCTGGGG + Intronic
1055106944 9:72523006-72523028 ACTTTTCCAAATGTCCCCTGAGG + Intronic
1055119029 9:72636812-72636834 ACATTGCCAAATGTCCCCTGGGG - Intronic
1055140769 9:72874686-72874708 ACATTGCCAAATGTCTCCTGAGG - Intergenic
1055528941 9:77164050-77164072 ACATTGGCAAATGTCCCATGAGG + Intergenic
1055628025 9:78194575-78194597 ACGTTGACAAATGTCCCCTGGGG + Intergenic
1055654269 9:78437677-78437699 ACATTGCCAAGTGTCCCCTGAGG + Intergenic
1055696135 9:78886647-78886669 ACATTGCCAAATGTCCCCCAGGG - Intergenic
1055792132 9:79934318-79934340 GCATTGCTAAATGTCCCCTGAGG + Intergenic
1055807030 9:80107304-80107326 ACATTGCCAAATGTCCTCTGAGG - Intergenic
1055871858 9:80889953-80889975 ACATTGTCAAATATCCCCTGGGG - Intergenic
1055909824 9:81336196-81336218 GCATTACCAAATGTCCCCTGGGG - Intergenic
1056451989 9:86725274-86725296 ATGTTGTCAAATGTCCCCTGGGG + Intergenic
1056545182 9:87607007-87607029 ACATTGCCACATGTACCCTGGGG + Intronic
1056724043 9:89096705-89096727 ACTTTGCCAAATGTCCGCTGGGG - Intronic
1056925989 9:90834946-90834968 ATATTGCCAAGTGTTCCCTAAGG - Intronic
1057149801 9:92786209-92786231 ACATTGCCAAATGTTCTCAGGGG + Intergenic
1057401795 9:94729762-94729784 ACGTTGCCAAATGTCTTCTGAGG + Intronic
1057563811 9:96150577-96150599 ACATTGCCTAATGTCACCTGGGG + Intergenic
1057568538 9:96185838-96185860 ATTTTGCCAAGTGTCCCCTGGGG + Intergenic
1058091496 9:100811123-100811145 ACATTACCAAGTGTTCACTGGGG - Intergenic
1058104619 9:100956036-100956058 ACATGGCCAAATGTTTTCTGGGG + Intergenic
1058128145 9:101220185-101220207 ACTTTGCCAAATGTCCACTGAGG + Intronic
1058606622 9:106730089-106730111 ACATTGTCAAATGTCCCCTGGGG - Intergenic
1058609026 9:106755098-106755120 ACATCACCAAATGTTCCCAGAGG + Intergenic
1058736412 9:107898220-107898242 ACATGGTCAAATGTCCCCTGAGG + Intergenic
1058849613 9:108998154-108998176 ACATTGCCAAATGTCCCGTGAGG - Intronic
1058923352 9:109639349-109639371 ACCGTGCAAAATGTTCTCAGTGG - Intergenic
1059017246 9:110532840-110532862 ACTTTGCCGAATGTCCCCTGGGG + Intronic
1059080427 9:111243284-111243306 ACGTTACCAAATATTCCCTTGGG + Intergenic
1059241091 9:112806206-112806228 ACATTGCCAAATGTTCCCTGGGG + Intronic
1059280831 9:113132279-113132301 ACATTGCCAAGTGTTCCCTGGGG - Intergenic
1059422189 9:114199199-114199221 ACACTGCCAACTGTTCCCTGGGG - Intronic
1059440487 9:114304114-114304136 ATATTGCCAAATATCCCCTGGGG + Intronic
1059525081 9:114984000-114984022 ACATTGCCAAATGTTTTCTTGGG + Intergenic
1059605351 9:115828821-115828843 ATATTGCCAAATGTATCCTGGGG + Intergenic
1059640162 9:116208928-116208950 ATATTGCCAAATGTCTCCTGGGG - Intronic
1059719955 9:116950265-116950287 ACATTGCTAAATGTCCCTTGGGG + Intronic
1059771873 9:117434410-117434432 ACGTTGCTAAATGTCTCCTGGGG - Intergenic
1059830486 9:118090035-118090057 ACATTGCCAAGTGTCCCCTGAGG - Intergenic
