ID: 1172935437

View in Genome Browser
Species Human (GRCh38)
Location 20:38616786-38616808
Sequence TCTCAGTTTTAACAATGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172935437_1172935443 6 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935443 20:38616815-38616837 CTTTGGCGTCTAGTGGGTAGAGG 0: 1
1: 0
2: 10
3: 124
4: 573
1172935437_1172935446 12 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935446 20:38616821-38616843 CGTCTAGTGGGTAGAGGGCAGGG 0: 1
1: 20
2: 243
3: 810
4: 1373
1172935437_1172935442 0 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55
1172935437_1172935444 7 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935444 20:38616816-38616838 TTTGGCGTCTAGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 103
1172935437_1172935441 -1 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935441 20:38616808-38616830 AGGGATGCTTTGGCGTCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
1172935437_1172935445 11 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935445 20:38616820-38616842 GCGTCTAGTGGGTAGAGGGCAGG 0: 1
1: 11
2: 218
3: 717
4: 1297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172935437 Original CRISPR TCTCAGTTTTAACAATGACA AGG (reversed) Intronic
900724960 1:4210143-4210165 ACTCAGTATTAACCATCACAAGG + Intergenic
903370711 1:22833567-22833589 TGTGAGTGTTAAAAATGACAGGG + Intronic
904651459 1:32009014-32009036 TCTCTGTTTTATCAAGGAGAGGG + Intergenic
905001081 1:34670619-34670641 TTTCAATTTTAACAATGTAATGG + Intergenic
906966706 1:50464449-50464471 TCTGAGTCTTGGCAATGACAGGG - Intronic
906975732 1:50570488-50570510 TCTCATGTTTAACAGTGTCAGGG - Intronic
908753010 1:67442689-67442711 TCTCAGTTTTACCATTTACTAGG - Intergenic
909984819 1:82147964-82147986 ACACAGTTTTCACAATCACAGGG + Intergenic
910182758 1:84504209-84504231 TATCTGTTTTATCAATGACTGGG - Intronic
910522257 1:88136128-88136150 CATCAGTTTTAACAATAGCATGG - Intergenic
911524718 1:98970556-98970578 TGTCACTTTTTAAAATGACAAGG - Intronic
912066580 1:105752827-105752849 ACTCAGTATTAACCATCACATGG - Intergenic
912066773 1:105754823-105754845 ACTCAGTATTAACCATCACATGG - Intergenic
913227761 1:116714646-116714668 TCTCAGCTTTGACAGTGCCATGG + Intergenic
914725457 1:150323461-150323483 TCGTAGTTTTAATAAAGACACGG - Intronic
915173062 1:153991747-153991769 TTTCGGTCTTAACAGTGACAGGG + Intronic
915796858 1:158744550-158744572 ACTCAGTATTAACTATCACAGGG + Intergenic
916034231 1:160906611-160906633 TATCATTTTGAACAATGACAGGG - Intergenic
916146431 1:161744212-161744234 CATCAGGTTTAACAATCACAAGG - Intergenic
916797944 1:168185338-168185360 TCTCAGTTTTATCAATAAATTGG + Intronic
916883314 1:169043705-169043727 TCTCAGTGAAAACTATGACAGGG + Intergenic
918629249 1:186695826-186695848 ACTCAGTGTTAAAGATGACAAGG + Intergenic
918837028 1:189479739-189479761 GCTCTGTTTAAAAAATGACATGG - Intergenic
920452515 1:206070484-206070506 TCTATGTTTTAACAAAGGCAGGG + Intronic
920646927 1:207810740-207810762 GTTCAGTTTTACCAACGACAAGG + Intergenic
920797424 1:209153784-209153806 TTTCAGTTTTATCAATATCAAGG - Intergenic
920893245 1:210014948-210014970 TCTCAGTTTTAACTCTAATATGG - Intronic
