ID: 1172935438

View in Genome Browser
Species Human (GRCh38)
Location 20:38616788-38616810
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172935428_1172935438 25 Left 1172935428 20:38616740-38616762 CCAGAATGATGGTGTTCCCCAGG No data
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG No data
1172935433_1172935438 9 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT No data
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG No data
1172935435_1172935438 7 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT No data
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG No data
1172935434_1172935438 8 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC No data
Right 1172935438 20:38616788-38616810 TTGTCATTGTTAAAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type