1059917858 9:119123781-119123803 ACATTGCCATATGTTCTCTTGGG + Intergenic
1060016294 9:120089269-120089291 ACATTGCCACATGTTTTCTGAGG - Intergenic
1060124228 9:121026628-121026650 ACATTGCCAAATGTCTCCTTGGG + Intronic
1060443174 9:123660874-123660896 GCATTGCCAAATATCCCCTGGGG - Intronic
1060651805 9:125333989-125334011 ACATTGCCAAATGCTCTCTTGGG + Intronic
1060654046 9:125356443-125356465 ACATTCCCAAATGTCCCTTGTGG + Intronic
1060806577 9:126581414-126581436 ACATTGCCAGATGTGCCTTGGGG - Intergenic
1061373751 9:130212312-130212334 ACATTGCCAAATATCCCCTCGGG - Intronic
1061598415 9:131647995-131648017 ACATTGCCAAATGGCCCCTGGGG + Intronic
1061701328 9:132418201-132418223 ACGTGGCCCAGTGTTCCCTGGGG - Intronic
1062115078 9:134804301-134804323 ATCTTCCAAAATGTTCTCTGGGG - Intronic
1062148398 9:135004133-135004155 ATATTGCCAAATGTCTCCTGGGG - Intergenic
1203581013 Un_KI270746v1:4995-5017 ACATTGACAAATGTCTCCTGGGG - Intergenic
1203588286 Un_KI270747v1:28722-28744 ACATTGACAAATGTCTCCTGGGG + Intergenic
1203615045 Un_KI270749v1:54002-54024 ACATTGACAAATGTCTCCTGGGG - Intergenic
1185582250 X:1218572-1218594 AGGTTGCCAAGGGTTCCCTGGGG + Intergenic
1185587477 X:1250413-1250435 ACATTGCCAAGTTTCCCCTGGGG + Intergenic
1185670091 X:1802045-1802067 ACATTGCCAAATGTGCCCTAGGG - Intergenic
1185992685 X:4909916-4909938 ACATTGCCAAACATCCCCTGTGG - Intergenic
1186095678 X:6099072-6099094 ACATCGCCAAATGTCCCCTGAGG + Intronic
1186210410 X:7244603-7244625 ATATTGCCAAATGTCCTCTGGGG - Intronic
1186283036 X:8014622-8014644 ACATTGCCTAATGTACCCTGGGG + Intergenic
1186380495 X:9053747-9053769 ACATTGCCAAATGTCTTCTGGGG + Intronic
1186413005 X:9360311-9360333 ATATTGCCAAATGTTCCCAGAGG + Intergenic
1186414255 X:9369761-9369783 ACATTGCTGAATGTTCCCTGGGG - Intergenic
1186416028 X:9383760-9383782 ACATTGCCTTATGTCCCCTGGGG - Intergenic
1186429257 X:9490348-9490370 ACATTGTCAAATGTTCCCCAAGG - Intronic
1186430552 X:9500844-9500866 ACATTGCCGAGTGTCCCCTGGGG - Intronic
1186438695 X:9566283-9566305 ACATTGCCCAATGTTTCCTGGGG + Intronic
1186442242 X:9596426-9596448 ATATTGCCAAATGTCCCCTGGGG - Intronic
1186445876 X:9628351-9628373 ACATTGTCCAATGTCCCCTGGGG + Intronic
1186459786 X:9739278-9739300 ACATTGACAAATGTCTCCTGGGG - Intronic
1186466676 X:9788888-9788910 ACATTGCCAAATGTCCTCTGGGG + Intronic
1186485871 X:9933926-9933948 ACATTGCCTAATGTCCCCTGGGG - Intronic
1186495486 X:10009698-10009720 GCATTGCCAAATGTCCCCTGGGG + Intergenic
1186509325 X:10118599-10118621 ACATTGCCAAGTGTTCCCCAGGG - Intronic
1186514964 X:10160136-10160158 ACATTGCCAAATGTCCCCTGAGG + Intronic
1186515524 X:10163923-10163945 ACATGGCCAAATGTCCCCTGGGG + Intronic
1186522376 X:10217487-10217509 ACATTGCCAAATGTCCCCTGAGG + Intronic
1186523756 X:10228895-10228917 ACAATGCCAAATGTCTCCTGTGG - Intronic