921348125 1:214208043-214208065 TCACAGATTTAACAAAAACATGG + Intergenic
921937025 1:220804800-220804822 TCTCACTTGTAAAAATGTCATGG - Intronic
922229102 1:223670336-223670358 TCTCAATTTTAAAATTGAAAAGG + Intergenic
923715509 1:236421794-236421816 TCCCAGTTCTACCAATGTCAAGG + Intronic
924256485 1:242188325-242188347 TCTCTGTCTTAAAAATAACATGG - Intronic
1063122109 10:3112377-3112399 TCTGATTTTTCACAGTGACATGG - Intronic
1063729624 10:8681286-8681308 GCTCAGTAGTAATAATGACAAGG + Intergenic
1064612323 10:17116290-17116312 AAGCAGCTTTAACAATGACAAGG - Intronic
1065348741 10:24775423-24775445 TCTCAGTTGTCAAAATGACCAGG + Intergenic
1065739132 10:28781130-28781152 ACTCAGTATTAACCATCACAGGG + Intergenic
1066985351 10:42461319-42461341 TGTGAGGTTTCACAATGACATGG + Intergenic
1067494075 10:46746661-46746683 ACTCAGTATTAACCATCACAGGG + Intergenic
1067600587 10:47593743-47593765 ACTCAGTATTAACCATCACAGGG - Intergenic
1067700726 10:48569544-48569566 TATGAGTTTTATCAATCACAAGG - Intronic
1067991477 10:51218155-51218177 TATCTGTTATAACAATGACTAGG + Intronic
1068342859 10:55731983-55732005 TCTCAATTTGAAAAATGATAGGG - Intergenic
1069310661 10:67031976-67031998 TCTGAGTTCTAACAAAAACACGG + Intronic
1069819667 10:71219661-71219683 ACTCAGTATTAACCATCACAAGG + Intronic
1070715156 10:78714869-78714891 TCTCAGTTCTAAGATTGAGAAGG + Intergenic
1070725049 10:78781993-78782015 TCTCTGTATTTACAATGAAATGG + Intergenic
1071652120 10:87401615-87401637 ACTCAGTATTAACCATCACAGGG - Intergenic
1073362443 10:102910580-102910602 ACTCAGTATTAACGATAACAGGG - Intergenic
1074577814 10:114686968-114686990 TCTCTGATTTCAAAATGACATGG - Intergenic
1075829747 10:125398150-125398172 TCTGAATTTGAACAATGAAAAGG + Intergenic
1078215524 11:9308664-9308686 AATCAGTTTTCCCAATGACATGG - Intronic
1078707367 11:13758148-13758170 TCTCAGTTATAACAGTGAAATGG - Intergenic
1079047640 11:17121023-17121045 TCTCATTTTTAATAGTTACATGG + Intronic
1079319017 11:19434711-19434733 TCTCATTTATAACAAAGCCAAGG - Intronic
1080347878 11:31345391-31345413 TCTTTGTTTTAAGCATGACAAGG - Intronic
1080921356 11:36712611-36712633 TCTCACTTTTAATCAGGACAAGG + Intergenic
1080985504 11:37459125-37459147 TCTTTGTTTTCACAATTACATGG - Intergenic
1081323519 11:41718650-41718672 ACTCAGTATTAACTATCACAGGG - Intergenic
1081451942 11:43179531-43179553 ACTCAGTATTAACCATCACAAGG + Intergenic
1085365736 11:75941911-75941933 TCTCCTTTTTAAAAATTACATGG - Intronic
1085784030 11:79436159-79436181 TGTCAGTTTTAACATCGATAAGG - Intronic
1086212636 11:84339367-84339389 TCTCAGCTTTAACTATAAGATGG - Intronic
1086606383 11:88701228-88701250 CCACAGTTTTTACCATGACAGGG + Intronic
1086682479 11:89689822-89689844 TCACAGTTATAAAAATGGCAAGG + Intergenic
1086755485 11:90557250-90557272 TCATAGTTATAACTATGACAGGG + Intergenic
1087357469 11:97112696-97112718 TCTCAGTTTTCAGAATAATATGG - Intergenic
1087654516 11:100906120-100906142 TTTCAGTTTTAAGAGTCACAGGG - Intronic
1087965418 11:104406916-104406938 TCACAGTCTCAACAAGGACATGG + Intergenic
1088836473 11:113581948-113581970 ACTCAGTATTAACCATCACATGG - Intergenic
1090641744 11:128735206-128735228 TATCAGTAATAATAATGACAAGG - Intronic
1092067824 12:5606403-5606425 TCTCATTTTTTACAAAGAGAAGG + Intronic
1092797427 12:12126562-12126584 TCTGAGTTTAAACAATTATAAGG - Intronic
1093576314 12:20734379-20734401 TGTTAGTTGTAACAATGAAATGG + Intronic
1095755349 12:45759525-45759547 TCTCAGTTTTAAAATTGTAAAGG + Intronic
1095856686 12:46867399-46867421 ACTCAGTATTAACCATCACAGGG + Intergenic
1096938602 12:55313986-55314008 TCCCAGTTTTACAAATGGCATGG + Intergenic
1097290389 12:57909452-57909474 TTTGAGTTTTAAAAATGAAACGG + Intergenic
1098810647 12:75086006-75086028 TGTCAGTTTTAGAACTGACAAGG - Intronic
1098843982 12:75512633-75512655 TGTGAGTTTTATAAATGACAGGG + Intergenic
1099060025 12:77896554-77896576 TCTTAATTTTGACAAAGACATGG + Intronic
1099633710 12:85184318-85184340 TCTCAGTTATCATAATGAAATGG - Intronic
1099735303 12:86561260-86561282 ACTCAGTATTAACGATCACAGGG - Intronic
1100664391 12:96735474-96735496 TCTCAGTCTTAACTATGAGATGG - Intronic
1101014025 12:100480937-100480959 TCTCAGATTTAAAAATCTCATGG - Intronic
1101221715 12:102648232-102648254 TCTCAGTTTTACCAAGAATAAGG + Intergenic
1106169606 13:27277728-27277750 ACTCAGTATTAACCATAACAAGG + Intergenic
1108162045 13:47650922-47650944 ACTCAGTTTTTACTCTGACAAGG - Intergenic
1109624062 13:64951618-64951640 TCTAAGTTTTAGAAATGAAAAGG - Intergenic
1110083157 13:71343789-71343811 ACTCAGTATTAACCATCACAAGG + Intergenic
1110668736 13:78150434-78150456 ACTCAGTATTAACCATCACAAGG - Intergenic
1110927216 13:81168624-81168646 TCTCACTTTTAATAATGAGAAGG + Intergenic
1111289066 13:86139163-86139185 TCTCATTTTTAAAAATAACAGGG + Intergenic
1111371507 13:87324640-87324662 TTTCATTTTTAACATTTACAGGG + Intergenic
1111906896 13:94265604-94265626 ACTCAGTATTAACCATCACAGGG + Intronic
1112040869 13:95546756-95546778 CCTCAGTTTTCTCAATGACTAGG - Intronic
1112790701 13:102999676-102999698 CCTCTTTTTTAACCATGACAGGG + Intergenic
1112997556 13:105592860-105592882 ACTCAGTATTAACTATCACATGG + Intergenic
1112997660 13:105594166-105594188 ACTCAGTATTAACTATCACATGG - Intergenic
1114718278 14:24851869-24851891 CCTCAGTTTTCCCAATGACAGGG + Intronic
1115039921 14:28911487-28911509 TATCTATTTTAACAATGACTGGG + Intergenic
1116901413 14:50365634-50365656 ACTCAGTATTAACTATCACAGGG - Intronic
1119060214 14:71466101-71466123 ACTCAGTATTAACCATCACAGGG + Intronic
1119109306 14:71956781-71956803 ACTCAGTATTAACCATCACAAGG + Intronic
1119516052 14:75249316-75249338 TCTCAGTTTCAGCAGTTACATGG + Intronic
1119607271 14:76031209-76031231 TCTCAATTTTTAAAATGAAAGGG - Intronic
1119714108 14:76846233-76846255 TCACAGCTTTAAAGATGACAAGG - Intronic
1119990783 14:79195001-79195023 TACCAGTTTTGACAGTGACAAGG - Intronic
1119997360 14:79268029-79268051 TATCAGTTTTAAGAAAGATATGG + Intronic
1120126893 14:80754933-80754955 ACTCAGTGTTAACCATCACATGG - Intronic
1120380557 14:83773737-83773759 TCACAGTTTTAACAATGATCAGG - Intergenic
1121986602 14:98512889-98512911 TCTCAGTTTAAACAGTGAGCAGG + Intergenic
1122218818 14:100222319-100222341 TCTCAGTATTTAAACTGACAAGG + Intergenic
1125704660 15:41723070-41723092 AATCAGTTTTAACAAAGAAATGG - Intronic
1127018326 15:54714291-54714313 TCTCATTATTAACAATGCTATGG - Intergenic
1130325556 15:82876738-82876760 TCTCTGTTTTATCAGTTACAAGG - Intronic
1130790138 15:87145689-87145711 TCTCAGTTTTAAAAACCACCTGG - Intergenic
1131813894 15:96202540-96202562 TCTTAGTATAAACAATCACATGG + Intergenic
1132628801 16:906241-906263 ACTCAGTATTAACCATCACAAGG - Intronic
1132716548 16:1292865-1292887 TCTTATTTTTAGCAAAGACAGGG + Intergenic
1133585294 16:7188748-7188770 TCTTACTTTTGACAATTACAAGG - Intronic
1134570235 16:15284425-15284447 ACTCAGTATTAACCATCACAGGG - Intergenic
1134732140 16:16471628-16471650 ACTCAGTATTAACCATCACAGGG + Intergenic
1134935297 16:18240335-18240357 ACTCAGTATTAACCATCACAGGG - Intergenic
1135417091 16:22276757-22276779 GCTCGGTTTTAACACTGACTAGG - Intronic
1136711321 16:32239775-32239797 TCTCTGTTTTAACACTGAAGAGG + Intergenic
1136756586 16:32689630-32689652 TCTCTGTTTTAACACTGAAGAGG - Intergenic
1136811524 16:33180743-33180765 TCTCTGTTTTAACACTGAAGAGG + Intergenic
1136818000 16:33290823-33290845 TCTCTGTTTTAACACTGAAGAGG + Intronic
1136824564 16:33347352-33347374 TCTCTGTTTTAACACTGAAGAGG + Intergenic
1136829630 16:33446123-33446145 TCTCTGTTTTAACACTGAAGAGG + Intergenic
1138029472 16:53548622-53548644 ACTGACTTTTAACAATGATAAGG - Intergenic
1138900720 16:61265928-61265950 TCTCATTTTTAACAATTCTAAGG + Intergenic
1139001468 16:62515712-62515734 TCCTAGTTTTTGCAATGACAGGG + Intergenic
1140604653 16:76520634-76520656 TCTCAGTTTAGAAAATCACAAGG + Intronic
1141303792 16:82841934-82841956 TCTGAGTTTTGACAATGTCCAGG - Intronic
1202990102 16_KI270728v1_random:3712-3734 TCTCTGTTTTAACACTGAAGAGG + Intergenic
1203058735 16_KI270728v1_random:949984-950006 TCTCTGTTTTAACACTGAAGAGG - Intergenic
1144343864 17:14332888-14332910 TCTCAGTTGTAAAACTGAGAAGG + Intronic
1146702792 17:34976369-34976391 TCTCAGTTTTCACCGTGAAATGG - Intronic
1146811352 17:35906390-35906412 CCACAGGCTTAACAATGACATGG + Intergenic
1147493898 17:40897467-40897489 TTTCAGTTTTAACAATGCTAAGG - Intergenic
1147531618 17:41283865-41283887 TCTAGATTTTAACAATGAGAAGG + Intergenic
1149064223 17:52461032-52461054 TTTCTGCTTGAACAATGACATGG + Intergenic
1149462835 17:56846566-56846588 CCTCAGTTTTAAAAATAAAAGGG + Intronic
1150904515 17:69323516-69323538 TGTCATTATTAACATTGACATGG + Intronic
1153908756 18:9687790-9687812 TCTCAGTTATGAGAAGGACAAGG - Intergenic
1155931758 18:31715981-31716003 CCTCAGTTTTCTCATTGACAAGG - Intergenic
1156007509 18:32461191-32461213 TCTCAGTATTAAAAATTATAAGG - Intronic
1156079240 18:33314467-33314489 TCTCATTTTTAACAAGGACATGG - Intronic
1157094732 18:44678138-44678160 TCTCAGCAATAACAATGACGCGG + Intergenic
1158808455 18:61003075-61003097 ACTCAGTATAAACCATGACAAGG + Intergenic
1158824444 18:61200417-61200439 CCTCAGAATTAACATTGACAAGG - Intergenic
1159136610 18:64344056-64344078 ACTCAGTATTAACTATCACATGG + Intergenic
1159292067 18:66435749-66435771 ACTCAGTATTAACCATCACAGGG + Intergenic
1161362522 19:3858956-3858978 ACTCAGTATTAACCATCACAGGG - Intronic
1162998676 19:14352277-14352299 TCTCTGTTTTTACAGAGACAGGG + Intergenic
1164300383 19:23956910-23956932 TATTATTTTGAACAATGACAGGG + Intergenic
925455260 2:4010654-4010676 TCTCAGTTTTAAAAATAACAAGG - Intergenic
925687769 2:6491024-6491046 TCGCAGTTTTAGCAAGGACTTGG + Intergenic
