ID: 1172935442

View in Genome Browser
Species Human (GRCh38)
Location 20:38616809-38616831
Sequence GGGATGCTTTGGCGTCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172935434_1172935442 29 Left 1172935434 20:38616757-38616779 CCCAGGGAACATTTGGCAAGGTC 0: 1
1: 39
2: 240
3: 704
4: 1198
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55
1172935435_1172935442 28 Left 1172935435 20:38616758-38616780 CCAGGGAACATTTGGCAAGGTCT 0: 1
1: 42
2: 313
3: 760
4: 1318
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55
1172935433_1172935442 30 Left 1172935433 20:38616756-38616778 CCCCAGGGAACATTTGGCAAGGT 0: 2
1: 27
2: 207
3: 590
4: 1095
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55
1172935437_1172935442 0 Left 1172935437 20:38616786-38616808 CCTTGTCATTGTTAAAACTGAGA 0: 1
1: 0
2: 2
3: 22
4: 314
Right 1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172935442 Original CRISPR GGGATGCTTTGGCGTCTAGT GGG Intronic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
906153596 1:43601571-43601593 GGGATGCTTTGGCGGGTGGAAGG + Intronic
909021959 1:70441392-70441414 GAGTTGCTTTGGCCTCTAGATGG + Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
1063886628 10:10586569-10586591 GGGAAGCTATGCCGTGTAGTGGG + Intergenic
1069355083 10:67575655-67575677 GAGATTCTTTGGATTCTAGTGGG + Intronic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1084508614 11:69587365-69587387 GGGATGCTTTGGGTTTTAGCAGG - Intergenic
1087725532 11:101711956-101711978 GGATTGCTTTGGTGTCTATTTGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1092007495 12:5081578-5081600 GGTATGCTTTGGCGTGGAATAGG + Intergenic
1099087098 12:78258702-78258724 TGGAGGCTTTGGCTTCTATTAGG - Intergenic
1102229999 12:111256026-111256048 GGGGTGCTTTGGGGTCTGGGTGG - Intronic
1112576751 13:100642959-100642981 GGGATGTTTTGGCTTCTTGTTGG - Intronic
1114810956 14:25898897-25898919 GGGATGCTTGGGCTTTTAGTTGG - Intergenic
1117305323 14:54468365-54468387 GGGATCCTTTGAAGTCTAGGTGG - Intergenic
1122018009 14:98813277-98813299 GGCAGGCTCTGGCCTCTAGTTGG - Intergenic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1141443170 16:84042388-84042410 AGGTTGCCTTGGGGTCTAGTGGG - Intronic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1149359058 17:55873963-55873985 GGAATGGTATGGCGTCTACTGGG - Intergenic
1150132122 17:62674941-62674963 GGGAGGCTTTGGGGTCCAGGTGG - Intronic
1159060068 18:63505464-63505486 GGGATGCTTTGGGGTTTTTTGGG - Intergenic
1165108067 19:33486240-33486262 GGGTTGGTTTGGGGGCTAGTGGG - Intronic
932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG + Intronic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
939615945 2:144362292-144362314 TGGATGCTTTGGGGTCTGATGGG - Intergenic
946009816 2:216555479-216555501 GGGCTGCTTTGGCTTCTTGTGGG - Intronic
946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG + Intergenic
948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG + Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174978951 20:55369998-55370020 GGGATGCTCTGGTGCCTGGTGGG - Intergenic
1179086568 21:38223451-38223473 GGGATGCTGTGAAATCTAGTTGG + Intronic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
950142811 3:10627127-10627149 GGGAAGCTTTGGCATCTGGCAGG - Intronic
954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG + Exonic
960621817 3:119644441-119644463 GGGATGATTTGGGGTCTGGCTGG + Intronic
960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG + Intronic
970162440 4:13202556-13202578 GTGATGCTTTTGCCTCTAGCGGG - Intergenic
985021591 4:185697147-185697169 GGGATGCTTTGCTGTCTAGCGGG - Intronic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1000298975 5:159937960-159937982 GGGAAGCTTTGGCCTCCAGTGGG - Intronic
1004205477 6:13587875-13587897 GGTAGGCTTTGGGGTCCAGTGGG + Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011904603 6:92348689-92348711 GAGATGCTTTAGAGTCCAGTGGG - Intergenic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1029891585 7:103935582-103935604 GGGATCCTTTGGCATGTAGATGG - Intronic
1032705044 7:134414274-134414296 GGGATGCTTTGAAGTCCAGATGG - Intergenic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1047437531 8:124847280-124847302 GGGAAGCTTTGGCGTGTGTTGGG + Intergenic
1048283041 8:133119473-133119495 GGGAAGATTTGGTGTCTAGTAGG + Intronic
1052455494 9:28691827-28691849 GCTATGCTTTGGCATATAGTAGG - Intergenic
1056132004 9:83596475-83596497 AGGATGATTTGGCATATAGTTGG - Intergenic
1059460372 9:114425838-114425860 GAGATGCTTTGGGGTGTATTTGG - Intronic
1061683508 9:132256768-132256790 AGGATGCTATGGCGTCTCATGGG - Intergenic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG + Intergenic
1191867831 X:65719837-65719859 GGCATGATTTGGAGCCTAGTGGG + Intronic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1195732174 X:107978967-107978989 TGGATGCTCTGGCAACTAGTGGG + Intergenic
1200747281 Y:6913305-6913327 GTGGGGCTTTGGAGTCTAGTTGG + Intronic