1186526515 X:10254099-10254121 ATATTGCCAAATGTCCCCCGAGG - Intergenic
1186536660 X:10356982-10357004 ACATTGCCCAATGTCCCCTGGGG - Intergenic
1186540800 X:10398004-10398026 ACATTGGCAAATGTTCCCTGTGG + Intergenic
1186545617 X:10446115-10446137 GCATTGCCAAATGTCTCCTGGGG + Exonic
1186570108 X:10706150-10706172 ACATTGTCAAATGCTTCCTGAGG + Intronic
1186608223 X:11112796-11112818 ATATTGGCAAATGTCCCCTGTGG - Intronic
1186623052 X:11261767-11261789 ACATTGCTAAATGCTCACTGGGG - Intronic
1186628146 X:11317361-11317383 ACTTTGCCAGATGTCTCCTGGGG + Intronic
1186628516 X:11322300-11322322 ACATTGGCAAATGTGTCCTGGGG + Intronic
1186634618 X:11389045-11389067 ATATTGCCAAATGTCCCCTAAGG - Intronic
1186659989 X:11659973-11659995 ACACTGCCAAATGTCCCCTGGGG + Intronic
1186665827 X:11715898-11715920 ACCTTGCCAAATGTAACCTGAGG + Intergenic
1186717653 X:12269606-12269628 ACATTGCAAAATGTCCACTGGGG - Intronic
1186720205 X:12296118-12296140 ACATTGTCAAATGTCCCCTGGGG + Intronic
1186722092 X:12315826-12315848 ACATTGCCAAATATTCCCTGAGG - Intronic
1186754850 X:12659582-12659604 ACATTGCCAAATATCCCCTATGG + Intronic
1186797054 X:13057216-13057238 ACATTGCCAAATGTCCCCAGGGG + Intergenic
1186803950 X:13120654-13120676 GCTTTGCCAAATGTCCCCTGTGG + Intergenic
1186817949 X:13256444-13256466 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1186830386 X:13384303-13384325 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1186842115 X:13494757-13494779 ATATTGCCAAATATCCCCTGGGG - Intergenic
1186844733 X:13519290-13519312 ACATTGCCAAATGTCCTCTGTGG - Intergenic
1186873157 X:13792174-13792196 ATATTGCCAAATGTCCCCTGAGG - Intronic
1186884368 X:13898301-13898323 ACATTGCCAAATGGCCCCTGGGG + Intronic
1186886842 X:13922335-13922357 ACATTGCCAACTGTCCCTTGAGG + Intronic
1186958137 X:14705326-14705348 ACATTGCCAAATGTCCCCTGGGG - Intronic
1186958797 X:14712336-14712358 ACATTGCCAAATATCCCCTAGGG + Intronic
1186976852 X:14917012-14917034 ACATTGACAAATGTCCCCTGGGG - Intronic
1187007277 X:15245269-15245291 ACACTGCCAAATGTCCCCTGAGG - Intronic
1187054071 X:15725028-15725050 ACATTGCCAAATGTTCTCTGGGG - Intronic
1187056119 X:15742810-15742832 ATATTGCCAGATGTCCCCTGCGG - Intronic
1187109508 X:16282354-16282376 ACATTGCCAAATGTCCCTTCGGG - Intergenic
1187242704 X:17528117-17528139 ACATTGCCACATGTCCCCTGGGG - Intronic
1187280299 X:17853459-17853481 ACCTTGCCAAATGTCCCCTCTGG - Intronic
1187285874 X:17903160-17903182 ACATTGCCAAATGTTCTGTGGGG + Intergenic
1187295450 X:17995530-17995552 ACACTGTCAAGTGTTCCCTGGGG - Intergenic
1187361478 X:18631912-18631934 ACATTGCCAAATGTACCCTTGGG - Intronic
1187470443 X:19564952-19564974 ACATTGCCAAATGTCCCCTTGGG + Intronic
1187560533 X:20398777-20398799 ACATTGTCTAATGTCCCCTGGGG + Intergenic
1187604149 X:20864861-20864883 ACATTGCCAACTGTTCCTTATGG + Intergenic
1187661521 X:21551608-21551630 AAATTACCAAATGTCCCCTGGGG - Intronic
1187753243 X:22490800-22490822 ACATTGCTAAATGTCCCCTAGGG - Intergenic
1187796445 X:23008545-23008567 ACATTGCCAAATGTCCCTTAGGG - Intergenic
1187885613 X:23886133-23886155 ACACTGCCAAATGTCTCCTGGGG + Intronic
1187933852 X:24317160-24317182 ACATTGTCGAATGTTCCCTGGGG + Intergenic
1187950819 X:24468415-24468437 TCATTGCCAAATGTCCCCTGGGG + Intronic
1187963583 X:24588779-24588801 ACATTGCCAAATGTTCCTCAGGG + Intronic
1188000304 X:24974202-24974224 ACATTGTCAAATGTTCCCTCGGG - Intronic
1188068093 X:25686372-25686394 GCATTGTCAAATGTTCACTGGGG - Intergenic
1188152075 X:26689318-26689340 TCCTGGCCAAATGTGCCGTGGGG - Intergenic
1188195769 X:27231102-27231124 ACATTGCCAAATGTTCCATGGGG - Intergenic
1188224856 X:27584843-27584865 ATATTGCCAAATGCTCCTTGAGG - Intergenic
1188251018 X:27894328-27894350 ACATTGCCAAATATCTCCTGGGG + Intergenic
1188385027 X:29545984-29546006 ACATTGCCAAATATCCCCTGGGG - Intronic
1188415378 X:29926793-29926815 ACATTGCCAGATGTCCCCAGGGG + Intronic
1188586447 X:31781836-31781858 ACATTACCAAATGTCTCCTGAGG + Intronic
1188618480 X:32190062-32190084 ACATTTCCAAATGTCCCTTGGGG - Intronic
1189026163 X:37396952-37396974 ACATTGCCAAATGCCCCCTCGGG + Intronic
1189096934 X:38150416-38150438 ACATGGCCAAATTTCCCCTGGGG - Intronic
1189104647 X:38222731-38222753 ACATTGCCAAATGTCCCCCAGGG + Intronic
1189139515 X:38587032-38587054 ACATTGTCAAATATCCCCTGTGG - Intronic
1189447641 X:41095492-41095514 ACATTGCCAGTTGTGCCCTGGGG + Intronic
1189517973 X:41734668-41734690 ACATTGCTAAATGTCCCCTGGGG - Intronic
1189602413 X:42641210-42641232 ATTTTGCCAAAAGTTCCCTCTGG + Intergenic
1189630214 X:42944386-42944408 ACACTGCCAAATGTTCCCTGAGG + Intergenic
1189719024 X:43895969-43895991 ACATTGCCAAATGTCCCTGGGGG + Intergenic
1189795555 X:44642638-44642660 ACATTGCCAAATGTTCCCTGAGG - Intergenic
1189975054 X:46452490-46452512 TCATTGTCAAATATTCCCTGAGG + Intronic
1190031243 X:46975033-46975055 ATATTGCCAAATGTCCCCTGGGG + Intronic
1190060356 X:47207029-47207051 ACATTGCCAGATGTCCCCAGGGG + Intronic
1190116511 X:47629204-47629226 ACATTGCCAAATGTCCCCTGGGG - Intronic
1190251768 X:48732282-48732304 ATATTGCCAAATGTTCTTTGCGG - Intergenic
1190384324 X:49869920-49869942 ACTTTGTCAAATGTCCTCTGGGG - Intergenic
1190392828 X:49949165-49949187 ACATTGCTAAATGTCCCCAGGGG - Intronic
1190443716 X:50501950-50501972 ACATTGCCAAATGTCTCCTGTGG + Intergenic
1191100915 X:56727592-56727614 ACATTGCCAGATGTCCCCTCGGG - Intergenic
1191665172 X:63695101-63695123 ACATTGACAAATGTCCCCTGGGG - Intronic
1192149917 X:68705826-68705848 ACATTGCCAAATGTCCCCTGGGG + Intronic
1192218844 X:69183033-69183055 ACATTGTCAAATGTCTCCTGGGG + Intergenic
1193081992 X:77415301-77415323 ACATTGCCAAATGTTCCCTGGGG - Intergenic
1193115514 X:77771794-77771816 AAATTGCCAGATGTTCCCTGTGG - Intronic
1193386268 X:80875321-80875343 ACATTGCCAAATATCCTCTGGGG + Intergenic
1193812386 X:86067147-86067169 ACAGTGCCAAATGTCCACTGGGG - Intergenic
1194019730 X:88672481-88672503 ACCTCACCCAATGTACCCTGGGG + Intergenic
1194265739 X:91751721-91751743 ACAGTGCAAAATGTCCCCTGTGG - Intergenic
1194448472 X:94014436-94014458 ACCTTGCCAAAGACTTCCTGAGG + Intergenic
1195448386 X:104979801-104979823 ACATTGCCAAATGTCCCTTTAGG - Intronic
1195507719 X:105677772-105677794 ACATTACCAAATGTACCCTAGGG + Intronic
1195589642 X:106610173-106610195 ACATTGCCAAATGTCCCCTGGGG - Intergenic
1195765978 X:108297528-108297550 ACATGGCCAAATGTTCCCTGGGG + Intronic
1195888476 X:109667243-109667265 ACATTGCCAGATATCCCCTGGGG - Intronic
1195996601 X:110737889-110737911 ACATTGCCAAATGTCCCCTGGGG - Intronic
1196504003 X:116419072-116419094 ACATTGGCAAATGTTTCCGGAGG - Intergenic
1196703822 X:118699237-118699259 GCATTGCTAAATGTTCCCTAGGG - Intergenic
1196754413 X:119145404-119145426 ACATTGCCCAATGTCCCCTGGGG + Intronic
1196902666 X:120401274-120401296 ACACTACCAAATGTTCCCAGGGG + Intergenic
1197042405 X:121954467-121954489 AACCTGCCAACTCTTCCCTGTGG + Intergenic
1197155143 X:123262334-123262356 ACATTGCCAAATGTCCTCTGAGG - Intronic
1197182984 X:123556603-123556625 ACATTGCCAAATGTCCCCTGGGG + Intergenic
1197271562 X:124429871-124429893 ACATTGCAAAATGTCCCTTGAGG + Intronic
1197295917 X:124718882-124718904 ACATTGCCAAATATTCCCCATGG - Intronic
1197515805 X:127426773-127426795 ACATTGCCAAATGTCCTCTGGGG + Intergenic
1197647808 X:129036845-129036867 ACATTGCCAAATGTCCCAAGGGG - Intergenic
1197837420 X:130710423-130710445 ATACTGCCAAATGTCCCCTGTGG - Intronic
1197980294 X:132211059-132211081 AAATTGCCAAATGCCCCCTGGGG - Intronic
1198477910 X:137013267-137013289 ACAGTGCTAAATGTTCCCTGGGG - Intergenic
1199159420 X:144590767-144590789 ACTTTGCAAACTGTTCCCTGTGG + Intergenic
1199213195 X:145237959-145237981 GCCTTGCAAAATATTACCTGAGG - Intergenic
1199542571 X:148973353-148973375 ACATTGCCAAATGTTCCCTGTGG + Intronic
1199583578 X:149386748-149386770 TCATTGCCAAATGTCCCCTTGGG - Intergenic
1199695199 X:150339011-150339033 ACCTAGCCAGATGTTCCCCCTGG - Intergenic
1199895330 X:152120871-152120893 ACCAGGCCAGATGGTCCCTGGGG + Intergenic
1199923528 X:152436444-152436466 ACATTGCCAAATGTCCCTGGGGG + Intronic
1200582885 Y:4972160-4972182 ACACTGCAAAATGTCCCCTGTGG - Intergenic
1201300467 Y:12500340-12500362 ACATTGCCAAGTGTTACTTGAGG + Intergenic
1201414010 Y:13729653-13729675 ACATTGCCAAAGGGACCCTGGGG - Intergenic
1201420723 Y:13795764-13795786 CCATTGCCAATTGTTCCTTGGGG - Intergenic
1201440689 Y:14005041-14005063 ACGTTGCCTAATGTGCCCTGGGG + Intergenic
1201443882 Y:14037667-14037689 ACGTTGCCTAATGTGCCCTGGGG - Intergenic