926615056 2:14988796-14988818 TATCAGTTTTAGCAATGTCATGG - Intergenic
929067950 2:37999280-37999302 TCTCAGTTTCATCAATAACATGG + Intronic
930153958 2:48086456-48086478 ACTCAGTATTAACCATCACAAGG - Intergenic
930809954 2:55530027-55530049 TTGCATTTTTAACAATGATATGG + Intronic
930957430 2:57218735-57218757 TCTCAGAATTATCAATGACAAGG + Intergenic
933647650 2:84825592-84825614 TCTTTGTTGTAACAATGAAAGGG - Intronic
935814169 2:106830999-106831021 TCTCAGCTGTAACCATGACATGG + Intronic
936044283 2:109174234-109174256 TCACAGTTTTATCTATGACTGGG + Intronic
936404505 2:112190466-112190488 TTTCAGTTTTCAAAATGAGATGG + Intergenic
936483563 2:112907352-112907374 TGTGAGTTTTAACAGAGACAAGG - Intergenic
937017116 2:118616503-118616525 CCTCAGTCTTAACAGTGGCAGGG - Intergenic
939027206 2:137028314-137028336 ACCCAGTTTTAACAGTAACAGGG - Intronic
939998124 2:148939144-148939166 TCTTAGTTTTATCAATAACTTGG - Intronic
940138095 2:150461848-150461870 ACTCAGTATTAACCATCACAGGG - Intergenic
941214662 2:162690961-162690983 TCTCAGTGTTAATAAAGATAGGG + Intronic
943110436 2:183597663-183597685 TCTCAGTTTGGACAATTATATGG + Intergenic
943383778 2:187178733-187178755 ACTCAGTATTAACCATCACAAGG + Intergenic
944499261 2:200341610-200341632 CCTCAGGTTTCACAATGAAAGGG + Intronic
944860769 2:203813879-203813901 TCTCACTTTGAACTATCACAGGG - Intergenic
945245637 2:207714128-207714150 TCTCAGTTCTCAGACTGACATGG + Intronic
945425424 2:209694732-209694754 TGTCCGTTTTTACAATGACATGG - Exonic
946284275 2:218691257-218691279 TACCAGTTTTAACAATGACCAGG - Intronic
948732053 2:239971622-239971644 TCTCTGTTTTAAAAGAGACAGGG + Intronic
948978097 2:241476377-241476399 ACTCATTTTTAACAGAGACAGGG - Intronic
1169351682 20:4873187-4873209 TTTCATTTTTTATAATGACAAGG - Intronic
1172493033 20:35356659-35356681 TCTCAGTTTTAGCACTTACTAGG - Intronic
1172935437 20:38616786-38616808 TCTCAGTTTTAACAATGACAAGG - Intronic
1173087781 20:39940853-39940875 TCTCAGTGTTAAAATTGCCAGGG - Intergenic
1173454340 20:43190740-43190762 TCTCGGTCTTAACAAAGACCTGG + Intergenic
1173545223 20:43892591-43892613 TCTCAGTTTTAAAAATGGGACGG + Intergenic
1173583269 20:44162357-44162379 ACTCAGTATTAACCATCACAGGG - Intronic
1174942416 20:54944133-54944155 ACTAAGTGTTAACAATGACATGG + Intergenic
1175028023 20:55923560-55923582 ACTCAGTATTAACCATCACATGG + Intergenic
1175753113 20:61512850-61512872 TCTCAGTCTTCACAGGGACATGG + Intronic
1178067475 21:28921631-28921653 TCTCAGTTTCACCATTGTCAAGG - Intergenic
1178192774 21:30304810-30304832 TTTCCTTTTTAACAATGGCATGG - Intergenic
1179282805 21:39949562-39949584 ACTCAGTATTAACCATCACAGGG - Intergenic
1179298635 21:40086989-40087011 TCTCAGCTTTAGCACTGAAAGGG - Intronic
1180895693 22:19330550-19330572 ACGCAGTATTAACCATGACAGGG + Intergenic
1181877499 22:25951236-25951258 ACTCAGTATTAACCATCACAGGG + Intronic
1184048850 22:41989624-41989646 TGTCAGCCTTAGCAATGACAGGG - Exonic
1184305564 22:43598948-43598970 TATCAGTTTTAAAAATGGAAAGG + Intronic
1184401649 22:44277986-44278008 ACTCAGTATTAACCATCACAAGG - Intronic
1184963789 22:47951635-47951657 ACTCAGTGTTAACCATCACATGG + Intergenic
949453222 3:4210712-4210734 ACTCAGTGTTAACCATCACATGG - Intronic
951175087 3:19589858-19589880 TAACTGTTTTAGCAATGACATGG - Intergenic
956306663 3:67833947-67833969 ACTCAGTATTAACCATCACAGGG - Intergenic
956967938 3:74485501-74485523 TTTCTATTTTAACAATGGCAAGG - Intronic
957291855 3:78287494-78287516 TCTTAATTCTAACAATGGCAAGG - Intergenic
958016993 3:87949836-87949858 TCCCAGTTTGAACAATGTCTTGG + Intergenic
958525518 3:95254143-95254165 TCACATTTATAACAATGACAAGG - Intergenic
958789313 3:98632294-98632316 ACTCAGTATTAACCATCACATGG + Intergenic
959558824 3:107755793-107755815 TCTAATTTTCAACAATGAGAGGG + Intronic
960419670 3:117428310-117428332 TCTCATTTTTAGTAAAGACAAGG + Intergenic
962184099 3:133239969-133239991 ACTCTGTTTTAAGAATGAGAAGG + Intronic
964385903 3:156147546-156147568 TCTTTTTTTTAAGAATGACAGGG + Intronic
964876885 3:161377382-161377404 TCTTAGGTTTAACCATGATATGG - Intergenic
967565763 3:190970004-190970026 TCCCAATAGTAACAATGACAAGG - Intergenic
967683532 3:192393467-192393489 AATCAGTTTTAACCATGAGAAGG - Intronic
969172518 4:5375759-5375781 CCTCAGTATTAAGAATGAGACGG + Intronic
969200448 4:5600187-5600209 TCTCAGTTTTTCCAGTGAAAAGG + Intronic
970785725 4:19793891-19793913 ACTCAGTATGAACAATCACAAGG - Intergenic
970931776 4:21520272-21520294 ACTCAGTATTAACCATCACAAGG + Intronic
970955989 4:21811874-21811896 CCTCATTTGTAACCATGACAAGG - Intronic
971046715 4:22813257-22813279 ACTCAGTATTAACCATCACAAGG - Intergenic
973649891 4:52988219-52988241 TCCGAGTTTTGACTATGACATGG + Intronic
977721963 4:100249519-100249541 ACTCAGTATTAACCATCACATGG + Intergenic
978621534 4:110638045-110638067 TCTCATTTTTTAAAATGACGAGG + Intronic
979075266 4:116262650-116262672 ACTCAGTGTTAACCATCACAGGG - Intergenic
980427036 4:132639262-132639284 ACTCAGTATTAACCATCACAGGG - Intergenic
981216590 4:142176801-142176823 TCTCAGTCAAAACAATGACAGGG - Intronic
981613792 4:146624679-146624701 TCTCAGATGTACCAGTGACAAGG - Intergenic
982265778 4:153537137-153537159 ACTCAGTATTAACCATCACAGGG + Intronic
982912189 4:161157331-161157353 TATCAGTTTTAACAATTTCATGG + Intergenic
982971474 4:161993256-161993278 GCTCCATTTTAAAAATGACAAGG + Intronic
983250163 4:165334978-165335000 TGTCATTTTGAATAATGACAAGG - Intronic
983506534 4:168558898-168558920 TCTCTGTTTATAAAATGACAAGG + Intronic
984451976 4:179914069-179914091 ACTCAATATTAACAATTACATGG - Intergenic
984885737 4:184447787-184447809 TGACACTTTTGACAATGACAAGG - Intronic
984913174 4:184694713-184694735 TCTCAGTTATAACAGTGAAGTGG + Exonic
984980768 4:185278420-185278442 CCTCAGTTTTAACTGTGAAATGG + Intronic
985424604 4:189817290-189817312 TCTCAGTTTTAAGGATGAAGAGG - Intergenic
987621367 5:20341117-20341139 ACTCAGTATTAACCATCACAAGG - Intronic
987867020 5:23555400-23555422 TCTCTTTTTTAACAATTACTTGG + Intergenic
988448966 5:31320560-31320582 TGCCAGTGTGAACAATGACACGG - Intronic
988561657 5:32287155-32287177 ACTCAGTATTAACCATCACATGG - Intronic
988565630 5:32318162-32318184 ACTCAGTGTTAACCATCACAGGG + Intergenic
989129925 5:38097430-38097452 TCTCAGTTTAAACACTTACATGG + Intergenic
990758545 5:59102791-59102813 TCTGTGTTTTAACAAGGGCATGG + Intronic
991219478 5:64196064-64196086 TATCAGTTATAAAATTGACAAGG - Intronic
