ID: 1172935434

View in Genome Browser
Species Human (GRCh38)
Location 20:38616757-38616779
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2182
Summary {0: 1, 1: 39, 2: 240, 3: 704, 4: 1198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172935434_1172935441 28 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC 0: 1
1: 39
2: 240
3: 704
4: 1198
Right 1172935441 20:38616808-38616830 AGGGATGCTTTGGCGTCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
1172935434_1172935442 29 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC 0: 1
1: 39
2: 240
3: 704
4: 1198
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55
1172935434_1172935439 9 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC 0: 1
1: 39
2: 240
3: 704
4: 1198
Right 1172935439 20:38616789-38616811 TGTCATTGTTAAAACTGAGAGGG 0: 1
1: 0
2: 4
3: 25
4: 356
1172935434_1172935440 18 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC 0: 1
1: 39
2: 240
3: 704
4: 1198
Right 1172935440 20:38616798-38616820 TAAAACTGAGAGGGATGCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1172935434_1172935438 8 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC 0: 1
1: 39
2: 240
3: 704
4: 1198
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG 0: 1
1: 4
2: 1
3: 37
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172935434 Original CRISPR GACCTTGCCAAATGTTCCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr