ID: 1172935435

View in Genome Browser
Species Human (GRCh38)
Location 20:38616758-38616780
Sequence AGACCTTGCCAAATGTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2434
Summary {0: 1, 1: 42, 2: 313, 3: 760, 4: 1318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172935435_1172935440 17 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT 0: 1
1: 42
2: 313
3: 760
4: 1318
Right 1172935440 20:38616798-38616820 TAAAACTGAGAGGGATGCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1172935435_1172935438 7 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT 0: 1
1: 42
2: 313
3: 760
4: 1318
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG 0: 1
1: 4
2: 1
3: 37
4: 309
1172935435_1172935439 8 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT 0: 1
1: 42
2: 313
3: 760
4: 1318
Right 1172935439 20:38616789-38616811 TGTCATTGTTAAAACTGAGAGGG 0: 1
1: 0
2: 4
3: 25
4: 356
1172935435_1172935442 28 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT 0: 1
1: 42
2: 313
3: 760
4: 1318
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55
1172935435_1172935441 27 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT 0: 1
1: 42
2: 313
3: 760
4: 1318
Right 1172935441 20:38616808-38616830 AGGGATGCTTTGGCGTCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172935435 Original CRISPR AGACCTTGCCAAATGTTCCC TGG (reversed) Intronic
Too many off-targets to display for this crispr