991236550 5:64406033-64406055 TTGCAGCTTTAACAATCACAAGG - Intergenic
992970851 5:82056281-82056303 TCTCAGATTTTTCAATTACATGG - Intronic
993542796 5:89173156-89173178 ACTCAGTATTAACCATCACAGGG - Intergenic
993633474 5:90315887-90315909 CCTCAGTTTTTACACTGTCAAGG + Intergenic
993826490 5:92693774-92693796 CCCCAGTCTTAATAATGACAGGG + Intergenic
994044116 5:95289025-95289047 TCTCAGCTTCAACAATGGCAAGG + Intergenic
995170751 5:109108891-109108913 TCTCAATTTTAAAAATTACTGGG + Intronic
996332065 5:122341167-122341189 TGTCAATTTTAAGAAAGACAAGG - Intronic
999811094 5:155127737-155127759 TCTCCATTTTAACAAAGAGAGGG + Intergenic
1000111892 5:158116029-158116051 TATGAGTTTTGACAATGGCATGG - Intergenic
1002633173 5:180594285-180594307 TCTCCGTTTCACCACTGACAGGG + Intergenic
1003324183 6:5080379-5080401 TCCCAGTATGACCAATGACAAGG - Intergenic
1004286299 6:14323898-14323920 TCACAAGTTTAACACTGACAGGG + Intergenic
1004573625 6:16871649-16871671 GGACAGTTTTAGCAATGACATGG + Intergenic
1006994787 6:38248956-38248978 TCTCAAATTTCACAGTGACATGG - Intronic
1007331472 6:41113341-41113363 ACTCAGTATTAACCATCACATGG + Intergenic
1008196976 6:48536499-48536521 TATAAGTTTTGACAATAACATGG + Intergenic
1010868052 6:81004959-81004981 ACTCAGTATTAACCATCACAGGG - Intergenic
1011060320 6:83258590-83258612 TGTCACATTTAACAATGCCACGG - Intronic
1011752361 6:90465976-90465998 ACTCAGTATTAACCATCACAAGG + Intergenic
1012344112 6:98166612-98166634 ACTCAGTATTAACGATCACAGGG - Intergenic
1013141718 6:107342925-107342947 TCTAGGTTTTAACATTGAAAGGG - Intronic
1013584170 6:111564024-111564046 TCTCAGTTATAAAAATGAATTGG - Intronic
1013941244 6:115665788-115665810 TCTCTTTTTTACCATTGACAAGG + Intergenic
1013963528 6:115928598-115928620 TCTCAATATTAACAATTTCAAGG + Intergenic
1015646380 6:135393468-135393490 TCCTAGTTATAAGAATGACAAGG + Intronic
1017577651 6:155822739-155822761 TCTCAGTTTAAACAGAGAGAAGG - Intergenic
1017786952 6:157764293-157764315 CCTCAGTTTTACCAAGGAAAAGG - Intronic
1018190791 6:161307650-161307672 ACTCAGTATTAACCATCACAAGG + Intergenic
1018461289 6:164001420-164001442 TCTAAGTTTTAGCTATGTCATGG + Intergenic
1018491729 6:164300910-164300932 TCTGTGTTTTCACAATGTCATGG - Intergenic
1019036912 6:169068918-169068940 TCTCATTTTTATCACTTACACGG + Intergenic
1021118311 7:16768703-16768725 TATCAGTTTTCAAAATGAGAAGG + Intronic
1021861665 7:24911954-24911976 TCCCAATGCTAACAATGACATGG + Intronic
1022747812 7:33190461-33190483 CTTCAGTTTTACCAAAGACAAGG - Intronic
1022785769 7:33635293-33635315 TCCCAGTTTTAACCATCCCAGGG - Intergenic
1023180314 7:37475689-37475711 ACTCAGTGTTAACCATCACAGGG + Intergenic
1024620912 7:51157064-51157086 TCAGAGTTTTAACAAGGCCAGGG + Intronic
1027974892 7:85139693-85139715 TGTCAATTTTAACTATGACATGG + Intronic
1028143806 7:87299371-87299393 ACTCAGTTTTAAAAAGGAAATGG - Intergenic
1028674935 7:93448222-93448244 CCCCAGTTTTACCAATGAGAGGG - Intronic
1031328520 7:120433225-120433247 TCTCAGTATTAACAGTGCCTGGG - Intronic
1031815937 7:126435293-126435315 TATCTGTTTTAAGAGTGACAAGG - Intergenic
1032135226 7:129270667-129270689 ACTTAGTTTTAACAACCACATGG + Intronic
1035997409 8:4563448-4563470 TCTCACATTCAACAATGCCAAGG + Intronic
1036199798 8:6760028-6760050 TCTAAATTTTAAAAATCACATGG - Intergenic
1036957863 8:13209947-13209969 TCTCATATTTAACATTTACAGGG - Intronic
1037695677 8:21221905-21221927 ACTCAGTATTAACCATCACAGGG - Intergenic
1038976572 8:32703638-32703660 TCTTACTTTTACCCATGACATGG + Intronic
1039306802 8:36272141-36272163 ATTCAGTTTTATCAAGGACATGG - Intergenic
1039320563 8:36425645-36425667 ACTCAGTATCAAAAATGACAGGG + Intergenic
1043403348 8:79905511-79905533 TCTCTGTTTCAACTATGACTTGG + Intergenic
1044044338 8:87412277-87412299 TCTTAGTTTTAACATTTAGAAGG - Intronic
1044286539 8:90416869-90416891 ACTCAGTATTAACCATTACAGGG + Intergenic
1050467310 9:5941459-5941481 TCTCACTTTTAACAAATACCTGG + Intronic
1051547858 9:18296397-18296419 TCTTAGATTTGATAATGACATGG + Intergenic
1052221159 9:26024514-26024536 TTTCAGTTTTAACTTTGACCAGG + Intergenic
1052725299 9:32221699-32221721 GCTCAGTATTAACCATCACAGGG + Intergenic
1053169422 9:35868144-35868166 ACTCAGTATTAACCATCACAAGG - Intergenic
1057635742 9:96764561-96764583 TTTCAGTTTTGACAATCATAAGG - Intronic
1058330474 9:103754029-103754051 ACTCAGTATTAACCATCACATGG - Intergenic
1059680192 9:116578293-116578315 TCCTAGTTTTAACAATGATGGGG - Intronic
1060258770 9:122055614-122055636 ACTCAGTATTAACCATCACAAGG + Intronic
1061526077 9:131163864-131163886 TTTCAGTTTTGACAGTGACCTGG + Exonic
1186004140 X:5049687-5049709 GCTCAGTGTTAACCATCACAGGG - Intergenic
1186616458 X:11193468-11193490 TCTCAGTGTTGACATGGACAGGG + Intronic
1186977743 X:14926287-14926309 TCTCAGATTCAGCAATGAAAGGG - Intergenic
1186985514 X:15009604-15009626 TGTTTGTTTTAACCATGACAGGG + Intergenic
1187061131 X:15788375-15788397 ACTCAGTTTTCACAATAAAAGGG + Intergenic
1187138365 X:16570198-16570220 GCTCAGTTCCAACAAGGACAAGG - Intergenic
1188106166 X:26149793-26149815 TCTCTGGTTTACCGATGACAAGG - Intergenic
1188341297 X:29005270-29005292 CCTCAGGTTTGACAATGATAAGG + Intronic
1189645071 X:43119301-43119323 ACTCAGTATTAACCATCACAGGG + Intergenic
1190098747 X:47504174-47504196 ACTCAGTATTAACCATCACAGGG + Intergenic
1191658919 X:63630814-63630836 ACTCAGTATTAACCATTACAGGG + Intergenic
1193489102 X:82126001-82126023 TCCCAGTTTGATGAATGACATGG + Intergenic
1194150033 X:90312702-90312724 TCTCATTTTTAATCATGAGAGGG + Intergenic
1195202871 X:102566556-102566578 CCTCAGTGTTTACCATGACAAGG + Intergenic
1195872180 X:109497995-109498017 ACTCAGTATTAACCATCACAGGG - Intergenic
1195881507 X:109597446-109597468 ACTCAGTATTAACCATCACATGG - Intergenic
1197082578 X:122437716-122437738 ACTCAGTATTAACCATCACAGGG + Intergenic
1197246692 X:124173841-124173863 TCTCAGTTTTAGGAAAGACCAGG + Intronic
1197329000 X:125130390-125130412 TCATAGTGTTATCAATGACAAGG + Intergenic
1197477844 X:126945490-126945512 ACTCAGTATTAACCATCACAAGG + Intergenic
1197711230 X:129670502-129670524 TACCAGTTTGAAGAATGACAGGG - Intergenic
1197935071 X:131731735-131731757 TCTCATTAGTAACAAAGACATGG + Intergenic
1197936998 X:131749890-131749912 TCTCATTATTAACAAAGCCATGG + Intergenic
1198660805 X:138965984-138966006 ACTCAGTATTAACGATCACAGGG - Intronic
1198814185 X:140569607-140569629 CCTAATTTTTAACAAGGACATGG + Intergenic